ID: 1156401759

View in Genome Browser
Species Human (GRCh38)
Location 18:36745760-36745782
Sequence ATGAGTGGCAGGTGCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 1, 2: 1, 3: 53, 4: 432}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156401759 Original CRISPR ATGAGTGGCAGGTGCATGGA GGG (reversed) Intronic
900022332 1:193582-193604 ATTGGTGGCAGGTTCATGAATGG + Intergenic
900597575 1:3489509-3489531 ATGAGTGCCAGGTGCTCGGGAGG + Intergenic
900697872 1:4023376-4023398 GTGTGTGGCAGGTGCTAGGAGGG - Intergenic
901006602 1:6174703-6174725 ATGAATGGATGGTGGATGGATGG + Intronic
901006688 1:6175139-6175161 ATGGATGGCAGATGGATGGATGG + Intronic
901262549 1:7884883-7884905 ATGATGGGCAGATGGATGGATGG - Intergenic
901317962 1:8321864-8321886 AAGAGTGGCTGGTGGATGAATGG + Intronic
901443977 1:9295703-9295725 AGGAGGGGCAGGTGCAGGAAGGG - Intronic
901653066 1:10754186-10754208 GTGAGAGGCAGGTGGATGGATGG - Intronic
902107119 1:14047077-14047099 ATGGATGACAGGTGGATGGAAGG - Intergenic
902202608 1:14845129-14845151 ATGAGTGGATGATGAATGGATGG + Intronic
902887064 1:19413016-19413038 AATAGTGTCTGGTGCATGGATGG + Intronic
902937499 1:19774964-19774986 GTGAGTGGCCCGTGCATGGTGGG - Intronic
903538860 1:24085391-24085413 CTGATGGGCAGATGCATGGATGG + Intronic
904846563 1:33423079-33423101 ATGAGTGGCAGAGGCAAGGCTGG + Intronic
907211035 1:52822140-52822162 ATCACTGGCAGGAGCCTGGATGG + Exonic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907319137 1:53591984-53592006 ATGAGTGGCAGGTCCTGGGATGG - Intronic
907888653 1:58617497-58617519 ATGAGAGGCAGGTGGGTGGATGG + Intergenic
909099054 1:71328029-71328051 ATGAGTAGTGGGGGCATGGAAGG - Intergenic
910364194 1:86446515-86446537 ATTAGTGACAGATGCATGGCAGG - Intronic
911178894 1:94843689-94843711 CTGAGATGCAGGTGCAGGGAGGG + Intronic
913052369 1:115129039-115129061 ATAATGGGCAGGTGCTTGGAGGG + Intergenic
919721056 1:200836251-200836273 ACGAGTGGAAGGTGAAAGGAGGG - Intronic
919726715 1:200889141-200889163 ATGAGTGGCATGTGAGTGGTTGG - Intergenic
922790894 1:228310390-228310412 ATGAGTGGATGGTGAATGGATGG - Intronic
922812159 1:228422975-228422997 ATGAGTGCCAGATCCTTGGAGGG - Intergenic
924034287 1:239920357-239920379 ATGAATGGCTGATGGATGGATGG - Intergenic
924723554 1:246645809-246645831 ATGAATGAGAAGTGCATGGATGG - Intronic
1062812574 10:477563-477585 ATGGGTGGAAGGTGCATAGGTGG + Intronic
1063498169 10:6529100-6529122 ATGAATGGCAGAAGCTTGGAGGG - Intronic
1063516523 10:6701559-6701581 CAGAGTGGCAGGTGCAAGGCAGG + Intergenic
1063958222 10:11284691-11284713 ATGAGTGGATGATGGATGGATGG + Intronic
1065321137 10:24511218-24511240 CAGAGTGCCAGGTGCATGGAGGG + Intronic
1065803015 10:29369787-29369809 ATGAGTGGCTGGAGCAACGAGGG + Intergenic
1065860727 10:29870546-29870568 ATGAGTGGATGGTAGATGGATGG - Intergenic
1065860798 10:29870948-29870970 ATGAATGGTAGGTGGATAGATGG - Intergenic
1066496694 10:35949030-35949052 ATGAAAGGCAGGTGGATGGGCGG - Intergenic
1067169900 10:43897989-43898011 ATGAGTGGCAGGTGCAGCTGAGG + Intergenic
1067342457 10:45416878-45416900 ATGGGTGGATGGTGAATGGATGG + Intronic
1067833670 10:49624780-49624802 ATGGGTGGATGGTGGATGGATGG + Intronic
1067833695 10:49624892-49624914 ATGAGTGGGTGGTGGGTGGAAGG + Intronic
1070378812 10:75860865-75860887 ATAAGTGGCAGGTGCAAGCCAGG - Intronic
1070654916 10:78264768-78264790 GTGAATGGCAGTTGGATGGATGG + Intergenic
1070736540 10:78867174-78867196 AGAAGTGCCTGGTGCATGGAAGG - Intergenic
1071507295 10:86240471-86240493 CTGAGAGGAAGGTGCAGGGAAGG + Intronic
1071508538 10:86247150-86247172 ATGAGTGGATGATGGATGGATGG + Intronic
1072734923 10:97872739-97872761 TGGAGAGGCAGGTGAATGGATGG + Intronic
1073467244 10:103701338-103701360 ATGGGTGGATGGTGGATGGATGG - Intronic
1074556898 10:114499760-114499782 TTACGTGGCAGGTGCATGGGCGG + Intronic
1076676750 10:132151068-132151090 ATGAATGGGAGATGGATGGATGG - Intronic
1076867749 10:133176325-133176347 ATGGGTTCCAGGTGCCTGGATGG + Intronic
1077283518 11:1756050-1756072 ATGAGTGCCAGGTGGAAGGAGGG - Intronic
1077357509 11:2125436-2125458 ATGACTGGGGGGTGGATGGAGGG + Intergenic
1077357526 11:2125525-2125547 ATGACTGGGGGGTGGATGGAGGG + Intergenic
1081436556 11:43033708-43033730 ATCAGTGAAAGGTGAATGGAAGG - Intergenic
1082847611 11:57739270-57739292 AGGAAGGGCAGGTGCATGAAGGG + Intronic
1083730947 11:64652242-64652264 ATGTGTGGCATGTGCGGGGATGG - Intronic
1084084829 11:66850163-66850185 GCCAGTGGCAGGTGCATGCAGGG + Intronic
1084709363 11:70834501-70834523 AGGGGTGGCAGGTGCAGGGCAGG + Intronic
1084746737 11:71175247-71175269 AGCAGTGGCAGGTTCCTGGATGG + Intronic
1084781890 11:71415160-71415182 ATGGGTGGTAAGTCCATGGATGG + Intergenic
1084785643 11:71440335-71440357 ATGACGGGCAGGTGGATGGGTGG + Intronic
1085406843 11:76268566-76268588 ATGGGTGGATGGTGGATGGATGG - Intergenic
1085406854 11:76268604-76268626 ATGGGTGGATGGTGGATGGATGG - Intergenic
1085554233 11:77404979-77405001 ATGAGGGGGAGGCGCATGCATGG + Intronic
1086091012 11:83004710-83004732 ATGTGTGTCAGGCCCATGGAAGG + Intronic
1087636955 11:100712566-100712588 CTGAGTGGCAGGTGGTGGGAGGG + Intronic
1088338230 11:108732531-108732553 CTGAGTGCCAGGTGCAAGCAAGG + Intronic
1088626732 11:111735093-111735115 AAGAGTAGAAGGGGCATGGAAGG + Intronic
1089093135 11:115895293-115895315 ATGAGTGGTGGATGAATGGATGG - Intergenic
1089321034 11:117626831-117626853 ATGAGCGGCAGGTGCAGAGTAGG + Intronic
1089709942 11:120307415-120307437 ATGAGTGGCCGGTGCCTTCATGG - Intronic
1091117837 11:133031308-133031330 ATGGGTGGTTGGTGAATGGATGG + Intronic
1091376031 12:25120-25142 ATTGGTGGCAGGTTCATGAATGG + Intergenic
1091670104 12:2446548-2446570 ATGAGTGGGTGGTGCATAGGTGG + Intronic
1091749310 12:3012572-3012594 CGGAGTGGCAGGGGCATGGGGGG + Intronic
1092924122 12:13258331-13258353 ATGAGAGGCAGGGGGAGGGATGG + Intergenic
1095886519 12:47194120-47194142 ATGTGTTTCAGGAGCATGGAGGG - Intronic
1098357950 12:69628911-69628933 TTGAGTGGCAGGTGCATTCCTGG - Intergenic
1098872578 12:75833624-75833646 ATGTGAGGTAGGTGCATGGGTGG - Intergenic
1099113174 12:78587428-78587450 GTGCATGGCAGGTGCATAGAAGG + Intergenic
1099458470 12:82894011-82894033 ATGAGTGGAATGTGGAGGGAAGG + Intronic
1099681725 12:85837306-85837328 ATGAGTGCCAGGTACCTGGTGGG - Intergenic
1099969353 12:89484863-89484885 ATCACTGGCAGGTGCGTGGATGG + Intronic
1100987476 12:100216997-100217019 ATGAGTGGTAGTATCATGGAAGG + Intronic
1101801031 12:108022080-108022102 ATGAGTGGATGATGGATGGATGG - Intergenic
1101801072 12:108022362-108022384 ATGATGGGCAGATGGATGGATGG - Intergenic
1101822312 12:108193535-108193557 ATTAATGGTAGGTGGATGGATGG + Intronic
1102292136 12:111709710-111709732 ATTAGTGGCTGGTGCATGGGAGG - Intronic
1103004352 12:117409360-117409382 AGGGGTGGAAGGTGGATGGAGGG + Intronic
1103004390 12:117409499-117409521 ATGAGTGGAAGGGGGATAGATGG + Intronic
1103209369 12:119155309-119155331 CTGAGTGGCAGATGCCTGGAAGG - Intronic
1103255956 12:119541449-119541471 ATGAATGGATGGTGGATGGATGG + Intergenic
1104092403 12:125527290-125527312 AAGAGTGGAGGGTGGATGGAAGG - Intronic
1104092425 12:125527357-125527379 AAGAGTGGAGGGTGGATGGAAGG - Intronic
1104153128 12:126104473-126104495 ATGAGAGGCAGGTGCAAAGGTGG - Intergenic
1106637305 13:31542878-31542900 AGGAGTGTTAGCTGCATGGAGGG + Intergenic
1106653238 13:31715046-31715068 ATGAGTGGCAGGTGAAGATAAGG - Intergenic
1107094911 13:36525943-36525965 ACCAGTGGCAGCTGAATGGAGGG + Intergenic
1111457340 13:88502282-88502304 ATCCTTTGCAGGTGCATGGATGG - Intergenic
1111991144 13:95118659-95118681 AGGTGTGGCATGTGCATGGAGGG - Intronic
1113245108 13:108386529-108386551 ATGACTGCCACGTGCAGGGATGG - Intergenic
1113521644 13:110946159-110946181 CTGAGTGGGAGGTGCTGGGATGG + Intergenic
1113780281 13:112972818-112972840 ATGGATGGAAGGTGGATGGATGG + Intronic
1113852282 13:113424661-113424683 ATGAATGGATGGTGAATGGATGG - Intronic
1113934169 13:113984662-113984684 ATGAGTGATGGGTGGATGGAAGG - Intronic
1113934551 13:113986820-113986842 ATGAGTGATGGGTGGATGGAAGG - Intronic
1113934846 13:113988572-113988594 ATGAGTGATGGGTGGATGGAAGG - Intronic
1113935034 13:113989440-113989462 GTGAGTGACGGGTGGATGGACGG - Intronic
1113935058 13:113989546-113989568 ATGAGTGATGGGTGGATGGAAGG - Intronic
1113935086 13:113989673-113989695 GTGAGTGACGGGTGGATGGATGG - Intronic
1114447927 14:22803805-22803827 ATATGTGGCAGGTGCTTGCAGGG - Intronic
1115648010 14:35383794-35383816 AGGTGTGGCAGATGCATGAAAGG + Intergenic
1117745305 14:58863216-58863238 ATAAGTGGAAGATGGATGGATGG - Intergenic
1118091202 14:62481353-62481375 ATGATTGGTAGCTGCAAGGAGGG - Intergenic
1120769057 14:88358711-88358733 CAGAGAAGCAGGTGCATGGAGGG + Intergenic
1120900015 14:89567643-89567665 ATGAGTGGCAAGGACAAGGAAGG + Intronic
1121029953 14:90649787-90649809 ATGGGTGGATGGTGGATGGATGG - Intronic
1121443201 14:93962041-93962063 ATGTGTGGCAGGCACATGGGAGG + Intronic
1121744084 14:96274374-96274396 ATGAGTGTCTGGTGAAGGGAAGG + Intergenic
1122088773 14:99324373-99324395 ACCAGGGGCTGGTGCATGGAAGG - Intergenic
1122411133 14:101526763-101526785 ATGGGTGGCAGGTGGATGGCAGG + Intergenic
1122600684 14:102920182-102920204 ATGAGTGGTAGATGGATGGAAGG - Intergenic
1122600790 14:102920714-102920736 ATAAGTGGATGGTGGATGGATGG - Intergenic
1122923785 14:104890714-104890736 ATGAGTGGTGGGTGGATGGATGG + Intronic
1125961912 15:43837748-43837770 CTGGATGGCAGGTACATGGATGG - Intronic
1126871713 15:52996438-52996460 ATGAATGTCAGGTGGGTGGAAGG - Intergenic
1128014873 15:64334782-64334804 GTGAGTGGCAGGTGAGTGGCAGG - Intronic
1128654235 15:69448481-69448503 ATGAGTGCCAGGTAAATGCAGGG - Intergenic
1129755619 15:78097273-78097295 CTGAGTGGCAGTTACATGGGAGG + Intronic
1129769435 15:78193909-78193931 GTGAGTGGCGGGGGCAGGGACGG - Intronic
1130106354 15:80931593-80931615 ATGACTGCCGGGTGAATGGATGG - Intronic
1131699336 15:94917226-94917248 ATGTGTGGCCGGTGGCTGGAAGG + Intergenic
1132019091 15:98344924-98344946 ATGGGTGGGAGGTGGGTGGATGG + Intergenic
1132069250 15:98761313-98761335 ATGAGTTGCAGGGGCAGAGAGGG + Intronic
1132228720 15:100165470-100165492 ATGAGTGGCACCTGCTTGGGAGG + Intronic
1132450896 15:101967882-101967904 ATTGGTGGCAGGTTCATGAATGG - Intergenic
1132644923 16:994353-994375 GTGAGTGGCTGGTGGTTGGATGG - Intergenic
1132885770 16:2181314-2181336 GTGGGTGGCAGGTGGCTGGAGGG + Exonic
1133146074 16:3787578-3787600 ATGAGTGGCAGTTCAAAGGACGG + Intronic
1134106153 16:11486990-11487012 ATGAGAGGGATGTGCGTGGATGG + Intronic
1134224499 16:12380673-12380695 ATGGGTGGATGGTGGATGGATGG - Intronic
1134224539 16:12380804-12380826 ATGGATGGCGGGTGGATGGATGG - Intronic
1135547396 16:23375350-23375372 ATCTGTGTCAGGTGCTTGGACGG + Intronic
1135561480 16:23480004-23480026 CTGAGTGGAAGGTTCTTGGAAGG - Intronic
1135893134 16:26374807-26374829 ATGAGTGGTAGATGGTTGGATGG + Intergenic
1136289698 16:29264214-29264236 GTGAGTGGCAGGAGCACGGAGGG - Intergenic
1136289707 16:29264245-29264267 GTGAGTGGCAGGAGCACAGAGGG - Intergenic
1136289724 16:29264307-29264329 GTGAGTGGCAGGAGCAAGGAGGG - Intergenic
1138062162 16:53903172-53903194 ATGAGTGGCTGGAGGATTGAGGG - Intronic
1138619718 16:58201326-58201348 ATGAGAGGAAGGTGCACGGAGGG - Intergenic
1140188775 16:72796875-72796897 ATGCGTGGAGGGAGCATGGAAGG + Exonic
1141031999 16:80597127-80597149 AAGAATGGCAGATGCATGGATGG + Intergenic
1141096829 16:81168707-81168729 ATGGGTGGAAGATGAATGGATGG + Intergenic
1141319228 16:82991056-82991078 AAGGATGGCAGGTGCATGGCAGG - Intronic
1141351675 16:83303884-83303906 TTGGGTGACAGGTGCATTGAGGG + Intronic
1141391371 16:83667420-83667442 ATGGGTGGGTGGTGGATGGATGG - Intronic
1141641873 16:85346328-85346350 ATGATGGGCAGGTAGATGGATGG + Intergenic
1141916320 16:87099620-87099642 ATGACTGGCAGCTGAAGGGAAGG - Intronic
1142095426 16:88237163-88237185 GTGAGTGGCAGGAGCAAGGAGGG - Intergenic
1142095451 16:88237256-88237278 GTGAGTGGCGGGAGCACGGAGGG - Intergenic
1142095461 16:88237287-88237309 GTGAGTGGCGGGAGCACGGAGGG - Intergenic
1142095471 16:88237318-88237340 GTGAGTGGCAGGAGCACGGAGGG - Intergenic
1142095496 16:88237411-88237433 GTGAGTGGCAGGAGCACGGAGGG - Intergenic
1142095505 16:88237442-88237464 GTGAGTGGCAGGAGCACGGAGGG - Intergenic
1142095514 16:88237473-88237495 GTGCGTGGCAGGAGCACGGAGGG - Intergenic
1142095523 16:88237504-88237526 GTGCGTGGCAGGAGCAAGGAGGG - Intergenic
1142095532 16:88237535-88237557 GTGAGTGGCAGGAGCACGGAGGG - Intergenic
1142095541 16:88237566-88237588 GTGAGTGGCAGGAGCACGGAGGG - Intergenic
1142095558 16:88237628-88237650 GTGAGTGGCAGGAGCAAGGAGGG - Intergenic
1142095567 16:88237659-88237681 GTGAGTGGCAGGAGCACGGAGGG - Intergenic
1142095584 16:88237721-88237743 GTGCGTGGCAGGAGCACGGAGGG - Intergenic
1142095593 16:88237752-88237774 GTGAGTGGCAGGAGCAAGGAGGG - Intergenic
1142095602 16:88237783-88237805 GTGAGTGGCGGGAGCAAGGAGGG - Intergenic
1142128613 16:88422236-88422258 ATGAATGGTAGAAGCATGGATGG + Intergenic
1142153030 16:88521032-88521054 ATGATGGACAGGTGGATGGATGG + Intronic
1142960559 17:3549909-3549931 ATGAGTGGATGGTTGATGGATGG + Intronic
1143044437 17:4065591-4065613 CTGAGTGACAGGTACATGGAAGG - Intronic
1143206120 17:5140222-5140244 ATTAGGGGCAGCTGGATGGAAGG - Intronic
1143301475 17:5913781-5913803 TTGGGTGGAAGGTGAATGGACGG - Intronic
1143350654 17:6285735-6285757 AGGAGTGGCCTGTGCATGCATGG + Intergenic
1144728518 17:17513686-17513708 CTGAGGGGCTGGTGCAGGGAGGG + Intronic
1145271526 17:21407372-21407394 ATGGGTGATGGGTGCATGGATGG - Intronic
1145309740 17:21694820-21694842 ATGGGTGACGGGTGCATGGATGG - Intronic
1146055723 17:29580058-29580080 AAGAGAGGCAGAGGCATGGAGGG - Intronic
1146155455 17:30520400-30520422 GTCAGTGGCAGATGCTTGGAAGG + Intronic
1146676582 17:34777538-34777560 ATAAGTGGTAGATGCAAGGATGG + Intergenic
1146842492 17:36165606-36165628 ATTAGGGGCAGCTGGATGGAAGG + Intronic
1146854802 17:36253565-36253587 ATTAGGGGCAGCTGGATGGAAGG + Intronic
1146865818 17:36334811-36334833 ATTAGGGGCAGCTGGATGGAAGG - Intronic
1146870702 17:36377457-36377479 ATTAGGGGCAGCTGGATGGAAGG + Intronic
1146878060 17:36428538-36428560 ATTAGGGGCAGCTGGATGGAAGG + Intronic
1146882001 17:36449642-36449664 ATTAGGGGCAGCTGGATGGAAGG + Intergenic
1146908164 17:36631067-36631089 ATGAATGTTAGATGCATGGAAGG + Intergenic
1147068688 17:37935423-37935445 ATTAGGGGCAGCTGGATGGAAGG - Intergenic
1147073585 17:37978081-37978103 ATTAGGGGCAGCTGGATGGAAGG + Intergenic
1147080211 17:38014960-38014982 ATTAGGGGCAGCTGGATGGAAGG - Intronic
1147085107 17:38057619-38057641 ATTAGGGGCAGCTGGATGGAAGG + Intronic
1147096159 17:38138920-38138942 ATTAGGGGCAGCTGGATGGAAGG - Intergenic
1147101053 17:38181585-38181607 ATTAGGGGCAGCTGGATGGAAGG + Intergenic
1147833979 17:43317001-43317023 GTGAGTGGCAGATACCTGGAAGG - Intergenic
1147923381 17:43932404-43932426 GTGAGGGGCAGGTGAAGGGAAGG - Intergenic
1147977479 17:44256058-44256080 ATGATAGGTAGGTGGATGGATGG - Intronic
1149644013 17:58226202-58226224 AAGAATGGGAGGAGCATGGAAGG - Intronic
1149845644 17:60008048-60008070 ATTAGGGGCAGCTGGATGGAAGG + Intergenic
1150083993 17:62264631-62264653 ATTAGGGGCAGCTGGATGGAAGG + Intergenic
1150439098 17:65177205-65177227 ATGGGTGGTAGGTGGATGGTGGG - Intronic
1151888360 17:76937527-76937549 ATGGATGGTGGGTGCATGGATGG + Intronic
1151888365 17:76937546-76937568 ATGGATGGTGGGTGCATGGATGG + Intronic
1152034041 17:77861104-77861126 ATGGGTGAAAGGTGGATGGATGG + Intergenic
1152612770 17:81323701-81323723 ATTAGTTGCAGGTGAGTGGATGG - Intronic
1152735231 17:81993960-81993982 ATGAGGGGCATCTGCAAGGAAGG + Intronic
1154485408 18:14868106-14868128 AGGGTGGGCAGGTGCATGGAGGG + Intergenic
1155339411 18:24798984-24799006 GTGTGAGGCAGGTGCAGGGAGGG + Intergenic
1156375871 18:36514949-36514971 ATGAGTCCCAGCTGCATAGAGGG + Intronic
1156401759 18:36745760-36745782 ATGAGTGGCAGGTGCATGGAGGG - Intronic
1156471703 18:37381146-37381168 ATGAATGGTAGGTGGATGGATGG - Intronic
1157536853 18:48465860-48465882 ATCTCTGGCAGGTGCAAGGATGG - Intergenic
1158592453 18:58789099-58789121 GGGAGTGGTAGGTGCATGGGAGG + Intergenic
1159061662 18:63520450-63520472 ATGAGTCACAGATGCATGGTGGG + Intergenic
1159541187 18:69778914-69778936 ATGAGTGGAATGGGGATGGAAGG + Intronic
1160226786 18:77018213-77018235 ATGAGTGGATGGGGGATGGATGG - Intronic
1160226823 18:77018380-77018402 ATGAGTGGATGGGGGATGGATGG - Intronic
1160226887 18:77018685-77018707 ATGAGTGGATGGGGGATGGATGG - Intronic
1160229155 18:77033545-77033567 ATGGATGGGAGGTGGATGGAAGG - Intronic
1160692095 19:464881-464903 ATGAGTGGATGATGGATGGATGG + Intronic
1160767915 19:816643-816665 ATGAGTGGATGATGGATGGATGG - Intronic
1160977773 19:1802246-1802268 ATGAGTGGGGGGTGGGTGGATGG - Intronic
1161258421 19:3322412-3322434 ATGGGAGGGAGGTGGATGGATGG + Intergenic
1161287707 19:3477413-3477435 ATAAGTGGTAGGTGAATAGATGG + Intronic
1161287806 19:3477789-3477811 ATGAGTGGATGATGGATGGATGG + Intronic
1161347764 19:3776673-3776695 ATGAGTGGATGGTGGGTGGATGG + Intergenic
1162135984 19:8555595-8555617 ATGAATGGCTGGGCCATGGACGG - Intronic
1162968211 19:14165656-14165678 AAGAGTGGCTGGTGCTGGGAGGG + Intronic
1163171650 19:15535633-15535655 ATGGGTGGATGGTGGATGGATGG - Intronic
1163290848 19:16378101-16378123 ATGAATGGCGGGTGGGTGGATGG + Intronic
1163365237 19:16872388-16872410 ATGGGTGGCAGGTGGCTGGGTGG - Intronic
1163491011 19:17617165-17617187 ATGATTGGCAGGTCCATGGGTGG - Intronic
1163497486 19:17655238-17655260 AAGTGTGGCAGGGGCATGGCTGG + Intronic
1163609827 19:18295089-18295111 ATGGGTGGATGGTGGATGGATGG - Intergenic
1163609845 19:18295162-18295184 ATGAGTGGATGGTGGATGGGTGG - Intergenic
1163609876 19:18295280-18295302 ATGGGTAGATGGTGCATGGATGG - Intergenic
1163609930 19:18295478-18295500 GTGAGTGGATGGTGGATGGATGG - Intergenic
1163609979 19:18295646-18295668 ATGAGTGGATGGTGGATGGATGG - Intergenic
1163609989 19:18295691-18295713 ATGAGTGGATGGTGGATGGATGG - Intergenic
1163610008 19:18295772-18295794 ATGAGTGGATGGTGGATGGATGG - Intergenic
1163610015 19:18295799-18295821 ATGGGTGGATGGTGGATGGATGG - Intergenic
1164771205 19:30810606-30810628 CTCAGTGGCAGGGCCATGGATGG - Intergenic
1164788961 19:30959758-30959780 AGGAGAGGAAGGTGCAGGGATGG + Intergenic
1165156904 19:33794788-33794810 CTGAGTGGGATGTGCATTGATGG + Intergenic
1165188120 19:34039486-34039508 ATGAGTGGCAGAAGGATGGCTGG - Intergenic
1165790549 19:38489075-38489097 ATGATTGGCATGTGCATGAGGGG + Intronic
1166755163 19:45186141-45186163 CTGAGTGGAGGGTGCATGGGAGG + Intronic
1166935614 19:46330668-46330690 ATGGATGGCAGATGGATGGATGG + Intronic
1166935649 19:46330833-46330855 ATGGATGGCAGATGGATGGATGG + Intronic
1168156746 19:54477721-54477743 CTGAGTAGCAGGGACATGGATGG + Intergenic
1168515772 19:57009244-57009266 ATGGGTGGTGGGTGGATGGATGG - Intergenic
925910348 2:8569705-8569727 AGATGTGGCAGGTGCATGGCAGG - Intergenic
926389198 2:12370139-12370161 TGGGGTGGCAGGGGCATGGAGGG + Intergenic
926986279 2:18627892-18627914 ATGAATGGCGGATGGATGGATGG - Intergenic
927196715 2:20552829-20552851 CTAAGTGGCAGGTGCATGTGTGG + Intergenic
927209589 2:20630871-20630893 CTGGGCAGCAGGTGCATGGAGGG + Intronic
927444749 2:23149342-23149364 CTGAGTGGCAGCTGCAGGGAGGG - Intergenic
928189127 2:29145474-29145496 ATGAGGGGCATGTGGATGTAGGG + Intronic
929125968 2:38523066-38523088 ATGTGGTGCAGGTCCATGGAGGG + Intergenic
929889600 2:45908056-45908078 GTGAGTGGCTGGTTAATGGATGG + Intronic
932364524 2:71140455-71140477 ATGAATGGCAGTTGCATTTATGG - Intronic
934125096 2:88880673-88880695 ATGAGCGGGAAGTGAATGGAAGG + Intergenic
934613921 2:95759789-95759811 ATGGATGGCAGATGGATGGATGG + Intergenic
935934904 2:108171147-108171169 ATTAGTGGCATCTGCCTGGAGGG + Intergenic
936282786 2:111157206-111157228 AGGAGATGCAGGTGCCTGGAAGG + Intronic
936567109 2:113590362-113590384 ATTGGTGGCAGGTTCATGAATGG - Intergenic
936648903 2:114403924-114403946 ATGAGTTGCAGGTGCTGAGAGGG + Intergenic
936956990 2:118032428-118032450 ATGAGTGATGGGTGGATGGATGG + Intergenic
937078432 2:119123895-119123917 ATGAGTGGCTGGTGCATGGAGGG + Intergenic
938163589 2:129007893-129007915 ATGAGTGGCCAGGGCATTGAGGG + Intergenic
938279137 2:130052173-130052195 GGGAGAGGCAGGTGCATGGTGGG - Intergenic
938436232 2:131285175-131285197 GGGAGAGGCAGGTGCATGGTGGG + Intronic
942765527 2:179451290-179451312 ATGAGTGGGAAGTGAATGGTTGG + Intronic
943955683 2:194186419-194186441 GTCATTGGCGGGTGCATGGATGG - Intergenic
944042015 2:195366256-195366278 ATAAGTGACAGGTCCAGGGATGG + Intergenic
946018027 2:216619869-216619891 ATGAGTGTCTGCTGCATTGAGGG + Intergenic
946428441 2:219612310-219612332 ATGAGTGCCAGGTGCTGGGCTGG - Intronic
947295396 2:228625277-228625299 GTCAGCGTCAGGTGCATGGAGGG - Intergenic
948029942 2:234809294-234809316 ATGGGTGGCAGGAGCAAAGAAGG + Intergenic
948375480 2:237517844-237517866 ATGGGTGGTAGGTGGATGGATGG + Intronic
948815641 2:240509050-240509072 ATGAGTGGAGGGTAGATGGATGG + Intronic
949065797 2:241989770-241989792 ATGAATGGATGGTGGATGGATGG - Intergenic
949066011 2:241990630-241990652 CAGAGTGACAGATGCATGGATGG - Intergenic
1169033499 20:2431495-2431517 ATGAGTTGCAAGTGGATGAATGG - Intronic
1169276202 20:4235250-4235272 CTGAGGGGCAGGTGAAGGGAGGG + Intronic
1170280738 20:14644890-14644912 GTGAGAGGCAGTGGCATGGAAGG + Intronic
1170946642 20:20896702-20896724 AGGAGTGGAAAGGGCATGGAGGG + Intergenic
1173109691 20:40175101-40175123 ATGTATGGAAGGTGCATGAATGG + Intergenic
1173250842 20:41363569-41363591 CTCAGTGGCAGGGGCAGGGAGGG - Intronic
1173976601 20:47191494-47191516 ATTAGTGGATGGTGGATGGATGG + Intergenic
1175313360 20:58027124-58027146 ATGGGTGGTAGATGTATGGATGG - Intergenic
1175817206 20:61889430-61889452 ATGAATGGATGATGCATGGATGG + Intronic
1175865304 20:62172839-62172861 ATGTGTGGCAGGGGCAGGGGTGG - Intronic
1176047162 20:63098803-63098825 ATGGATGACAGATGCATGGAAGG + Intergenic
1176047178 20:63098924-63098946 ATGGATGACAGATGCATGGAAGG + Intergenic
1176047194 20:63099045-63099067 ATGGATGACAGATGCATGGAAGG + Intergenic
1176240706 20:64074658-64074680 ATGTGTGTCAGGTGCCTGCAGGG - Intronic
1176795927 21:13371370-13371392 AGGGTGGGCAGGTGCATGGAGGG - Intergenic
1177715211 21:24831666-24831688 ATCAGAGCCAGGTTCATGGATGG - Intergenic
1178237158 21:30856086-30856108 ATGACTGGATGGGGCATGGAGGG + Intergenic
1178280873 21:31281745-31281767 ATGAATGGTAGATGGATGGATGG + Intronic
1178280893 21:31281853-31281875 ATGGGTGGTAGGTGGATAGATGG + Intronic
1178923887 21:36759457-36759479 ATGAGTAGCAGGAGTGTGGAAGG + Intronic
1179708885 21:43200141-43200163 TTGAGTGGCGGGTATATGGATGG - Intergenic
1179942577 21:44649509-44649531 ATGAGTGGGATTTGCCTGGAGGG - Intronic
1180025049 21:45156163-45156185 ATGATGGGTAGGTGGATGGATGG - Intronic
1180067670 21:45420723-45420745 AGGTGTGGCATGTGCAGGGAAGG + Intronic
1180289609 22:10784612-10784634 AGGGTGGGCAGGTGCATGGAGGG - Intergenic
1180305287 22:11068188-11068210 AGGGTGGGCAGGTGCATGGAAGG + Intergenic
1183218607 22:36497349-36497371 AAGAGGGGCAGGGGCATGGAGGG + Intronic
1183741172 22:39669470-39669492 ATAAGTGGCTGGTGGGTGGATGG + Intronic
1184850508 22:47116958-47116980 GGGAGGGGCAGGTGCATGAAGGG + Intronic
1184855164 22:47142621-47142643 ATGGTGGGCAGGTGAATGGATGG - Intronic
1184924922 22:47630151-47630173 ATGAGGGGCAGGCTCATGGAAGG + Intergenic
1185193351 22:49452656-49452678 ATGGGTGGGTGGTGGATGGAAGG + Intronic
1185196806 22:49476832-49476854 ATGGATGGTAGGTGGATGGATGG + Intronic
1185196866 22:49477106-49477128 ATGGATGGAAGGTGGATGGATGG + Intronic
1185196928 22:49477370-49477392 ATGGATGGAAGGTGGATGGATGG + Intronic
949934218 3:9104554-9104576 AGGAGGGGCAGGTGCATTGAAGG - Intronic
950025773 3:9819068-9819090 ATGGATGGCTGGTGGATGGATGG - Intronic
950081403 3:10224768-10224790 ATGGGTGGTAGATGGATGGATGG - Intronic
952495058 3:33908550-33908572 AAGAGTGGGAGATGGATGGAAGG + Intergenic
952836552 3:37607232-37607254 ATGAGTGGCAGTTGGGTGGATGG + Intronic
953925592 3:46980841-46980863 ATGCCAGGCAGGTGCAGGGAGGG - Intronic
954180757 3:48879755-48879777 GTGCCTGGCAGGCGCATGGATGG - Intronic
955081340 3:55660346-55660368 TTGAGTGCCTGGTGCAGGGAAGG + Intronic
955716424 3:61835082-61835104 ATAAATGTCAGGTTCATGGAAGG + Intronic
955741243 3:62093670-62093692 ATTAGGAGCAGGTGCATGGTTGG + Intronic
957593120 3:82225711-82225733 AGGAGTAGCAGGGGCAGGGATGG + Intergenic
959679110 3:109072439-109072461 CTGAGTGGCAGGTGCCTTGACGG - Intronic
959726470 3:109548373-109548395 ATGGTTGGCAGGTGCAGGGTGGG + Intergenic
959833927 3:110896448-110896470 AAGAGGGGCAGGGGCATGGCAGG - Intergenic
961092649 3:124128106-124128128 ATTTGTGGCAGGTGTATGGTAGG + Intronic
962732394 3:138295385-138295407 GTGATTAGAAGGTGCATGGAAGG - Intronic
963837768 3:150074226-150074248 ATCTGTGGCAGGGGGATGGAGGG + Intergenic
966881917 3:184355308-184355330 CTGCGTGGCAGGTGCTTAGAAGG + Intronic
968594629 4:1476057-1476079 ATGAGTGGCTGGTGAGTAGATGG + Intergenic
968935819 4:3609891-3609913 ATGAGTGGATGGAGGATGGATGG - Intergenic
969173761 4:5384130-5384152 GTGAGTGGAAGGAGGATGGAGGG + Intronic
969501612 4:7556827-7556849 ATGGGTGGTAGGTGGATGGATGG - Intronic
969514967 4:7642033-7642055 ATGGGTGGGTGGTGGATGGATGG + Intronic
969571711 4:8012632-8012654 ATGGGTGGTGGGTGGATGGATGG - Intronic
969599368 4:8166898-8166920 ATGGATGGTAGGTGGATGGATGG - Intergenic
969599391 4:8166979-8167001 ATGGGTGGCAGATGGATGGATGG - Intergenic
973393948 4:49578336-49578358 GTGAGAGGCAGGTGCATGCTGGG + Intergenic
975452359 4:74544130-74544152 GTGAGTGGTAGGAGGATGGAGGG + Intergenic
977810303 4:101348549-101348571 ATGACTGGAAGGAGCAGGGAAGG - Exonic
978024506 4:103855651-103855673 ATGAGTGGCAGTTGAATTGGCGG + Intergenic
982436371 4:155385844-155385866 ATTAGGGGCAGCTGGATGGAAGG - Intergenic
985486823 5:156558-156580 CTGGGTTGCAGGTGCCTGGAGGG - Intronic
985662959 5:1166435-1166457 ATGAATGGTGGGTGGATGGATGG - Intergenic
985674853 5:1225699-1225721 ATGCGTGGCAGGCGCCTGGCAGG - Intronic
985748392 5:1660577-1660599 ATTTGTGGCAGGAGCAGGGAAGG + Intergenic
986248195 5:6030187-6030209 GTGAGAGACAGGTGCATGCAAGG + Intergenic
990881062 5:60539946-60539968 AGGAAAGGCAGGTACATGGAGGG - Intergenic
991630376 5:68650599-68650621 AGAAGTGGCTGGTGAATGGAAGG - Intergenic
992366255 5:76093197-76093219 ATGACTGGAAGGAGCATGCAAGG - Intronic
992895049 5:81238666-81238688 ATGAGTGGCAGAGGCAGGGGAGG - Intronic
994951763 5:106472300-106472322 GTGAGTGGCAGGTTCATTGTGGG + Intergenic
996215343 5:120859120-120859142 ATGAGAGGCAGGTGGCAGGAGGG - Intergenic
996453882 5:123657901-123657923 ATGAGTGGCAGCTGCCTATAGGG + Intergenic
997598845 5:135125895-135125917 AGGAATGCCAGGTGGATGGAGGG + Intronic
997791182 5:136763768-136763790 ATGGGTGTCAGATGGATGGATGG + Intergenic
998023215 5:138789241-138789263 ATGAGTGGCAGAGGAATGGGAGG + Intronic
998152267 5:139764320-139764342 ATGAGTGGGGGCTGCAGGGAGGG + Intergenic
999129351 5:149271445-149271467 ATGGGTGGCGGCTGCAGGGAAGG + Intergenic
999724357 5:154422841-154422863 GTGAGTGGCAGATGACTGGAAGG - Intergenic
1000388193 5:160695436-160695458 ATGAGTGAGAGGTGGCTGGATGG + Intronic
1000505747 5:162115558-162115580 ATGAGTGGGAGGAGCAAGGGTGG + Intronic
1001302122 5:170541203-170541225 ATCAGAGGCAGCTGTATGGAAGG - Intronic
1002028834 5:176413684-176413706 ATGTGTGCCAGGAGCCTGGATGG - Intronic
1002095731 5:176829611-176829633 ATGGGTGGGAGGTGGATGGATGG + Intronic
1002176067 5:177402225-177402247 GAGAGTGGCTGGGGCATGGAAGG - Exonic
1002821190 6:726513-726535 ATGCTTTGCAGGAGCATGGATGG + Intergenic
1003709272 6:8570798-8570820 AACTGTGGCAGATGCATGGATGG + Intergenic
1004449636 6:15733174-15733196 ATGAGTGTTAGAGGCATGGATGG + Intergenic
1007714634 6:43848584-43848606 ATAGGTGGCAGGTTCATGGTGGG + Intergenic
1007999023 6:46339087-46339109 ATGGGTGGGTGGTGGATGGATGG - Intronic
1008540979 6:52546232-52546254 ATGAGGGGCCTGTGTATGGATGG + Intronic
1008594619 6:53028724-53028746 CTGAGTGTCTAGTGCATGGAGGG + Intronic
1012567258 6:100673844-100673866 AGGAATGTAAGGTGCATGGAGGG - Intronic
1012949381 6:105502003-105502025 ATGACAGCTAGGTGCATGGAAGG - Intergenic
1013182370 6:107729001-107729023 AAAAGTGACAGATGCATGGATGG + Intronic
1013657799 6:112263659-112263681 ATGAATGGATGGTGAATGGATGG - Intergenic
1013974274 6:116059157-116059179 AGGGGTGGTAGGTGGATGGATGG + Intronic
1015515623 6:134080105-134080127 ATGACTGGTTGGTGAATGGATGG + Intergenic
1015553315 6:134434890-134434912 ATGAGTGGATGGTGGATGGTGGG + Intergenic
1015854055 6:137604590-137604612 ATGAGTGGCAGAAGGAAGGAAGG + Intergenic
1015893920 6:137998275-137998297 TTGGGGGGCAGGTGCCTGGATGG + Intergenic
1016824018 6:148371753-148371775 CGGGGAGGCAGGTGCATGGAGGG - Intronic
1019376451 7:695181-695203 GTGATCGGCAGGTGCAGGGATGG + Intronic
1019414941 7:922818-922840 CTGAGAGGCAGGTGCGTGGGCGG - Intronic
1019662039 7:2229961-2229983 GTGAGTGGCATGTGCCTGGGTGG - Intronic
1019960262 7:4453491-4453513 ATGATAGGCAGGTACATAGAGGG + Intergenic
1020589151 7:10113071-10113093 AACAGTGGCAGGTGAAGGGAAGG - Intergenic
1021578168 7:22124114-22124136 ATGAGTGGGAGGTTCAAGGCAGG + Intronic
1021873656 7:25028686-25028708 ATGAGTGGCTAGTGGAAGGAAGG - Intergenic
1021922299 7:25497520-25497542 GGGAGTGGCAGGTGGATGAAGGG - Intergenic
1022353574 7:29588904-29588926 TAGTGTGGCAGGTGCATGGGGGG - Intergenic
1022892967 7:34719945-34719967 AAGTGTGGCATGGGCATGGAGGG - Intronic
1023779135 7:43639894-43639916 ATGACTGACAGGCGAATGGAAGG + Intronic
1024042695 7:45567566-45567588 ATGAGGGGAAGGTGTATGGTGGG + Intergenic
1026203539 7:68235744-68235766 ATGGATGGAAGGTGGATGGATGG + Intergenic
1026478151 7:70754798-70754820 ATGAATGGATGATGCATGGATGG + Intronic
1026762023 7:73134000-73134022 ATGAGTAGCAGGGGTGTGGAGGG + Intergenic
1027038364 7:74942824-74942846 ATGAGTAGCAGGGGTGTGGAGGG + Intergenic
1027085199 7:75258658-75258680 ATGAGTAGCAGGGGTGTGGAGGG - Intergenic
1029550520 7:101234860-101234882 AAGCGTGCCAGGTGCATGGGAGG - Intronic
1031028508 7:116709044-116709066 ATGAGAATCATGTGCATGGAGGG + Intronic
1032991161 7:137396237-137396259 GTGAGTGGCAGGTGGAAGGAGGG + Intronic
1035093517 7:156333570-156333592 ATGAGTGGCAGGGGCAGGTGTGG + Intergenic
1035308838 7:157952276-157952298 AAGAGTGCCCGGTGCAGGGATGG + Intronic
1035557789 8:579427-579449 ATGAGTGGCAGTGCCATTGAGGG + Intergenic
1035854801 8:2963299-2963321 ATAAGTTACAGCTGCATGGACGG - Exonic
1036117385 8:5972790-5972812 GTGCGTGGCAGGTGGATGGATGG - Intergenic
1038325141 8:26567285-26567307 ATGTGTGGTGGGTGGATGGATGG - Intronic
1039869786 8:41536127-41536149 ATGAGTGTCAGTTGAATAGAAGG + Intronic
1039987696 8:42461812-42461834 ATGAGTGGCAGATAGAGGGATGG - Intronic
1040985638 8:53291246-53291268 ATGTGTGGATGGTGCATGGTAGG + Intergenic
1041306959 8:56471514-56471536 ATGTGTGGCATGTGCATGTGTGG - Intergenic
1044599314 8:93988097-93988119 TGGAGTGGCAGGTGCTTAGAGGG - Intergenic
1046275147 8:111949428-111949450 ATGAGTGTCAGGTGGAGTGAGGG - Intergenic
1047541780 8:125774638-125774660 CTGAATGGCAGGAGGATGGAGGG - Intergenic
1048989441 8:139752686-139752708 ATGAATGGTAGATGGATGGATGG - Intronic
1048989575 8:139753308-139753330 ATGGGTGGATGGTGGATGGATGG - Intronic
1049171849 8:141166431-141166453 ATGACTTGCAGGTGCAGGAATGG - Intronic
1049213003 8:141395379-141395401 CTGAGTGGCACGTGCCTGGCGGG - Intronic
1049258408 8:141626002-141626024 ATGAGTGGTGGATGGATGGAGGG + Intergenic
1049364224 8:142228965-142228987 ATGAATGGAAGGTAGATGGATGG + Intronic
1049364270 8:142229160-142229182 ATGAATGGAGGGTGGATGGATGG + Intronic
1049474752 8:142791648-142791670 ATGAGTGGATGGAGAATGGATGG - Intergenic
1049474809 8:142791949-142791971 ATGAGTGGATGGAGAATGGATGG - Intergenic
1050264597 9:3876742-3876764 ATGAGTGCCAGGTACATGCATGG + Intronic
1050878691 9:10673899-10673921 AGGTGTGGCAGCTGCATGGTAGG + Intergenic
1051096465 9:13471630-13471652 GTGATTGGCAGGAACATGGATGG - Intergenic
1052088298 9:24294808-24294830 GTGAGTGGCATGAACATGGATGG + Intergenic
1052091498 9:24334020-24334042 ATGAGTGGCAGATAAATGGAAGG - Intergenic
1053886326 9:42646978-42647000 AGGGTGGGCAGGTGCATGGAGGG + Intergenic
1054225346 9:62454427-62454449 AGGGTGGGCAGGTGCATGGAGGG + Intergenic
1054454284 9:65421569-65421591 ATGAGTGGATGATGGATGGATGG + Intergenic
1054454292 9:65421623-65421645 ATGAGTGGATGATGGATGGATGG + Intergenic
1054716192 9:68559879-68559901 ATGGGTGGCTGATGCAGGGAAGG - Intergenic
1055261020 9:74433769-74433791 TTGAGTAGCAGTTGCATTGAGGG - Intergenic
1055615573 9:78068690-78068712 TTGAATGGAAGCTGCATGGAAGG + Intergenic
1056030766 9:82551131-82551153 AAGATTGCCAGGTGCATTGAGGG + Intergenic
1056705974 9:88953098-88953120 CAGAGTGGCTGGTGCATTGAAGG - Intergenic
1057008726 9:91583320-91583342 ATGAGTGGGTGGAGGATGGATGG + Intronic
1058340154 9:103885793-103885815 AAGATTGGCAGGTGCATCAATGG + Intergenic
1058760848 9:108130390-108130412 ATGAGTGGACTGTGCAGGGAAGG + Intergenic
1058935357 9:109764699-109764721 ATGAATGACTGGTGGATGGATGG + Intronic
1059323620 9:113488282-113488304 GTGAGATGCAGGTGCTTGGAGGG + Intronic
1059758471 9:117316377-117316399 ATGAATGACAGATGGATGGAGGG + Intronic
1061258850 9:129468027-129468049 AGGAGTGGCAAGTGCAAGGCTGG - Intergenic
1061411853 9:130426095-130426117 AGGAGTGGGGGGTGGATGGATGG - Intronic
1061417521 9:130455165-130455187 ATGAATGGATGATGCATGGAAGG - Intronic
1061804731 9:133131585-133131607 ATGGGTGGCTGGGGCAGGGATGG - Intronic
1061903935 9:133686919-133686941 TTGAGTGGCAGCCGCACGGAAGG + Intronic
1062092316 9:134684929-134684951 ATGAATGGATGGTGGATGGATGG - Intronic
1062201303 9:135304247-135304269 ATGGATGGCAGATGGATGGATGG + Intergenic
1062724685 9:138065218-138065240 ATGTGTGGCAGGAGCAAGGTGGG - Intronic
1185496964 X:562005-562027 ATGATTGGTAGGTAGATGGATGG - Intergenic
1185689206 X:2139438-2139460 GTGAATGGCAGGTGGATGGATGG - Intergenic
1186101925 X:6166669-6166691 ATAAGGAGCATGTGCATGGAAGG + Intronic
1186299265 X:8181497-8181519 TTGAGTGGAAGGTGCATGGATGG + Intergenic
1187099364 X:16177023-16177045 TTAAGTAGCAGGTTCATGGATGG + Intergenic
1187282287 X:17866939-17866961 ATGAGAGGCAAGGGCAAGGACGG - Intergenic
1188380189 X:29482120-29482142 ATGAGTAGAAGGAACATGGATGG - Intronic
1189207384 X:39253638-39253660 ATGACTGCCAGGTGAATTGATGG + Intergenic
1190732876 X:53236220-53236242 ATGTGTGGCAGGTGGAGGGAAGG + Intronic
1191801732 X:65088422-65088444 GTGAGTGGCAAGTGAATGTAAGG - Intergenic
1192211818 X:69132670-69132692 ATGAAGGGCAGGGGCATGGAAGG + Intergenic
1192479726 X:71474571-71474593 AACAGTGTCAGGTGCATGGTGGG - Intronic
1196866099 X:120072607-120072629 ATGAGTGGAAGGGGCAAGGACGG + Exonic
1196876997 X:120163674-120163696 ATGAGTGGAAGGGGCAAGGACGG - Exonic
1197106240 X:122720113-122720135 ATGAGGGACTGGTGCATGGATGG - Intergenic
1199599406 X:149533033-149533055 ATGACTGCCAGGGGCATGAAGGG - Exonic
1199651227 X:149947174-149947196 ATGACTGCCAGGGGCATGAAGGG + Intergenic
1199690340 X:150304829-150304851 TGGAGAGGCAGGTGCATGCATGG - Intergenic
1199818439 X:151421025-151421047 AAAAGTGGCAGATGCAGGGATGG - Intergenic
1200062716 X:153490726-153490748 GTGAGTGACAGGTCCCTGGATGG + Intronic
1201144759 Y:11058136-11058158 ATGGGTGGCGGATGGATGGATGG + Intergenic