ID: 1156401660

View in Genome Browser
Species Human (GRCh38)
Location 18:36745210-36745232
Sequence CTGCTCGGTGCACCTGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156401660_1156401666 -8 Left 1156401660 18:36745210-36745232 CCTCTGCCAGGTGCACCGAGCAG 0: 1
1: 0
2: 2
3: 12
4: 166
Right 1156401666 18:36745225-36745247 CCGAGCAGGGGACCCTGAACTGG 0: 1
1: 0
2: 0
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156401660 Original CRISPR CTGCTCGGTGCACCTGGCAG AGG (reversed) Intronic
900403069 1:2480570-2480592 GTGGTCGGGGCACCTGGCACAGG + Intronic
900572338 1:3364797-3364819 CTGCTCGGGGCACCTGGCTGAGG - Intronic
901853877 1:12031858-12031880 CTCCTGGGTGCGCCTGCCAGAGG - Exonic
904048548 1:27623960-27623982 CAGGGTGGTGCACCTGGCAGGGG - Intronic
907364355 1:53946522-53946544 CCGCTCGCTGCCCCGGGCAGGGG + Exonic
907493560 1:54826382-54826404 CTGCTGGGTCCAGCTGGCATTGG + Intronic
909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG + Intergenic
910368063 1:86487590-86487612 CTGCCCTGTGCTCCTTGCAGTGG + Intronic
910427204 1:87129884-87129906 CTGCTCCGTGGACCTCCCAGCGG + Intronic
919135118 1:193497930-193497952 GTGCTCTGTGCAGCTGCCAGTGG + Intergenic
919972750 1:202591475-202591497 CTACTTGGTGCAACTGGCTGGGG + Exonic
921924452 1:220699876-220699898 CTGCACGTTGCATCTGCCAGTGG + Intergenic
923865361 1:237933673-237933695 ATGGTCTGAGCACCTGGCAGGGG + Intergenic
924354910 1:243162329-243162351 CTGCCCTGGGCACATGGCAGTGG - Intronic
1063724144 10:8618166-8618188 CTGCTCTATTCAACTGGCAGTGG + Intergenic
1069773910 10:70915936-70915958 CTGCCTGGAGCACCTGACAGAGG + Intergenic
1070171607 10:73937316-73937338 CTGCTAGATGCTCCTGGAAGAGG - Intergenic
1070391700 10:75976554-75976576 ATGCCCCCTGCACCTGGCAGAGG + Intronic
1070934430 10:80282296-80282318 CTCCTCGTTGCTCCTGGCTGCGG - Intronic
1072679863 10:97498869-97498891 TCGCTCGGGGCACCAGGCAGGGG - Exonic
1076235563 10:128861450-128861472 CCACTTGGTGCACGTGGCAGTGG - Intergenic
1076730883 10:132438347-132438369 CTCATGGGTGCACCTGGCAGGGG - Intergenic
1077167304 11:1149562-1149584 CTGCACTGTGCACCCAGCAGTGG - Intergenic
1079080124 11:17408206-17408228 CTGCCCTGGGCACCTGGCACAGG + Intronic
1079494622 11:21027867-21027889 TTGCTGGGTGGGCCTGGCAGTGG + Intronic
1082191999 11:49257185-49257207 CTGCACTTTGCACATGGCAGTGG - Intergenic
1083771326 11:64869333-64869355 CTGCTCGCCCCACCTGGCTGTGG - Intronic
1084174811 11:67417655-67417677 CTGTGCGGGGCACCTGGCCGCGG - Exonic
1084858366 11:72003061-72003083 CTGGTGGGAGCACCTGCCAGAGG - Exonic
1089616377 11:119697027-119697049 CTGCCCGCTGCAGCGGGCAGAGG + Intronic
1090654946 11:128835969-128835991 CAGCTGGGTGCATCTGGCTGGGG + Intergenic
1091335244 11:134761670-134761692 CTTCACTGTGCATCTGGCAGAGG - Intergenic
1092091794 12:5809701-5809723 GTGCACGGTGCAGCTGGAAGTGG + Intronic
1092122908 12:6057056-6057078 CTCCTCGGAGAACCTGGCTGTGG + Exonic
1096113366 12:49041426-49041448 CTGCCCAGTGCCCCTGGCTGCGG + Exonic
1096651525 12:53064206-53064228 CAGCTGGGTGGAACTGGCAGGGG - Exonic
1096837969 12:54363227-54363249 CTGCTCGTTTGACCTGGCGGTGG + Exonic
1098352220 12:69574816-69574838 CAGCTCTGTGCGCCTGGTAGGGG - Exonic
1099113129 12:78587224-78587246 CTGCTCATTGCAACTGCCAGTGG - Intergenic
1101897925 12:108769818-108769840 CTCCTGGGTGGACCAGGCAGGGG - Intergenic
1103433417 12:120906270-120906292 CTGGTCCTGGCACCTGGCAGTGG - Intergenic
1103761056 12:123250741-123250763 CTGTTCGGTGGAGGTGGCAGAGG + Intronic
1110558285 13:76885225-76885247 CTGGTCGGTGCTGCTGGCAAAGG + Exonic
1114502749 14:23183260-23183282 CTGCTCTGTGCACCAGGCAGTGG + Exonic
1115754318 14:36517909-36517931 CTGCGCGGCGCGCTTGGCAGCGG + Exonic
1119781477 14:77279077-77279099 GTGCTTGGTGCACCTGCCATTGG - Intronic
1121275632 14:92665897-92665919 CTGCCCGGATCACCTGCCAGGGG - Intronic
1122954425 14:105063739-105063761 CTGCTCCCTGCACATGGCAGGGG - Intronic
1123036337 14:105473484-105473506 ATGCCTGGTGCACCAGGCAGAGG + Exonic
1124066335 15:26347380-26347402 TTGCTCTGTGCACCTGGATGGGG + Intergenic
1124983502 15:34584150-34584172 CTGCCCGGTGCAGCTGTAAGCGG + Intronic
1127261151 15:57327133-57327155 CTCCTCCGTGCAGCTGCCAGGGG - Intergenic
1128242244 15:66108967-66108989 CCGCCCGGTGCAGATGGCAGAGG + Intronic
1129208229 15:74050016-74050038 CTTCTAGAAGCACCTGGCAGGGG + Intergenic
1129413317 15:75361470-75361492 CTGCTATGTGACCCTGGCAGAGG + Intronic
1131149336 15:90037091-90037113 CAGCTTGGAGGACCTGGCAGGGG + Intronic
1135008311 16:18848637-18848659 CAGCTCAGTGAGCCTGGCAGAGG + Intronic
1135081985 16:19444223-19444245 CTGCCAGGTGCTCCTGGAAGTGG + Exonic
1136413561 16:30090880-30090902 CGGCTCAGTGCCCATGGCAGGGG + Exonic
1140484431 16:75282612-75282634 CTGCTCAGCGGACCTGGGAGAGG + Intergenic
1141427880 16:83955395-83955417 CTGCACGTTCCACCCGGCAGAGG + Intronic
1142178842 16:88657496-88657518 CTGCAAGGTGCACGTGGCATCGG - Exonic
1142940809 17:3378597-3378619 GTGCTCGGTGGAGCTGGCAGGGG - Intergenic
1148695271 17:49555012-49555034 CGGCCCGGAGCACCTGGCTGGGG + Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152090212 17:78242298-78242320 CTGGTAGGTGCCCCTGCCAGGGG + Intergenic
1152484152 17:80578819-80578841 CTGCACTGTGCACTTAGCAGCGG - Intronic
1152689933 17:81713355-81713377 CTGCCCTGTGAACCTGGCTGTGG + Intronic
1152707535 17:81852504-81852526 CTGTCCGGTGCACGTGGTAGGGG - Intronic
1153416798 18:4854791-4854813 CTGCTCTGTGCTGCTGGCTGGGG - Intergenic
1156401660 18:36745210-36745232 CTGCTCGGTGCACCTGGCAGAGG - Intronic
1156401663 18:36745213-36745235 CTGCCAGGTGCACCGAGCAGGGG + Intronic
1156401725 18:36745625-36745647 CTGCTCGTTGCCTCTGTCAGTGG + Intronic
1157484890 18:48079845-48079867 GTGCTCGGTCCCCCTGGAAGTGG - Intronic
1160149852 18:76390746-76390768 CCGCTCGGTGCTTCTGGCTGGGG - Intronic
1160187323 18:76685915-76685937 GTGCTTGGAGCACCTGTCAGAGG + Intergenic
1160418437 18:78727879-78727901 CTGCTCTGTGCAGCTGGCCTGGG + Intergenic
1160449819 18:78954983-78955005 CTGCTAGCTCCACCAGGCAGGGG + Intergenic
1161080618 19:2308225-2308247 CTCCTCGGCGCGCCTGGCGGGGG + Intronic
1161583776 19:5094345-5094367 CTGAGCGGGGGACCTGGCAGAGG + Intronic
1161593737 19:5140890-5140912 CTGCTGGGTGCTACTGGCTGCGG - Intronic
1162447209 19:10730833-10730855 CTGCTCAGTGGCCCTGGCAGGGG + Intronic
1163470909 19:17496495-17496517 CTAGTGGGTGCACCTGGGAGTGG + Intronic
1163604199 19:18265211-18265233 CTGTTAGGAGCACCTGGGAGTGG + Exonic
1163699162 19:18778572-18778594 CTGTTCTGTGGCCCTGGCAGAGG - Exonic
1165153430 19:33773808-33773830 CTTATCAGTGCACCTTGCAGGGG + Intergenic
1167144609 19:47674167-47674189 AGGCCCGGTGCTCCTGGCAGAGG + Intronic
1168004319 19:53474216-53474238 CTGCTCCGTGCATCCGACAGAGG - Intronic
925116008 2:1378745-1378767 ATGCTGTGTGCACCTGGCGGGGG + Intronic
927424876 2:22970770-22970792 ATGCTCTCTGCACCAGGCAGCGG - Intergenic
927497486 2:23560727-23560749 CTGCCCAGTGTGCCTGGCAGAGG + Intronic
928471424 2:31580463-31580485 CTGCCTGGCGCACCTGGCGGGGG - Intronic
931183762 2:59929839-59929861 CTGCTCTGAGGATCTGGCAGGGG + Intergenic
932432617 2:71685032-71685054 GTGCAGGGTGCAGCTGGCAGGGG - Intronic
941808661 2:169734292-169734314 CTGCGCGGAGCGCCGGGCAGAGG + Intronic
942248879 2:174031259-174031281 CTGCTCTGGGCACCTGGGATAGG + Intergenic
942947636 2:181686910-181686932 CTGCTGGGAGCACCTGCCATGGG + Intergenic
947104955 2:226659625-226659647 CTGGTAGGTGGAGCTGGCAGTGG - Intergenic
948115895 2:235494220-235494242 CTGCTCTGGGCTCCTGGCCGTGG - Exonic
948463937 2:238143274-238143296 CTGCTCAGTGCACCTGCCGAGGG + Intronic
948819240 2:240530187-240530209 CTCCCCTGGGCACCTGGCAGTGG - Intronic
948895781 2:240926255-240926277 CTGCTCACAGCACCTGGCCGTGG + Intronic
948900645 2:240955363-240955385 CTGCTCCGTGGACCAGGCTGTGG - Intronic
1170570767 20:17631182-17631204 CTGCCCGGGACACCTGGCAGAGG - Intronic
1175227185 20:57451408-57451430 CTCCTCAGTGAAGCTGGCAGTGG + Intergenic
1175335267 20:58191929-58191951 CTGCTCGGTTCTGCTGGCTGTGG - Intergenic
1176149637 20:63583442-63583464 CTGCTGCCTGCACCAGGCAGAGG - Intergenic
1181283208 22:21734708-21734730 CAGCTCCTGGCACCTGGCAGGGG + Intronic
1182471511 22:30551268-30551290 TTGCTCTGTGACCCTGGCAGAGG + Intergenic
1183115198 22:35686456-35686478 GTGCTCTGTGCACCTGCCAAGGG + Intergenic
1185202009 22:49513211-49513233 CTGCTTCGTGCAGCTGGCACAGG - Intronic
1185238573 22:49728448-49728470 CTGTTCTGTGCCCCGGGCAGAGG - Intergenic
951509774 3:23487441-23487463 ATGCTCTGTGAAGCTGGCAGGGG - Intronic
954395817 3:50292716-50292738 CTTCTCAGGGCACTTGGCAGCGG + Exonic
954676245 3:52317275-52317297 CTGCTCTCAGCACCTGGCATGGG - Intronic
961452915 3:127010530-127010552 CAGCTTCCTGCACCTGGCAGAGG + Intronic
965061453 3:163789154-163789176 GTGCTCTGTGAAGCTGGCAGGGG - Intergenic
968579829 4:1384758-1384780 GTGCTAAGTGCACCGGGCAGAGG + Intronic
969718096 4:8877989-8878011 CAGCTCGGTGGCCCTGGCACAGG - Intergenic
969866037 4:10077696-10077718 CTGGGCGGTGCAGGTGGCAGTGG - Intronic
969968606 4:11022759-11022781 CTGCTGGATGCACAGGGCAGAGG - Intergenic
972767716 4:42167008-42167030 CTGATCTGCCCACCTGGCAGAGG - Intergenic
976311161 4:83614892-83614914 ATGCTTGGTGGACCTGGGAGTGG + Intergenic
979246894 4:118517310-118517332 CTGCCCTGGGCACATGGCAGTGG + Intergenic
981764758 4:148235984-148236006 CTGCCCGCTGCTGCTGGCAGTGG - Intronic
984630515 4:182055527-182055549 CTGCTCTGGACACCCGGCAGAGG + Intergenic
985492564 5:188043-188065 GTGGTCAGAGCACCTGGCAGGGG - Exonic
985578237 5:683590-683612 CTGCAGGATGCCCCTGGCAGGGG + Intronic
985593164 5:775730-775752 CTGCAGGATGCCCCTGGCAGGGG + Intergenic
985789511 5:1917807-1917829 CAGCTCGGAACACCTGGCAGTGG - Intergenic
985887179 5:2688737-2688759 CTGCACCTTGCACCTGGAAGGGG - Intergenic
989225435 5:39022421-39022443 CCGCTGGCAGCACCTGGCAGGGG - Intronic
991987781 5:72308006-72308028 CTCCACGGTGGAACTGGCAGCGG + Intronic
993613769 5:90085194-90085216 CTGCTCAGTGGAGGTGGCAGGGG - Intergenic
997364299 5:133315792-133315814 CTCCTCCCTGCAACTGGCAGTGG + Intronic
998179412 5:139925999-139926021 CTACTGGGTGCATGTGGCAGGGG - Intronic
1001760628 5:174205190-174205212 ATGTTCTGTGCACCTGGAAGGGG - Intronic
1002021143 5:176365327-176365349 CTCCACCCTGCACCTGGCAGGGG + Intergenic
1004485979 6:16066991-16067013 CTGCTTTGTGCCTCTGGCAGTGG - Intergenic
1007391306 6:41551067-41551089 CGGCTTGGTGGAACTGGCAGTGG - Intronic
1007629095 6:43262945-43262967 CCGCTCGGTGCCGCTGGCTGAGG + Exonic
1008109476 6:47477607-47477629 CCGCTCGCTGCACCTGGACGCGG + Intergenic
1011706431 6:90005629-90005651 CTGCTCAGGGCACCTGCCTGTGG - Intronic
1016305092 6:142675730-142675752 CTGCTGGGTGGCCCTGGGAGAGG - Intergenic
1017826494 6:158085856-158085878 CTGCACGTTGCTCCTGCCAGGGG + Intronic
1018623925 6:165759078-165759100 CTGCTCCGTGCCCATAGCAGGGG + Intronic
1018996329 6:168713145-168713167 ATGCACAGTGCACATGGCAGAGG + Intergenic
1019317070 7:391715-391737 CTGCACGCTGCCCCTGGCAGGGG + Intergenic
1019522567 7:1467409-1467431 CTGCGGCGGGCACCTGGCAGGGG - Intergenic
1024930123 7:54660422-54660444 GTGCACGGTGCACACGGCAGGGG + Intergenic
1025260400 7:57414311-57414333 CTGCCCTGTGCACCTTGCACTGG + Intergenic
1026950079 7:74340988-74341010 CTGCTCTGAGAACCTGGCAAAGG + Intronic
1029201438 7:98841879-98841901 CCCCCCGGTGCACCTGGCAGAGG + Intergenic
1029487588 7:100852867-100852889 CTGTGGGGTGCACCTGGCCGGGG + Intronic
1031629854 7:124033044-124033066 CAGCTCCGCGCACCCGGCAGCGG - Intergenic
1031877567 7:127159101-127159123 CTGCTCAGTGGACCAGGCTGTGG + Intronic
1035298904 7:157884398-157884420 CTCCTCTCTGCACCTGGAAGAGG + Intronic
1036216546 8:6884390-6884412 CTGCTCTGGGCAGCTGCCAGTGG - Intergenic
1036794951 8:11749106-11749128 CTCCTCTGGGCACCTGGCTGCGG + Intronic
1039109740 8:34028686-34028708 GTGCTCATTGCACCGGGCAGGGG - Intergenic
1047480604 8:125278449-125278471 CTGCTGGCAGCACCTGGCAATGG - Intronic
1049546655 8:143234946-143234968 CTGTTCTGTGCAGCTGGCAGAGG - Intergenic
1049770774 8:144380008-144380030 TGGCTCAGTGAACCTGGCAGGGG + Intronic
1056792042 9:89632263-89632285 CTGCCCAGTGCATCTGGCATGGG + Intergenic
1057178387 9:93015860-93015882 CTGCTCAGTGCCCCTTCCAGGGG - Intronic
1057317293 9:93977877-93977899 CTGATGGGTGCACCTGGAGGAGG + Intergenic
1057646224 9:96877465-96877487 CTCCTGGGGGTACCTGGCAGAGG + Intergenic
1058397377 9:104569887-104569909 CTGCTCAGCCCACCTGACAGTGG + Exonic
1058747555 9:108006898-108006920 CTTCTCAGAGGACCTGGCAGTGG + Intergenic
1060157382 9:121329132-121329154 CAGCTGGCTGCAGCTGGCAGGGG - Intronic
1061001654 9:127906047-127906069 CTTCTGGGTCCACCTGGCACTGG + Intergenic
1061279070 9:129586713-129586735 CTGCCTGCTGAACCTGGCAGTGG + Intergenic
1062113834 9:134796992-134797014 CTGCTCGGAGCTCCTCACAGTGG + Intronic
1062469318 9:136695610-136695632 CTGCTGAGAGCACCTGGCTGCGG + Intergenic
1062641630 9:137521582-137521604 CTGCTCCATGCAGCTGGCATCGG - Intronic
1062650618 9:137575001-137575023 CTTCTCGGGGCCCCTAGCAGGGG - Intronic
1185700890 X:2228948-2228970 CTGCCCTCTGCTCCTGGCAGTGG - Intronic
1186834086 X:13420224-13420246 CTGCTCGCTGCATGTGGAAGGGG - Intergenic
1189137328 X:38562510-38562532 CTGCGTGGTGCACCTCGCGGAGG + Intronic
1200228660 X:154433082-154433104 CTTCTCGGGGCAGCTGGCAGTGG + Intronic
1200243944 X:154512852-154512874 CTCCTGGGTGGGCCTGGCAGTGG - Exonic