ID: 1156399567

View in Genome Browser
Species Human (GRCh38)
Location 18:36728258-36728280
Sequence GGCCTCCAGCACCACAGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156399562_1156399567 -1 Left 1156399562 18:36728236-36728258 CCCAGCAGTGCCCGGAGAAGCAG 0: 1
1: 0
2: 1
3: 24
4: 198
Right 1156399567 18:36728258-36728280 GGCCTCCAGCACCACAGTATTGG 0: 1
1: 0
2: 0
3: 10
4: 116
1156399563_1156399567 -2 Left 1156399563 18:36728237-36728259 CCAGCAGTGCCCGGAGAAGCAGG 0: 1
1: 0
2: 3
3: 23
4: 244
Right 1156399567 18:36728258-36728280 GGCCTCCAGCACCACAGTATTGG 0: 1
1: 0
2: 0
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156399567 Original CRISPR GGCCTCCAGCACCACAGTAT TGG Intronic
900307063 1:2015732-2015754 GGGCTCCAGCACCAGATTGTGGG - Intergenic
901024544 1:6272171-6272193 GGCCTCCAGCAGGACAGGAAGGG - Intronic
901064154 1:6486680-6486702 TGACTCCAGCACCAGAGTCTGGG - Intronic
902744684 1:18465772-18465794 GGCCTCCAGCACCACAGAGAAGG + Intergenic
903161959 1:21495427-21495449 GGCCACCAGCTCCAGAGTGTGGG - Intergenic
903706140 1:25287280-25287302 AGCCTCCTGCCCCACAGTCTAGG + Intronic
903721098 1:25406094-25406116 AGCCTCCTGCCCCACAGTCTAGG - Intronic
906868299 1:49447392-49447414 GGGCTGCAGCAACACAGCATTGG - Intronic
910494772 1:87814540-87814562 GGCCTTCAGCCCCACAGCAATGG + Intergenic
911364651 1:96922335-96922357 GCCATCCAGCACTACAATATAGG - Intergenic
913490056 1:119370740-119370762 GGCCTTCAGAAACACAGTCTGGG + Intronic
915225453 1:154407838-154407860 GCCTTCCAGCACCAGAGTGTTGG - Intronic
915238333 1:154502030-154502052 GGCCTCCAGCGCCCCAGTCACGG - Exonic
915615640 1:157035724-157035746 GCCCTCCAGCCCCAGAGTTTGGG + Intronic
916060312 1:161093724-161093746 GAAATCCAGGACCACAGTATGGG + Intergenic
919844962 1:201636246-201636268 TCCCTCCAGCACCACTGAATGGG + Intronic
1069756931 10:70779151-70779173 GGCTTCCAGCACCTCAGTGGTGG + Intronic
1075514454 10:123097998-123098020 GGCCACCAGAACCCCAGAATTGG + Intergenic
1076264014 10:129094797-129094819 GACCTCCAGGACCACTGCATGGG + Intergenic
1076747833 10:132523219-132523241 AGCCTCCAGGACCACAGCAGAGG - Intergenic
1077194453 11:1272304-1272326 GGCCTGCAGCACCCCAGGGTGGG + Intergenic
1078733051 11:13993304-13993326 GGGTTCCAGCACAACAGCATTGG + Intronic
1080326135 11:31075892-31075914 GCACTCCAGCACTCCAGTATGGG - Intronic
1081813937 11:45928347-45928369 GGCATCCAGCTCCACAATGTGGG - Exonic
1083427188 11:62594273-62594295 GGCCACAAACACCACAGGATTGG + Exonic
1083734097 11:64669858-64669880 GGCCTGCAGAAGCACAGTGTTGG - Intronic
1084042598 11:66550969-66550991 GGCCACCAGCACCCCAGCCTTGG - Intronic
1084585697 11:70060803-70060825 GGGCTCCAGCAGCACAGCCTTGG + Intergenic
1085869763 11:80335566-80335588 GGCCTGCAGCACCAAGTTATAGG + Intergenic
1092230433 12:6772936-6772958 GACCTCCAGCCCCACAGGAGGGG + Intronic
1097356787 12:58611187-58611209 GACCCGCAGCAACACAGTATGGG - Intronic
1098226549 12:68330853-68330875 GGCCTCCATCACAACTGTTTCGG - Intronic
1101897967 12:108770079-108770101 GGCCACCAGCCCCACGGTACAGG + Intergenic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1103705481 12:122868988-122869010 GGCCTCCACCACCACAGAGGAGG + Intronic
1106308768 13:28535032-28535054 GGCCTCCAGCTCCACAGAGCAGG + Intergenic
1113121165 13:106924956-106924978 GGACTGCAGCACCAGAGTGTGGG + Intergenic
1116154685 14:41188033-41188055 GGCCTCAACCAGCACAGTGTAGG - Intergenic
1123919439 15:25060153-25060175 GGTCTCCACCACCACACCATGGG - Intergenic
1124237277 15:28001765-28001787 GTCCTCCAGCACCACATTCTGGG - Intronic
1131272742 15:90956997-90957019 GGCCGCCAGCCCCACATTCTGGG + Intronic
1131272828 15:90957281-90957303 GGCCTCGGGCACCACATTCTGGG - Exonic
1133550872 16:6853477-6853499 GTCCTCGAGCACCACACTGTAGG - Intronic
1133932256 16:10242136-10242158 GGCCTCCAGCACCAAGGCAATGG - Intergenic
1135880862 16:26254872-26254894 GGCCTCCAGCTCCATTGTAAGGG - Intergenic
1139697318 16:68684475-68684497 GGCCTCAAGCCCCTCAGTATTGG + Intronic
1141158472 16:81612937-81612959 AGCCACCAGCAGGACAGTATGGG + Intronic
1141963006 16:87421800-87421822 GGCCTCCAGGACCCCACTAAGGG + Intronic
1142153573 16:88523278-88523300 GGCCTGCAGCACCAGAGAAAGGG + Intronic
1142259167 16:89034566-89034588 GGCCTCCACCACCACTGAAGAGG - Intergenic
1143729132 17:8870483-8870505 GGTCTGCAGGACCACAGTATTGG + Intergenic
1145289824 17:21534332-21534354 GGGCTCCAGCATCACAGTGAAGG + Exonic
1145779296 17:27551782-27551804 TGCCTCCAGCACCACGGTCCAGG + Intronic
1148153961 17:45412154-45412176 GGGCTCCAGCCCCAAACTATAGG + Intronic
1152424524 17:80211652-80211674 GGTCCCCAGGCCCACAGTATCGG + Intronic
1152655650 17:81518096-81518118 GGCCTCCAGCACCAGGGGAAGGG - Intronic
1153749138 18:8211237-8211259 GGCCTCCTGCACAACAGGAAGGG + Intronic
1154030886 18:10753385-10753407 GACCTCCAGAAACAGAGTATTGG - Intronic
1155900462 18:31382780-31382802 AGCCTCCATCAGCACAGCATAGG + Intronic
1156399567 18:36728258-36728280 GGCCTCCAGCACCACAGTATTGG + Intronic
1157772760 18:50364243-50364265 CTCATCCAGCACCACAGTACTGG - Intergenic
1158546762 18:58404060-58404082 GCCCTCCAGGCCCACAGTACTGG - Intergenic
1166368324 19:42288370-42288392 GGCCCCCAGCACCATAGTTGGGG + Intronic
1167095532 19:47373251-47373273 GGCCCCCAGCACTACACTACAGG - Intronic
1167121660 19:47521008-47521030 AGCCTCCAGCACCACCGGACAGG + Exonic
1168303317 19:55419468-55419490 GGCCTCCAGCTCCACAGAGCAGG + Intergenic
929426945 2:41853512-41853534 GGACTCCAGGACCTCAGAATTGG - Intergenic
933553339 2:83802799-83802821 CTCCACCAGCACCACAGTGTGGG + Intergenic
935518867 2:104078815-104078837 GGCCTCCAGCACCACAGAGCAGG - Intergenic
937859973 2:126700096-126700118 GGCCTCCAGCTCCACAGGCAGGG - Intergenic
940823881 2:158387925-158387947 GGGCTCCAACACCATAGTTTGGG + Intronic
946321195 2:218955495-218955517 GCCCTCCAGCATCTCAGCATTGG + Intergenic
948056552 2:235012941-235012963 GGCCTCCAGCCCCACAGCCTAGG - Intronic
948136848 2:235642878-235642900 GGCCCCAAACACCACAGTCTAGG - Intronic
1169695811 20:8385525-8385547 GGCCACCAGCACCACAGCTGTGG - Intronic
1170434758 20:16314960-16314982 AGCTTTCAGCACCACAGCATCGG - Intronic
1170891376 20:20378887-20378909 GTCCACCAGCACCACTGTAAGGG - Intergenic
1173524605 20:43721972-43721994 GGCCTCCAGCTCCACAGAGCAGG - Intergenic
1175771772 20:61628601-61628623 GGCCTCCAGCCCCACAGGCCGGG + Intronic
1179483749 21:41695414-41695436 GTGCTCCAGCACCACAGTGTAGG + Intergenic
1181964501 22:26647187-26647209 GCCCTCCAGAACCGCAGCATTGG + Intergenic
1183618867 22:38961283-38961305 GGCCTCCAGCACGAAATTAGAGG - Intronic
1183624070 22:38991228-38991250 GGCCTCCAGCACGAAATTAGAGG - Intronic
1184629963 22:45769437-45769459 GGCCCCCAATGCCACAGTATAGG + Intronic
1184807272 22:46803261-46803283 GCCCTCCAGCCCCACAGTGAGGG + Intronic
949332691 3:2939808-2939830 GGGCTCCAGCACAACAGTGCAGG - Intronic
950305861 3:11915017-11915039 GGGCTCCAGCTCCACTGTAAAGG + Intergenic
952716601 3:36486302-36486324 GGCCTCAGGCACTGCAGTATGGG + Intronic
963361235 3:144274475-144274497 GGACTCCAGCACAACAGTGGTGG + Intergenic
967424067 3:189305919-189305941 GGCCTCCATTCCCACAGTAGTGG - Intronic
968504845 4:966985-967007 GACCTCCAGCACCACAGAGCGGG + Exonic
968747992 4:2370810-2370832 GGCGCCCAGCATCACAGTGTGGG - Intronic
975294144 4:72712625-72712647 GGCCTCAAGCAGCACACTTTGGG + Intergenic
981272155 4:142857672-142857694 GCCATCCAGGACCACAGTCTTGG + Intergenic
984172826 4:176381190-176381212 GGCCTCCATCACCTCATTTTGGG + Intergenic
986680933 5:10232362-10232384 GGCCTCCAGCACCGCAGCACTGG - Intronic
992219722 5:74560002-74560024 GGGCTCCAGCTGCACATTATTGG - Intergenic
996527282 5:124492382-124492404 GGCGACCAGCACCACAGTTGCGG - Intergenic
1001110923 5:168895581-168895603 GGCCTCCAGAAGCCCAGTAACGG + Intronic
1001330127 5:170755975-170755997 GGACCCCAGCACCACAGATTCGG - Intergenic
1001387972 5:171355582-171355604 TCCCTCCAGCACGATAGTATTGG + Intergenic
1001949405 5:175805811-175805833 GACCTCCAACTCCACAGCATGGG + Intronic
1004237834 6:13890284-13890306 GACCTCCAGTACCTCAGAATTGG - Intergenic
1005082771 6:21973453-21973475 AGCATCCAGCAACAGAGTATAGG - Intergenic
1008244289 6:49150961-49150983 GGCGACCAGCACCACAGTTGTGG - Intergenic
1008639020 6:53442659-53442681 GGGCTCCAGGTCCACAGTATAGG - Intergenic
1009610273 6:65931524-65931546 GGCCTCCCTCTCCACAGAATGGG - Intergenic
1014545212 6:122727264-122727286 CACCTCCACTACCACAGTATTGG - Intergenic
1014603940 6:123448737-123448759 GGCCTCCTGCACCAAAGTGCAGG - Intronic
1016372653 6:143391140-143391162 GGCCTCCAGAACCACACCATAGG - Intergenic
1018945998 6:168346905-168346927 GGCCTCCAGGACCAGAATTTGGG - Intergenic
1019201236 6:170317889-170317911 GGCCTCCAGCATAACTGTCTTGG + Exonic
1021048478 7:15953129-15953151 GGCATCCACCACCACAGCTTTGG - Intergenic
1026795163 7:73361629-73361651 AGCCTCCTGCCCCACAGCATAGG + Intergenic
1029453948 7:100657862-100657884 GGCTCCCAGTACCACAGTTTTGG + Intergenic
1034535541 7:151723713-151723735 GGGCTCCCTCACCACAGTCTTGG + Intronic
1034716071 7:153243432-153243454 GGCCTCCACCCCCATAGTTTGGG + Intergenic
1041292195 8:56318627-56318649 GGGCTCCAGCACCTCAGCAGTGG + Intronic
1046121223 8:109849181-109849203 AGCATCCAGCCCAACAGTATTGG - Intergenic
1046914930 8:119669982-119670004 GGCATCCAGAACCTCAGAATGGG - Intronic
1049928909 9:437308-437330 GGCTTCCCACACCACAGTTTAGG + Intronic
1054881689 9:70150954-70150976 GACCTCAAAAACCACAGTATGGG - Intronic
1059912427 9:119059968-119059990 GGCCACCTTCAGCACAGTATCGG + Intergenic
1061216254 9:129223702-129223724 TGACTCCAGCACCACAGCAAAGG - Intergenic
1061797920 9:133099038-133099060 GGCAGCCAGCACTGCAGTATGGG - Intronic
1199436211 X:147815417-147815439 GACCTTCAGCACCACGGTCTGGG + Intergenic
1201362610 Y:13169756-13169778 TTCCTCTAGCACCACTGTATTGG - Intergenic