ID: 1156405173

View in Genome Browser
Species Human (GRCh38)
Location 18:36776314-36776336
Sequence TACACCCTGAGCCTCTGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156405173_1156405174 2 Left 1156405173 18:36776314-36776336 CCATCGCAGAGGCTCAGGGTGTA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1156405174 18:36776339-36776361 TGTACATGATGTTTGATGAATGG 0: 1
1: 0
2: 0
3: 14
4: 206
1156405173_1156405175 29 Left 1156405173 18:36776314-36776336 CCATCGCAGAGGCTCAGGGTGTA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1156405175 18:36776366-36776388 GAAACTGACCAGCAGACAGATGG 0: 1
1: 0
2: 2
3: 27
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156405173 Original CRISPR TACACCCTGAGCCTCTGCGA TGG (reversed) Intronic
900030522 1:368965-368987 TACACCGTGAGCTGCTGAGATGG - Intergenic
900030538 1:369106-369128 TACACCGTGAGCTGCTGAGATGG - Intergenic
900771388 1:4547596-4547618 TACACCCTGAGCCTGAGAGATGG - Intergenic
901757446 1:11449888-11449910 ATCACCCTGATCCTCTGCGACGG + Intergenic
905880210 1:41458166-41458188 TCTGCCCTGAGACTCTGCGATGG + Intergenic
906077895 1:43065452-43065474 TACACACTGAGCCTTTAAGAGGG - Intergenic
910617664 1:89217565-89217587 TCCACCCAGACCCTCTGTGAGGG + Intergenic
912581399 1:110724216-110724238 TATACCATGAGCCTCAGGGAGGG - Intergenic
920117215 1:203629374-203629396 TGCACTCTGAGCCTCCACGATGG - Intronic
920636995 1:207713591-207713613 TACATGCTCAGCCTCTGGGAGGG + Intronic
921369415 1:214406200-214406222 TACAGGCTGAGCCACTGCAACGG - Intronic
922559455 1:226558580-226558602 CAAACCCTGGGCCTGTGCGAGGG + Intronic
923393161 1:233533608-233533630 TACTCCCTGAGGCTCTGCTGTGG - Intergenic
923802908 1:237227750-237227772 GACACCCTGAGCTGCTGGGATGG + Intronic
924788969 1:247226332-247226354 TGCACCCTGAGCTGCTGGGATGG - Intergenic
1064317439 10:14271344-14271366 TGCACCCTGAGCTGCTGGGATGG - Intronic
1067173977 10:43929640-43929662 TCCACCCTGAGTCTGTGCCAGGG - Intergenic
1070226709 10:74515709-74515731 ACCTCCCTGAGCCTCTGAGAAGG - Intronic
1071395807 10:85222877-85222899 AACACACTGAGCCTCTGCAAGGG - Intergenic
1076120444 10:127932810-127932832 TTCATCCTGAGCCTCTGGAAAGG - Intronic
1077309882 11:1883570-1883592 TACACCCAGACCCTCTGAGGTGG - Intronic
1078643184 11:13114804-13114826 TGCACCCTGACCCTCTGGCAAGG - Intergenic
1101323883 12:103697853-103697875 TAAACCTAGAGCCTCTGAGAAGG + Intronic
1104532688 12:129587371-129587393 TACACACTGGGCCTATGTGAGGG + Intronic
1106793094 13:33176277-33176299 TACACTCTGAGCCAGTGCCAAGG - Intronic
1113319245 13:109215770-109215792 CACATCCTGAGACTCTGGGAGGG - Intergenic
1115369567 14:32596923-32596945 TTCACAATGAGCCTCTGAGAAGG - Intronic
1122769608 14:104092142-104092164 TACAGCCTGGGCATCTGGGAGGG + Intronic
1123022626 14:105408769-105408791 TACACCCTTCGTCTCTGCGGTGG - Intronic
1127928588 15:63573288-63573310 TACACACTGAGCCTCTGTGGTGG + Intronic
1128644092 15:69362158-69362180 TTCTCCCTTAGCCTCTGCCAGGG - Intronic
1129235544 15:74221797-74221819 AGCACCCTGAGCCTCTGGGAAGG - Intergenic
1132549700 16:549266-549288 GTCACCCTGAGGCTCTGCGCAGG + Exonic
1132847608 16:2007624-2007646 TCCACCCTGAGCACCTGCCAGGG + Intronic
1134419240 16:14071030-14071052 TCGGCCCTGAGCCTCTGCAAAGG - Intergenic
1135330355 16:21555164-21555186 TACACCTTGAGCCTCTTTCAAGG + Intergenic
1138107246 16:54294640-54294662 CACACCCTGAGGTTCTGGGAAGG - Intergenic
1141848404 16:86626909-86626931 TGCACCCTGGGGCTCTGTGATGG - Intergenic
1141897977 16:86970819-86970841 TAGACACTGAGCCTATGCCAGGG + Intergenic
1142043390 16:87909681-87909703 TACACCTTGAGCCTCTTTCAAGG + Intronic
1145942666 17:28751052-28751074 TAAACCCTCAGCCTCTGCATGGG - Intergenic
1146370833 17:32265088-32265110 TACAGCCAGAGCCTCTGCTTCGG + Intergenic
1146374387 17:32284530-32284552 CAGACACTGAGCCTCTGCCAGGG + Intronic
1149064895 17:52467636-52467658 TTTACCCTGAGCCTATGAGAAGG + Intergenic
1151496033 17:74458637-74458659 TACACTCTGACCTCCTGCGATGG + Intergenic
1152740593 17:82016760-82016782 CTCACCCTGAGCCTCTGAGGAGG - Intronic
1152949230 17:83217521-83217543 TACACCGTGAGCTGCTGAGATGG + Intergenic
1152949234 17:83217568-83217590 TACACCGTGAGCTGCTGAGATGG + Intergenic
1152949238 17:83217615-83217637 TACACCGTGAGCTGCTGAGATGG + Intergenic
1152949242 17:83217662-83217684 TACACCGTGAGCTGCTGAGATGG + Intergenic
1152949246 17:83217709-83217731 TACACCGTGAGCTGCTGAGATGG + Intergenic
1155171005 18:23266887-23266909 CACTCCCTGAGCTTCGGCGAGGG - Intronic
1156405173 18:36776314-36776336 TACACCCTGAGCCTCTGCGATGG - Intronic
1159558662 18:69971156-69971178 TGCACCCTGAGCTGCTGGGATGG + Intergenic
1160222367 18:76986435-76986457 TGCACCCTCAGCCTCTGCTGGGG + Intronic
1163405466 19:17119335-17119357 TGCACCCTGAGGCTCTGAGCAGG + Intronic
1164564091 19:29313657-29313679 CACCCCCTGAGCCTCTGTGCAGG + Intergenic
1167612730 19:50515119-50515141 TACAGCCTGGGCCACTACGAGGG + Intergenic
926800204 2:16653328-16653350 TCCAGTCTGAGCCTCAGCGAGGG - Intronic
938271682 2:129977706-129977728 TACAGCATGAGCCACTGCGCTGG + Intergenic
938444327 2:131366156-131366178 TACAGCATGAGCCACTGCGCTGG - Intergenic
942297002 2:174527539-174527561 TACTCCCTGAGCTTCTGCCTGGG - Intergenic
946303261 2:218839010-218839032 CACACCCTGGGACTCTGGGAAGG - Intergenic
948268608 2:236656902-236656924 GACACCCTGATCCTGTGGGAGGG + Intergenic
948591588 2:239054019-239054041 TCCACCCCCAGCCTCTGTGAGGG - Intronic
948904033 2:240969352-240969374 TAGGCCCTGAGCCTCTGAGGAGG + Intronic
1170812717 20:19687157-19687179 TTCTCCCAGAGCCTCTGCAAAGG - Intronic
1172853052 20:37980583-37980605 CACACCCAGATGCTCTGCGAAGG + Intergenic
1174305358 20:49610980-49611002 GACTCCCTGAGCCTCTGGGGAGG + Intergenic
1176518953 21:7810629-7810651 TTGACCCTGTGCCTCTGGGATGG + Intergenic
1177894569 21:26844524-26844546 GCCGCCCTCAGCCTCTGCGAGGG - Exonic
1178652981 21:34440642-34440664 TTGACCCTGTGCCTCTGGGATGG + Intergenic
1178951563 21:36990057-36990079 TCCACCGCGAGCCTCTGCCAGGG - Intronic
1181339196 22:22165027-22165049 GACACCCAGAGGCTCTGGGAGGG - Intergenic
1184975286 22:48057460-48057482 GACACCCAGAGCGTCTGGGAAGG + Intergenic
950509221 3:13415772-13415794 GGGACCCTGAGCCTCTGGGACGG - Intronic
953357760 3:42268762-42268784 TACAGGCTGAACCTCTGCAAGGG - Intergenic
956622610 3:71236338-71236360 TATTTCCTGAGCCTCTGCTATGG + Intronic
958887639 3:99745109-99745131 TAGACACTGAGCATCTGCCAAGG - Intronic
969509001 4:7606679-7606701 TTCACCCTGAGCTTCAGGGAAGG + Intronic
973861492 4:55069442-55069464 TACAGCCTGCCCCTCTGCTACGG - Intergenic
976398427 4:84582654-84582676 TAGTCCCTGGGCCGCTGCGAGGG - Intergenic
980053099 4:128057552-128057574 TACAGCGTGAGCCACTGCGCTGG - Intergenic
981215378 4:142159699-142159721 AACACCCTGTTCCTCTGCCATGG + Intronic
981305151 4:143239556-143239578 TGCATCCTGAGCTTCTGGGACGG - Intergenic
981936910 4:150248868-150248890 GACCACCTGAGCCTCTGGGAGGG - Intronic
984793407 4:183634997-183635019 TACAGGCTGAGCCACTGCGCTGG + Intergenic
993648850 5:90493521-90493543 TACATCCTGAGCCACTGTGTTGG + Intronic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
1001110849 5:168895012-168895034 TACATCTTCAGCCTCTGGGAGGG - Intronic
1002712524 5:181204021-181204043 TTCTCGCTGAGCCTCAGCGAGGG - Intronic
1002743397 5:181450796-181450818 TACACCGTGAGCTGCTGAGATGG + Intergenic
1002743408 5:181450890-181450912 TACACCGTGAGCTGCTGAGATGG + Intergenic
1002743451 5:181451266-181451288 TACACCGTGAGCTGCTGAGATGG + Intergenic
1002743467 5:181451407-181451429 TACACCGTGAGCTGCTGAGATGG + Intergenic
1003137285 6:3443520-3443542 TACATCCTGAGTCTCTGGGAGGG + Intronic
1003166145 6:3680116-3680138 TCCACAATGAGCCTCTGGGATGG - Intergenic
1007006790 6:38371524-38371546 TTCACCCTGTGCCTCTGCACAGG - Intronic
1007258097 6:40542591-40542613 TGCACCCTGGGCCTCTGAGCTGG + Intronic
1007528976 6:42523166-42523188 TAAGCCCTGAGCCTCTGGCAGGG - Intergenic
1017924175 6:158896509-158896531 TACATCCTGAGCTTCTGGGGAGG + Intronic
1019248347 6:170724848-170724870 TACACCGTGAGCTGCTGAGATGG + Intergenic
1022066087 7:26858999-26859021 CACACACTCAGCCTCTGTGATGG + Intronic
1030772180 7:113488192-113488214 CACAGCCTGAGCCTCCCCGACGG - Intergenic
1033215300 7:139489124-139489146 TACCCTCTGAGCCTCTGAGCAGG - Intergenic
1034294170 7:149957285-149957307 TTCTCCCTGACCCACTGCGATGG + Intergenic
1034811898 7:154139587-154139609 TTCTCCCTGACCCACTGCGATGG - Intronic
1037193533 8:16157199-16157221 TAGACTCTTAGCCTCTGAGATGG + Intronic
1042671531 8:71268766-71268788 TACACACTGAGTATCTGCTATGG - Intronic
1044834337 8:96281068-96281090 TACACCCTTAGGCTCTGCAAAGG + Intronic
1045250702 8:100481362-100481384 CACAGCCTGAGCCTCTGCTCTGG - Intergenic
1047228249 8:122974661-122974683 TACAGCGTGAGCCACTGCGCTGG - Intergenic
1052435854 9:28427999-28428021 TACACACAGAGACTCTGCAAAGG - Intronic
1053490590 9:38498260-38498282 GACACCCTGAGCTGCTGAGAGGG + Intergenic
1054816930 9:69484396-69484418 TCCAGCCAGAGCCTCTGCAAGGG - Intronic
1056777298 9:89522761-89522783 TAAACGCTGAGCCCCTGGGAAGG - Intergenic
1057080946 9:92174168-92174190 TACACCCTGAGAATCTGGTAAGG + Intergenic
1057670913 9:97087509-97087531 CACACCCTGAGCTGCTGAGAGGG + Intergenic
1061873064 9:133530952-133530974 TCCACGCTAAGCCTCTGAGACGG + Intergenic
1203609292 Un_KI270748v1:81972-81994 TACACCGTGAGCTGCTGAGATGG + Intergenic
1203609296 Un_KI270748v1:82019-82041 TACACCGTGAGCTGCTGAGATGG + Intergenic
1203609305 Un_KI270748v1:82113-82135 TACACCGTGAGCTGCTGAGATGG + Intergenic
1198203928 X:134448362-134448384 TAAGCCCTGAGCTTCTGGGATGG - Intergenic