ID: 1156407707

View in Genome Browser
Species Human (GRCh38)
Location 18:36798502-36798524
Sequence GGCCCAGGTGGGTGATGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 1, 2: 1, 3: 42, 4: 406}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156407695_1156407707 25 Left 1156407695 18:36798454-36798476 CCTGTGGGCTAATGCCATAGCTG 0: 1
1: 0
2: 1
3: 8
4: 76
Right 1156407707 18:36798502-36798524 GGCCCAGGTGGGTGATGAGCAGG 0: 1
1: 1
2: 1
3: 42
4: 406
1156407698_1156407707 11 Left 1156407698 18:36798468-36798490 CCATAGCTGGTGAAGGCATATTG 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1156407707 18:36798502-36798524 GGCCCAGGTGGGTGATGAGCAGG 0: 1
1: 1
2: 1
3: 42
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156407707 Original CRISPR GGCCCAGGTGGGTGATGAGC AGG Exonic
900284952 1:1894588-1894610 GGCCCAGGGGGGTCTAGAGCCGG + Intergenic
900482824 1:2907620-2907642 GTCCCAGGTGAGTGGAGAGCCGG - Intergenic
900493208 1:2963218-2963240 GGCCCGCGAGGGTGAGGAGCAGG + Intergenic
900624628 1:3602578-3602600 GCCCCACGTGTGTGCTGAGCAGG - Exonic
900799209 1:4727163-4727185 GGCTCAGGTGGGTGAAGAGCAGG + Intronic
900822481 1:4900021-4900043 GGCATGGGTGGCTGATGAGCTGG + Intergenic
901231095 1:7642101-7642123 GGCCCAGCTGGGTGGTGGGAGGG - Intronic
901237848 1:7677031-7677053 AGCCCCAGTGGGTGTTGAGCTGG - Intronic
901807478 1:11747678-11747700 AGCCCAGGAGGCTGATGAACAGG - Intronic
901884579 1:12214011-12214033 GGCCGAGGCGGGTGATCACCTGG + Intergenic
902228250 1:15010624-15010646 GGCCAAGGTGGGTGATCACGAGG - Intronic
902453896 1:16517777-16517799 GGCCCAGGTGGGTGGTCACGAGG + Intergenic
902498576 1:16892532-16892554 GGCCCAGGTGGGTGGTCACGAGG - Intronic
902889455 1:19431462-19431484 GGCCAAGGTGGGTGGAGATCAGG + Intronic
903049934 1:20593157-20593179 GGCCCAGGTGAATGATGATGAGG + Intronic
903050197 1:20594907-20594929 GCGCCGGGTGGGTGATGGGCAGG + Intronic
903332129 1:22601639-22601661 GGCCCATGAGGGTGATGCCCAGG - Exonic
903641469 1:24863072-24863094 GGCCTGGGTGTCTGATGAGCTGG + Intergenic
904042374 1:27592339-27592361 GGGCTGGGTGGGTGACGAGCTGG - Intronic
904067138 1:27762079-27762101 GGCTCGGGTGGGTGAGGAGTGGG - Intronic
904386905 1:30148838-30148860 GGAGCAGGTGGGGGTTGAGCAGG + Intergenic
904618226 1:31761157-31761179 GGGGCAGGCGGGTGATGAGGAGG + Intronic
905146022 1:35887316-35887338 AGCCCAGGTGGGAGAAGAGAGGG - Intronic
906061482 1:42952015-42952037 GGCCAGGATGGGTGATGAGGGGG + Intronic
906637853 1:47421564-47421586 GGCCCAGGATGGTGCTGAGCTGG + Intergenic
906702793 1:47872075-47872097 GGACCAGGTGTGTGATGTGTCGG + Intronic
906718981 1:47992166-47992188 GGCCCAGGCTGGTGATGGGTTGG + Intronic
907222133 1:52914854-52914876 GGGCCAGGTGGGTGATCCGAGGG - Intronic
909705183 1:78573095-78573117 GGCCCAGGTGGTTCATGATAAGG - Intergenic
910584369 1:88862868-88862890 GGCCGAGGTGGGTGGAGATCAGG - Intronic
912513088 1:110201562-110201584 GGCCCAGATGGGGGCTGAACAGG + Exonic
913393920 1:118345402-118345424 GCCACAGGTGGGAGATGAGTGGG - Intergenic
915670232 1:157482835-157482857 GGACCAGGTGGGTGAGGTGAAGG - Intergenic
915786183 1:158614985-158615007 TGTCCAAGTGGGTGATGAGTAGG + Intronic
915972223 1:160362861-160362883 GGCTCAGTTGGGTGCTGAGAAGG + Intergenic
917194314 1:172449781-172449803 GGTAGAGGTGGGGGATGAGCGGG + Intronic
917500799 1:175583275-175583297 AGCCCAGGTAGGAGCTGAGCTGG + Intronic
917504945 1:175618998-175619020 TGCCCAGGTGGGTGAAGGGCTGG + Intronic
917562406 1:176173075-176173097 GGCCGAGGTGGGTGATCACGAGG + Intronic
917945620 1:179967644-179967666 GGCCGAGGTGGGCGATCACCTGG - Intronic
917973049 1:180220616-180220638 TGCACAGGTGGGAGCTGAGCAGG - Intergenic
918309412 1:183275039-183275061 GCCCCAGGTGGGTGTGGAGCAGG + Intronic
920094307 1:203475942-203475964 AGCCCAGTTGGGAGATGGGCAGG + Intronic
920106441 1:203556610-203556632 GGGCCGGGAGGGTGGTGAGCAGG - Intergenic
921138284 1:212282730-212282752 GGCCGAGGTGGGTGATCACGAGG - Intergenic
922791049 1:228311276-228311298 GGCCCAGGTAGGTGTTGTGGTGG + Intronic
923749798 1:236737038-236737060 GAACGAGGTGGGTGATGAGAGGG - Intronic
923755211 1:236785618-236785640 GCCCCAGGTGTGTGCTCAGCTGG - Intergenic
924087051 1:240463412-240463434 GGCCCAGGTGGGTGAGAGGAAGG + Intronic
1062885436 10:1012326-1012348 GGCCCAGGTGGGTCTGGACCAGG + Intronic
1062941277 10:1423151-1423173 GGCAAAGGTGGGAGCTGAGCTGG - Intronic
1063570932 10:7213897-7213919 GGCACAGATGGCTGAAGAGCAGG + Intronic
1064569670 10:16679741-16679763 GGGCCACGTGGGAGCTGAGCTGG - Intronic
1065651362 10:27895522-27895544 GGCCGAGGCGGGTGAATAGCTGG - Intronic
1067852747 10:49764988-49765010 GGCCAAGGTGGGGGATGATGAGG - Intergenic
1069892715 10:71662008-71662030 GGCCCAGGTGAGTGAGGGGCTGG + Intronic
1071483527 10:86082488-86082510 GGCCCAGGTGAGAGATGATGAGG - Intronic
1071496445 10:86170515-86170537 GGCCCAGCAGGGAGAAGAGCAGG - Intronic
1072782098 10:98258116-98258138 GGCCCAGGTGGGCGAGGGCCGGG - Exonic
1072807819 10:98435733-98435755 GGGCTAGGAGGGTGCTGAGCTGG + Exonic
1073191067 10:101650970-101650992 GGCCCAGGCGGGAGATTTGCCGG - Intronic
1075777364 10:124997419-124997441 GGCCCAGGAGGGTCTTCAGCAGG - Intronic
1076536588 10:131181687-131181709 GGGCCAGGTGGGCCAGGAGCAGG + Intronic
1076668957 10:132108631-132108653 GGACCAGGTAGGAGAAGAGCAGG - Intronic
1076799608 10:132814561-132814583 GGCCCAGGTGGGTGCTGCACAGG - Exonic
1077106537 11:844727-844749 GGGCCAGGAGGGTGAGGCGCTGG + Intronic
1077134624 11:992232-992254 GGCCCAGGTGGGAGGTGGCCTGG + Intronic
1077180141 11:1208581-1208603 GGGCCAGGTGGGGCAGGAGCCGG + Intergenic
1077192521 11:1261349-1261371 GGCCAAGGTGGCTGATGTGAGGG + Intronic
1077319576 11:1935266-1935288 GGCCGAGCTGGGTGATGATGGGG - Intronic
1077516245 11:3003685-3003707 GGCTGAGGTGGGGGAGGAGCTGG + Intronic
1077777191 11:5284781-5284803 GGCCCAGATGGGTTATAGGCTGG - Intronic
1077981830 11:7308710-7308732 TGTCCAGGCGGGTGATGAGATGG - Intronic
1079547520 11:21651718-21651740 GGGCCAGGTTGGGGATGAGTTGG + Intergenic
1080566630 11:33515556-33515578 TCCCCACGTGGGTGGTGAGCAGG + Intergenic
1080600991 11:33820448-33820470 GGCACAGGTGTCTGGTGAGCTGG - Intergenic
1080618689 11:33968247-33968269 GCCCCAGGTGGTTGATCAGCTGG - Intergenic
1081586078 11:44384808-44384830 TGCCCAGGTGGGTGCCCAGCAGG - Intergenic
1081779049 11:45697185-45697207 GACCCAGGCTGGTGATGAGCAGG - Intergenic
1082786903 11:57322356-57322378 AGCCCAGGTTGGGGAGGAGCGGG - Intronic
1083471714 11:62888585-62888607 GGCCTGGCTGGGTGCTGAGCAGG - Exonic
1083719544 11:64597636-64597658 GGCCCCGGTGGGTGTAGGGCAGG + Intronic
1083804858 11:65067553-65067575 GGCCCACGTGGCTGGTGAACGGG - Intronic
1083895751 11:65618940-65618962 GGCCCAGGTTGGGGTGGAGCAGG + Exonic
1084361169 11:68669556-68669578 GACCCTGGTGGGTGTGGAGCAGG - Intergenic
1084489564 11:69471097-69471119 GGCCGTGGTGGGCGCTGAGCAGG + Intergenic
1085186672 11:74581667-74581689 GGCCAAGGTGGGCGATCACCAGG + Intronic
1087097891 11:94337464-94337486 GGCACATGTGGGTGATGTGCAGG - Intergenic
1088805011 11:113344411-113344433 GGTCAAGGTGGTTGATGATCAGG - Exonic
1088884279 11:113994770-113994792 GGCACAGGTGTGTGATGGGGTGG - Intergenic
1089731770 11:120523782-120523804 AGCCCAGCTGGGAGATGATCAGG + Intronic
1089740321 11:120577797-120577819 GGGGCAGGTGGGTGTTTAGCTGG + Intronic
1090426114 11:126608116-126608138 GGCCCAGGTGGAGTCTGAGCTGG + Intronic
1090948183 11:131449780-131449802 TGCACAGGTGGGACATGAGCTGG - Intronic
1090951359 11:131476357-131476379 GGCCCAGGTACATGATTAGCTGG - Intronic
1091411365 12:242018-242040 GGCCCAGGTGTGCGATGGGCTGG + Intronic
1093673497 12:21905236-21905258 GGCCCCGGTGTGTGATGTGAGGG - Intronic
1094348623 12:29498572-29498594 GGGGCAGGTGGGAGATGAGCAGG + Intergenic
1096750549 12:53756169-53756191 CGGCCAGGTGGGGGATGGGCTGG + Intergenic
1096844129 12:54396123-54396145 GAGCCAGGGGGGTGAGGAGCTGG - Exonic
1096891455 12:54775897-54775919 TGCCCAGATGGGTGATAAGAAGG + Intergenic
1099953573 12:89330337-89330359 GGCCGAGGTGGGTGAGTAGCTGG - Intergenic
1101758602 12:107641035-107641057 GTCCCAGCTGGGTGGCGAGCAGG + Intronic
1102036172 12:109771617-109771639 GGCCCTGCAGGGTGAGGAGCTGG + Intergenic
1102458829 12:113087655-113087677 GGGCCAAGTGGGTGAGGAGGGGG - Intronic
1102954881 12:117052917-117052939 GCCCCAGGAGGGTGCTGAGCAGG - Intronic
1104013564 12:124948282-124948304 CACCCAGGAGGGTGAAGAGCTGG + Intronic
1104730889 12:131104740-131104762 GGCCCAGGTGGGTGCACAGCTGG - Intronic
1108870077 13:54974190-54974212 GGCCAAGGTGGGTGATCACGAGG - Intergenic
1113539994 13:111099520-111099542 TGCTCATGTGGGTGGTGAGCTGG + Intergenic
1113593740 13:111517837-111517859 GGCCCACGTGGGTGGTAAGCAGG - Intergenic
1114251662 14:20967097-20967119 GGTCCTGGTGGGTTATGAGATGG + Intergenic
1120254866 14:82105920-82105942 GGGGCAGGTGGGTGGGGAGCAGG - Intergenic
1120719113 14:87871243-87871265 GGCCAAGGTGGGTGAATTGCTGG - Intronic
1120791742 14:88590356-88590378 GAGGCAGGTGGGTGATGAGAAGG - Intronic
1121266007 14:92603089-92603111 GGCCCTGGTGGGTGGAGACCAGG + Intronic
1122032375 14:98921790-98921812 GGCAGAGCTGGCTGATGAGCAGG - Intergenic
1122100227 14:99402598-99402620 GACCCAGGTGGGTGGGGAGTGGG - Intronic
1122298838 14:100720395-100720417 GGCACAGGTGGGAGGTGAGAGGG - Intergenic
1122425934 14:101605239-101605261 GGCCCAGAGGGGTGGTGAGGAGG - Intergenic
1122797420 14:104212930-104212952 GGCCCAGGCAGGTGAGGAGATGG + Intergenic
1122885789 14:104709740-104709762 GCCCCAGGTGGGAGGAGAGCAGG + Intronic
1123011234 14:105350535-105350557 GGGCCACGTGGCTGCTGAGCTGG - Intronic
1123467774 15:20529155-20529177 GACTCAGGTGGGTGCTGGGCCGG - Intergenic
1123650339 15:22471887-22471909 GACTCAGGTGGGTGCTGGGCCGG + Intergenic
1123728087 15:23124364-23124386 GACTCAGGTGGGTGCTGGGCCGG - Intergenic
1123740747 15:23280729-23280751 GACTCAGGTGGGTGCTGGGCCGG + Intergenic
1123746251 15:23321829-23321851 GACTCAGGTGGGTGCTGGGCCGG - Intergenic
1124278518 15:28345146-28345168 GACTCAGGTGGGTGCTGGGCCGG - Intergenic
1124304182 15:28566462-28566484 GACTCAGGTGGGTGCTGGGCCGG + Intergenic
1124765597 15:32484714-32484736 GACTCAGGTGGGTGCTGGGCTGG - Intergenic
1125602465 15:40923170-40923192 GGCCAGGGTGGAGGATGAGCAGG + Intergenic
1127260470 15:57323362-57323384 GGCCACGGTGGGTGGGGAGCAGG + Intergenic
1127299618 15:57639851-57639873 GACCCAAGGGGGTGATGGGCAGG + Intronic
1128074753 15:64819101-64819123 GGCCCAGGTGAGTGGGAAGCAGG - Exonic
1128097810 15:64971601-64971623 GGCCAAGGTGGGTGATCACAAGG + Intronic
1129664732 15:77573236-77573258 GGCCCAGGTGGCTGCCGAGGTGG + Intergenic
1129986566 15:79923866-79923888 GGGCCAGGTGTGTGAGGGGCGGG + Intergenic
1131119502 15:89813948-89813970 GGCCCAGGTGGGCTATGTCCTGG - Intronic
1131221294 15:90586593-90586615 GGCCAAGGTGGGTGATCATGAGG - Intronic
1131404895 15:92156217-92156239 GCCCCAGGTGAGAGATGAGAGGG + Intronic
1131981209 15:97996566-97996588 GGCCCAGCTGGCTGATGAATGGG - Intergenic
1132024452 15:98392956-98392978 AGCCCAGGAGACTGATGAGCAGG + Intergenic
1132581161 16:685241-685263 GACCCAGGTGTGTGGTGGGCGGG - Exonic
1132708000 16:1254777-1254799 GGCCCAGGTGAGTCAGGAGGTGG + Intergenic
1132858243 16:2057116-2057138 GGCCCAGGTGGGTGCCAAGGAGG - Exonic
1132870165 16:2112324-2112346 GCCCCAGGTGAGGGATGAGGGGG - Exonic
1132973974 16:2702472-2702494 GGCCAAGGTGAGTGCTGGGCCGG + Exonic
1133054645 16:3139496-3139518 GGCCCAGGCTGGTGAGCAGCTGG - Intronic
1133130993 16:3676027-3676049 GGCCCGGGTGCGAGGTGAGCGGG - Exonic
1133287783 16:4698551-4698573 GGGCCAGGTGTGTCAGGAGCAGG - Exonic
1133615770 16:7475546-7475568 GGCCAAGGTGGGTGATCACGAGG - Intronic
1133622682 16:7541736-7541758 GGCCCAGGTGGTTAATGACTAGG - Intronic
1134063225 16:11211372-11211394 GGTCCAGGTGGGAGATGAGGAGG - Intergenic
1134503718 16:14789192-14789214 GGCCCATGTGGGAGATGGGAGGG + Intronic
1134504060 16:14791055-14791077 GGCCCACCTGGGTGAAGAACAGG - Intronic
1134522380 16:14924632-14924654 GCCCCAGGTGAGGGATGAGGGGG + Intronic
1134576512 16:15337853-15337875 GGCCCACCTGGGTGAAGAACAGG + Intergenic
1134710050 16:16323283-16323305 GCCCCAGGTGAGGGATGAGGGGG + Intergenic
1134717263 16:16363283-16363305 GCCCCAGGTGAGGGATGAGGGGG + Intergenic
1134725588 16:16416782-16416804 GGCCCATGTGGGAGATGGGAGGG + Intergenic
1134725931 16:16418646-16418668 GGCCCACCTGGGTGAAGAACAGG - Intergenic
1134866024 16:17607891-17607913 TGCACAATTGGGTGATGAGCTGG - Intergenic
1134941503 16:18293213-18293235 GGCCCACCTGGGTGAAGAACAGG + Intergenic
1134941846 16:18295076-18295098 GGCCCATGTGGGAGATGGGAGGG - Intergenic
1134949553 16:18345362-18345384 GCCCCAGGTGAGGGATGAGGGGG - Intergenic
1134957489 16:18388876-18388898 GCCCCAGGTGAGGGATGAGGGGG - Intergenic
1136533805 16:30887538-30887560 GGCCCAGGCGAGGGCTGAGCAGG + Intronic
1138008461 16:53357841-53357863 GACTCAGGTGGGTGCTGGGCTGG - Intergenic
1138329696 16:56203839-56203861 GGCTCATGTGGCTGAAGAGCTGG + Intronic
1138513137 16:57520203-57520225 GGGCCAGGTGGCTGGAGAGCAGG - Intronic
1138542320 16:57695908-57695930 GGCCCATGTGGGTGTGGAGTTGG + Intronic
1139342055 16:66273895-66273917 GGCCAAGGAATGTGATGAGCAGG + Intergenic
1139468776 16:67167396-67167418 GGCCCAGGTGGGTGTTGGTGGGG + Intronic
1139569500 16:67802172-67802194 GGGCCAGGTGGGTTTTGAGGAGG - Intronic
1141620541 16:85234842-85234864 GGCCCAGCTGGGGGATTAGAAGG + Intergenic
1142416649 16:89946897-89946919 GGCCCAGGTGGGAGCTGAGATGG + Intergenic
1142799891 17:2338123-2338145 GGCGCAGGTGGGTGTCGTGCGGG + Intronic
1142891780 17:2948534-2948556 GGCACAGGGTGGTGATGAGATGG + Intronic
1142891811 17:2948672-2948694 GGCACAGGGTGGTGATGAGATGG + Intronic
1143014317 17:3883602-3883624 GGCCCAGGTAAGTGTTAAGCGGG + Intronic
1143660059 17:8319103-8319125 GGCCCTGGTGGTTGCTGAGAAGG - Exonic
1143780353 17:9225871-9225893 GCCCCTGCTGGGTGAAGAGCAGG + Intronic
1143847674 17:9785484-9785506 GGCCAAGGTAGGTCATGAGTTGG + Intronic
1144703598 17:17353585-17353607 GGCCAAGGAGGGTGAGGAGAAGG + Intergenic
1144728678 17:17514569-17514591 GGCACTGGTGGGTGGAGAGCTGG - Intronic
1144782863 17:17816637-17816659 GGTCCAGGTGGGAGGTGGGCAGG + Exonic
1144808731 17:17984995-17985017 GGCCCAGGTGTGAGAGGACCTGG - Intronic
1144810264 17:17994367-17994389 GGCCCAGCTGGAGGACGAGCAGG + Exonic
1145957041 17:28861767-28861789 AGCCCAGGTGGGTTATGGGAAGG + Intergenic
1146169481 17:30621681-30621703 GGGCCAGCTGGGTGAGGAGTTGG + Intergenic
1146170081 17:30625768-30625790 GGGCCAGCTGGGTGAGGAGTTGG - Intergenic
1146286180 17:31575535-31575557 GGGCCAGGTGGGTGAGAGGCAGG - Exonic
1146343534 17:32041797-32041819 GGGCCAGCTGGGTGAGGAGTTGG - Intronic
1146607708 17:34275455-34275477 GGCCCCGGTGTGTGATGTTCTGG + Intergenic
1148077496 17:44947335-44947357 GGCCCCGGTGGCAGATGTGCAGG + Intronic
1148083588 17:44980796-44980818 GGCCCCTGTGGGTGATGAGATGG - Intergenic
1148859268 17:50595613-50595635 GACCCAAGTGGGTGATGAAGGGG - Intronic
1149286616 17:55172187-55172209 AGCCCATGTGGGCGATGACCAGG + Intergenic
1149786210 17:59437455-59437477 TGCCCAGGTTGGTGTTGAACTGG + Intergenic
1150229112 17:63540197-63540219 GGCCGAGGTGGGTGATCACAAGG + Intronic
1151459737 17:74247482-74247504 GGCCAAGGGGTGTGAAGAGCAGG + Intronic
1151523714 17:74649163-74649185 GCCCCAGGTGAGTGGTGAACTGG - Intergenic
1151946391 17:77322132-77322154 GGCCCAGATGGGTGACCAGCAGG + Intronic
1152095878 17:78271415-78271437 GGGCCATGTGGAGGATGAGCAGG + Intergenic
1152689125 17:81709823-81709845 GGCCGAGGTGGGTGATCACCTGG - Intergenic
1152917817 17:83051239-83051261 GGACCAGGTGTGTGAGGTGCGGG + Intronic
1154119902 18:11643845-11643867 GGCCGAGGTGGGTGGTGCCCAGG - Intergenic
1154237522 18:12619611-12619633 GGCCGAGGTGGGTGATCAGGAGG + Intronic
1155233555 18:23796982-23797004 GGCCCCGGTGGGTGAAGGTCTGG + Intronic
1155297453 18:24397981-24398003 GGCCCAGGCGGGACAGGAGCGGG - Intergenic
1155333889 18:24745753-24745775 AGCCCAGGTGGGGGCTGAGCAGG - Intergenic
1156407707 18:36798502-36798524 GGCCCAGGTGGGTGATGAGCAGG + Exonic
1156699805 18:39812165-39812187 GGCCAAGGTGGGTGATCACAAGG - Intergenic
1157108788 18:44800086-44800108 GAACCAGGTGTGTGATGGGCAGG + Intronic
1158026076 18:52898870-52898892 GTCCCAGCTGGGTGAGGGGCTGG + Intronic
1158603993 18:58878619-58878641 GGCCCAGGTGGCTGAGGTGAGGG + Intronic
1158770486 18:60511000-60511022 GGCCGAGGTGGGTGATCATGAGG + Intergenic
1160198242 18:76775034-76775056 GGCCGAGGTGGGTGATCACGAGG - Intergenic
1160513563 18:79466070-79466092 GGCCCAGTGGGGTGGGGAGCAGG + Intronic
1160726258 19:619068-619090 AGCCCATGTGGGAGATGAGGCGG + Exonic
1160784017 19:891483-891505 GGCCCAGGTGAGTGATGATGGGG + Intronic
1161069858 19:2254546-2254568 GGCCCTGCTGGGTGACGTGCGGG + Intronic
1161243274 19:3234829-3234851 GGTCCAGGTGAGGGATGAGGGGG - Intronic
1161342313 19:3750044-3750066 GGCCAAGGTGGGGGATGGGATGG + Intronic
1161361999 19:3855693-3855715 GGGCCTGGTGGGTGAGGAGGAGG + Intronic
1161420747 19:4174874-4174896 GCCCCAGGTGCTTCATGAGCCGG + Exonic
1161569730 19:5023984-5024006 GGCCAAGGTGGGTGATCACTTGG - Intronic
1161982425 19:7637071-7637093 GGTCCACGTGGGTGACGCGCGGG + Intronic
1162360487 19:10217119-10217141 GGTACAGGTGGGTGCAGAGCTGG + Intronic
1162373956 19:10294327-10294349 GGCCCAGGCGGGTAGGGAGCAGG + Intronic
1162575198 19:11495210-11495232 GGCCCCGGTGAGTGGTGAGGGGG - Intronic
1162922873 19:13913632-13913654 CCCCCAGGTAGGTGATGGGCAGG + Exonic
1163315078 19:16535956-16535978 GGCCTAGGTGGGTGAGGAGGTGG - Intronic
1163536195 19:17877967-17877989 GGCCGACCTGGTTGATGAGCAGG - Exonic
1164588108 19:29490264-29490286 GGCGAAGGTGGAGGATGAGCTGG - Intergenic
1164747892 19:30629429-30629451 GGCCGAGGTGGGTGAATGGCTGG - Intronic
1165721926 19:38085244-38085266 GGCCAAGGTGGGTGATCACAAGG + Intronic
1166073128 19:40398050-40398072 GGACCAGGCGGGGGATGTGCTGG + Intronic
1166321080 19:42019239-42019261 GGGCCAGGTGTGTGAGGTGCTGG - Intronic
1166552485 19:43675601-43675623 GGCCCAGGTGAGTCACGAGGAGG - Intergenic
1167217620 19:48175318-48175340 GGAGCAGGTGGTTGATGAGCCGG + Intronic
1167390258 19:49190242-49190264 GGCCCAGATGGGTGTAGTGCTGG - Exonic
925129225 2:1482486-1482508 GGCCCACCTGGGAGGTGAGCAGG + Intronic
925348886 2:3187892-3187914 TGCACAGGTGGGTGAGGAGTGGG - Intergenic
926321727 2:11753088-11753110 GGGCAAGGAGGGGGATGAGCAGG + Intronic
926385750 2:12334215-12334237 GGCTCAGGAGGGTGACGAACTGG + Intergenic
926820755 2:16849104-16849126 GGTCCATGTGGGTGTTGGGCAGG - Intergenic
926874079 2:17456228-17456250 GGCCCTGGTGTGTGATGTTCAGG - Intergenic
927100531 2:19784551-19784573 GGCCCAGGTGGGGAAGGAGAAGG - Intergenic
927509659 2:23636517-23636539 GGCCCAGATGGGCTGTGAGCAGG - Intronic
927651924 2:24918519-24918541 GGCCCAGGTAGGAGAAGATCTGG + Exonic
927930218 2:27039028-27039050 GGCCCTGGTGGGAGGGGAGCAGG - Exonic
929092275 2:38230888-38230910 GGAACAGGTGGGTGAGTAGCCGG + Intergenic
929455413 2:42061535-42061557 GGCCCAGAGGGGTGAAGAGCAGG + Intergenic
930049746 2:47205787-47205809 GGCAAAGGAGGGTGATGAGATGG + Intergenic
932073982 2:68646115-68646137 TGGCCAGGTTGGCGATGAGCAGG - Exonic
932869334 2:75381181-75381203 GGCCCAGCTGCGGGATGAGCTGG + Intergenic
933902870 2:86861916-86861938 GGCTGGGGTGGGTGAGGAGCTGG + Intronic
934780081 2:96964459-96964481 GGCCCAGGTGGCAGAGGAGACGG + Intronic
935612221 2:105037688-105037710 TGCCCAGGTGGAGGAAGAGCCGG + Intergenic
935684914 2:105674640-105674662 GAGCCAGCTGGGTGATGACCTGG - Intergenic
935777675 2:106487354-106487376 GGCTGGGGTGGGTGAGGAGCTGG - Intergenic
936061252 2:109297072-109297094 GGTCCAGGTGGGGGGTGACCGGG + Intronic
936585782 2:113756569-113756591 GGCCCAGGAGGGCGTGGAGCGGG + Exonic
937331262 2:121031784-121031806 GGGCCATGTGGGTGATGTGGAGG + Intergenic
937335390 2:121059339-121059361 AGCCCAGGTGGGTGAAGGGCAGG - Intergenic
937885176 2:126894706-126894728 GAGCCAAGAGGGTGATGAGCAGG + Intergenic
937972994 2:127564654-127564676 GGGCCAGCTAGGTGGTGAGCAGG + Intronic
937984527 2:127632577-127632599 GGCCCAGGAGGGTCAAGAGAAGG + Intronic
938120842 2:128632068-128632090 GGCGCAGGTGCGGGAGGAGCAGG - Intergenic
938140677 2:128792004-128792026 AGCCCTGGTGGATGCTGAGCAGG + Intergenic
938160301 2:128979445-128979467 GCCCCTGGTGGCTGTTGAGCAGG + Intergenic
938833514 2:135076141-135076163 GGCTGAGGCGGGTGATCAGCAGG - Intronic
939171464 2:138701183-138701205 GGCCCAAGTGGGTGAGAAGTGGG + Intronic
941646522 2:168046772-168046794 GGGTCAGGTGGGTGATGGGAGGG + Intronic
942516913 2:176764063-176764085 GGACGAGGTGAGTGATGAGTTGG - Intergenic
944494824 2:200296048-200296070 GGCCCAGGTGAGTGGTCAGCAGG - Intergenic
946410203 2:219511796-219511818 GGACCAGCTGGGCAATGAGCCGG + Intergenic
946417043 2:219544903-219544925 AGCCCAGGTGAGGGATGAGATGG - Intronic
946899303 2:224356876-224356898 GGCCGAGGTGGGCGATCAGGAGG + Intergenic
947126079 2:226869857-226869879 GTCCCAGGAGGGAGATGTGCAGG + Intronic
948178540 2:235962297-235962319 GGCCCATGACGGTGCTGAGCAGG + Intronic
948385040 2:237575846-237575868 GGCCCAGGTGGGTGCCGTCCAGG - Intronic
948973572 2:241448215-241448237 GGACCAGGAGGGTGATGGTCAGG - Intronic
1169510282 20:6256421-6256443 GGCAGCAGTGGGTGATGAGCAGG - Intergenic
1171375389 20:24690599-24690621 GTCCCAGGTGGCTGGTGAGCAGG + Intergenic
1171976155 20:31596027-31596049 GGCCCAGTTGGGTAGTGGGCAGG + Intergenic
1172883669 20:38217498-38217520 AGCCAAGGTGGGTGCTGAGTGGG - Intronic
1173202215 20:40962418-40962440 GGCCCAGGTGGGAGCAAAGCTGG - Intergenic
1174378391 20:50141068-50141090 AGCCCAGGTGTGTGCTGTGCAGG - Intronic
1174395552 20:50244676-50244698 GGCCCAGGTGGGAGGTAGGCAGG - Intergenic
1174415199 20:50361377-50361399 GGCCTAGGTGGGTGCAGGGCAGG + Intergenic
1176415864 21:6474458-6474480 GTCCCAGGGGGGTGAGGGGCTGG + Intergenic
1178680841 21:34670621-34670643 CGGCCAGGTGGTTGCTGAGCTGG - Exonic
1178905039 21:36629713-36629735 GGCCGAGGTGGGTGGTCAGGAGG + Intergenic
1179691364 21:43082792-43082814 GTCCCAGGGGGGTGAGGGGCTGG + Intergenic
1179959127 21:44758482-44758504 GGCCCAGCTGGGGTGTGAGCCGG + Intergenic
1180183187 21:46127051-46127073 GGCCCACGTGGGTGTGAAGCTGG + Intronic
1180748604 22:18109911-18109933 CCCCCAGGTGGGTGAGGGGCTGG - Intronic
1180864209 22:19106544-19106566 GGCCCTCATGGGTGAGGAGCCGG - Intronic
1181270091 22:21653524-21653546 GGATCAGGTGGGTGCAGAGCTGG + Intronic
1181760074 22:25052132-25052154 GGCCCAGGAGAGAGAGGAGCTGG - Intronic
1181994700 22:26867668-26867690 GGCCCAGGTGGGTAAATTGCTGG - Intergenic
1182105552 22:27686529-27686551 GGCCCAGGAGGGTCATGCCCTGG - Intergenic
1182919756 22:34068506-34068528 AGCCAAGGTGGGTGAGAAGCGGG - Intergenic
1183213290 22:36464056-36464078 GGCCGGGGTGGGGGTTGAGCTGG + Intergenic
1183776709 22:39970940-39970962 GGCCCTGGAGGATGACGAGCTGG + Exonic
1184097955 22:42326663-42326685 GGCCCAGAGGGGTGATGTGCTGG - Intronic
1184415434 22:44349385-44349407 GGGGCAGGGGAGTGATGAGCTGG - Intergenic
1184458105 22:44622818-44622840 TGCCCACCTGGGTGTTGAGCGGG - Intergenic
1184688597 22:46107465-46107487 GGCCCAGGCGGGGGAGGGGCCGG - Intronic
1185266709 22:49907866-49907888 AGCCCAGGGGGATGAAGAGCAGG + Exonic
1185388639 22:50547706-50547728 GGCTGAGGTTGGTGCTGAGCTGG - Intergenic
1185392601 22:50570734-50570756 GGCCCAGGTGGGGTGTGGGCGGG + Intronic
950226232 3:11236805-11236827 GCCCCAGGTGTGGGATGAGGTGG + Intronic
953164472 3:40452852-40452874 GGCCCAGATGGGGGATGCGAGGG - Intergenic
953183251 3:40615817-40615839 GGCCGAGGAGGGTGTTGAGCGGG - Intergenic
953603994 3:44396393-44396415 GGCCTAGGTGGCAGAGGAGCTGG + Exonic
955284412 3:57625002-57625024 GGCTCAGGTGGGTGAGGGGATGG - Intergenic
955412749 3:58666653-58666675 GGCCCAGGGTGGTGGTCAGCTGG - Exonic
955527817 3:59839021-59839043 CGCCCAGCTGGGAGATGAGATGG - Intronic
955865359 3:63376581-63376603 GGGAGAGGTGGGTGATGAACAGG - Intronic
956167057 3:66405080-66405102 GGCCCAGGCGGAAGAGGAGCTGG - Intronic
956727508 3:72168658-72168680 GGACCAGGAGGGTGAGGAGATGG - Intergenic
957577815 3:82032071-82032093 AGCCCAGGTGGAAGATCAGCGGG + Intergenic
961354509 3:126327498-126327520 GGCCACAGTGGGTGAGGAGCAGG + Intergenic
961829879 3:129618011-129618033 GGCCGAGGAGGGTGCTGGGCTGG + Intergenic
963025863 3:140918007-140918029 GGGCCAGGTGTGTGATCAGCAGG + Intergenic
965373500 3:167893344-167893366 GGAGCTGGTGGGGGATGAGCAGG + Intergenic
966135594 3:176694814-176694836 GGCCAAGGTGGGTGAGGCGCAGG - Intergenic
967990705 3:195128271-195128293 CGCCCTGGTGGGTGATGATGTGG - Intronic
968076989 3:195821464-195821486 GTCACAGGCGGGTGAAGAGCAGG - Intergenic
968493406 4:902499-902521 GGCTCAGGTGGGAGATCACCTGG + Intronic
968903988 4:3443414-3443436 GGCCCAGGTGGGTGCTGGGTTGG + Exonic
969257467 4:6011898-6011920 GGGCCACGTGGGTGCTCAGCTGG + Intergenic
969563404 4:7963515-7963537 GGCCCAGGTTGGTGCTGATCCGG + Intergenic
969685958 4:8674425-8674447 GGCCCAGGTAGCAGCTGAGCAGG - Intergenic
969714128 4:8860328-8860350 GGTCATGGTGGGTGCTGAGCGGG + Intronic
970370091 4:15397378-15397400 GGCCCAGGAGGTTGCAGAGCAGG - Intronic
977002239 4:91518875-91518897 GGCCCAGATTGGTGAAGAGTGGG + Intronic
979878095 4:125918636-125918658 GGCAAAAGTGGATGATGAGCTGG + Intergenic
981749683 4:148081932-148081954 TGCCCAGGAGGGTGAGGAGCAGG + Intronic
984961678 4:185103490-185103512 GGCCCAGGTGGGAGAATTGCTGG + Intergenic
986067005 5:4244329-4244351 AACCCAGGTGAGGGATGAGCTGG + Intergenic
986309910 5:6544252-6544274 GGCCCAGGAAGGGGATGAACAGG - Intergenic
987574968 5:19713924-19713946 TGCCCAGGCAGGTGTTGAGCTGG - Intronic
988518316 5:31923923-31923945 AGCCCAGGTGGGTCAGAAGCAGG - Intronic
992099271 5:73390550-73390572 GGCCCCGGTGTGTGATAATCTGG - Intergenic
993647421 5:90477441-90477463 GGTCCAGGTGAGAGATGAGAGGG + Intronic
997407825 5:133665934-133665956 GGCCCAGGTATGTGATGCTCCGG - Intergenic
997436064 5:133876558-133876580 TACCCAGGTGGGTGTGGAGCTGG - Intergenic
999238355 5:150113385-150113407 GGTCCAGGTGAGTCATGATCAGG - Intergenic
999241137 5:150128065-150128087 GACCGAGATGTGTGATGAGCGGG - Intronic
999266601 5:150270730-150270752 GGCCTAGGTGAGTGTTGAGGGGG - Intronic
999371294 5:151056837-151056859 GGCCCAGGTGGGTGAAGAGCTGG + Exonic
1000097806 5:157986590-157986612 GGCCAAGGTGGGAGAGGAGGCGG - Intergenic
1001114867 5:168931053-168931075 GGACCAGGAGGGTGTTGGGCCGG - Intronic
1001887946 5:175312717-175312739 GGCCCAGGTGAGAGATGAAGTGG - Intergenic
1001950147 5:175810702-175810724 GGCAGAGGTGGGTGGTGAGTGGG - Intronic
1002066196 5:176652997-176653019 AGCCCAGGTGGGTAAGGAGATGG - Intronic
1003417011 6:5918647-5918669 GGCCCAGGTTGGAAATGAGCAGG - Intergenic
1004516381 6:16325588-16325610 GCCCCAGGTGGGTCAGGAGGTGG - Intronic
1005292678 6:24394936-24394958 GAGCAAGGTGGGTGAGGAGCTGG - Intergenic
1006072168 6:31505996-31506018 GGCTCAGCAGGGTGGTGAGCCGG + Intronic
1006863201 6:37187370-37187392 GGCCCTGCTGGGAGATGAGAGGG - Intergenic
1006990252 6:38209210-38209232 GGACCAGATGGGTGATGTGAGGG - Intronic
1008119644 6:47597470-47597492 GGCCCAGGTGAGTGAGAAGGTGG + Intronic
1011069071 6:83361491-83361513 GGCCCAAGTGGCAGAGGAGCTGG - Intronic
1014125074 6:117768178-117768200 GGCCCAAGTGGGTAAGGAGCAGG - Intergenic
1017408281 6:154142619-154142641 GGCCCAGGTGGGTGACTTGAAGG - Intronic
1017727386 6:157284948-157284970 GGGCCAGGTGGCAGAGGAGCTGG + Intergenic
1018090766 6:160345834-160345856 GGCCTTGCTGGGTGATGGGCAGG + Intergenic
1018947300 6:168356724-168356746 GGCCCAGGACGGTGCTCAGCAGG + Intergenic
1018947348 6:168356889-168356911 GGCCCAGGAAGGTGCTCAGCAGG + Intergenic
1018947381 6:168356999-168357021 GGCCCAGGACGGTGCTCAGCAGG + Intergenic
1018947397 6:168357054-168357076 GGCCCAGGACGGTGCTCAGCAGG + Intergenic
1018947413 6:168357109-168357131 GGCCCAGGATGGTGCTCAGCAGG + Intergenic
1018947431 6:168357164-168357186 GGCCCAGGACGGTGCTCAGCAGG + Intergenic
1018947480 6:168357329-168357351 GGCCCAGGAAGGTGCTCAGCAGG + Intergenic
1018947513 6:168357439-168357461 GGCCCAGGACGGTGCTCAGCAGG + Intergenic
1018947613 6:168357768-168357790 GGCCCAGGAAGGTGCTCAGCAGG + Intergenic
1018947645 6:168357878-168357900 GGCCCAGGACGGTGCTCAGCAGG + Intergenic
1018947803 6:168358372-168358394 GGCCCAGGAAGGTGCTCAGCAGG + Intergenic
1018947836 6:168358482-168358504 GGCCCAGGACGGTGCTCAGCAGG + Intergenic
1018947851 6:168358537-168358559 GGCCCAGGACGGTGCTCAGCAGG + Intergenic
1018947925 6:168358757-168358779 GGCCCAGGACGGTGCTCAGCAGG + Intergenic
1018947992 6:168358976-168358998 GGCCCAGGACGGTGCTCAGCAGG + Intergenic
1019996875 7:4730308-4730330 GGCCAGGGTGAGTGATGGGCAGG + Intronic
1022197487 7:28082894-28082916 GGCACTGGTGGGTTCTGAGCTGG - Intronic
1022296958 7:29064632-29064654 GGGCCAGGTTGGTGGTGTGCTGG + Intronic
1023864456 7:44232224-44232246 GGCCTAGGTGGGAGCTGGGCTGG + Intronic
1024004076 7:45212517-45212539 GGCCCAGGTGGGCTGTGGGCTGG + Intergenic
1024310363 7:47963673-47963695 GGCCAAGGTGGGTGATCACGAGG + Exonic
1024553734 7:50585000-50585022 CCTCCAGGTGGCTGATGAGCGGG + Intergenic
1025211500 7:57021511-57021533 GGCCCACGTGGGTCTTGACCTGG + Intergenic
1025660455 7:63555336-63555358 GGCCCACGTGGGTCTTGACCTGG - Intergenic
1026061326 7:67029218-67029240 GGCCGAGGTGGGTGATCACGAGG - Intronic
1026208564 7:68280691-68280713 GGCACAGGAGGGTGTGGAGCTGG - Intergenic
1026876635 7:73882992-73883014 GGCCCTGAAGGGAGATGAGCCGG + Intergenic
1026944847 7:74309102-74309124 GGCCGAGGTGGGTGAATTGCTGG - Intronic
1026977438 7:74507113-74507135 AGCCCAGCTGGGTCAGGAGCCGG - Intronic
1027188275 7:75984354-75984376 GGCCCAGGTTGGTGACCAGTGGG - Intronic
1027224122 7:76233463-76233485 AGCCGAGGTGGGTGGGGAGCAGG + Intronic
1027837102 7:83258391-83258413 GGCCCAGGTGAGTGAAGACTGGG - Intergenic
1029437752 7:100572491-100572513 GCCCCGGGAGGGTGATGGGCGGG + Exonic
1033583718 7:142759129-142759151 AGCTCAGGTTGGTGATGGGCAGG - Intronic
1034717392 7:153256185-153256207 GGCCCAGCTGTGGGCTGAGCTGG + Intergenic
1035050235 7:155994522-155994544 GGCTCAGGAGGGAGCTGAGCAGG - Intergenic
1035531269 8:353226-353248 GGCCCCGTTGGCTGAAGAGCAGG - Intergenic
1035593943 8:839758-839780 TGCCCATGTGGGTGATGAAACGG - Intergenic
1036645041 8:10607581-10607603 GGCCCAGGAGGCTGAAGAGGAGG - Exonic
1037815661 8:22110306-22110328 GGCCGAGCTGGGAGAGGAGCAGG - Intergenic
1038011777 8:23481813-23481835 TCCCCATGTGGGTGATGAGCTGG - Intergenic
1039400597 8:37265894-37265916 GGCCCAGGTGGGTAAGGTGTGGG - Intergenic
1040515762 8:48133389-48133411 CGCCCAGGTGAGTGATGATGGGG - Intergenic
1042217843 8:66444222-66444244 AGACCAGGTGGGAGATGACCTGG + Intronic
1043359283 8:79452021-79452043 GGCCCAGCTGGGTAGTCAGCAGG + Intergenic
1043532239 8:81164181-81164203 GGCCCATGTGGGTAATCAGTTGG + Intergenic
1043938212 8:86167560-86167582 GGCCCAGGTGGGCGATCACTTGG + Intergenic
1045550177 8:103164323-103164345 GGACCTTGTGAGTGATGAGCAGG + Intronic
1048437790 8:134433830-134433852 AGGCCAGGTGGGTGAGCAGCTGG - Intergenic
1048498872 8:134958025-134958047 GGCCCAGGTGGCAGAAGAGGCGG + Intergenic
1049488492 8:142878751-142878773 GGCCAAGGTTGGTGCAGAGCGGG + Intronic
1049499373 8:142953411-142953433 GGGACAGGTGGGTCATGAGGTGG - Intergenic
1049747663 8:144269847-144269869 GGCGCTGGTGAGTGAGGAGCAGG + Intronic
1049773133 8:144392926-144392948 GTCACAGGTGGGTGGGGAGCAGG - Intronic
1052900899 9:33794279-33794301 AGCTCAGGTTGGTGATGGGCAGG - Intronic
1053289890 9:36872936-36872958 GGGGCTGGTGGGAGATGAGCTGG - Intronic
1055426341 9:76200755-76200777 GGCCCAGGCAGGGGATGAGCAGG + Intronic
1057192903 9:93097097-93097119 GCCCCATGAGGGTGATGGGCTGG + Intronic
1060157422 9:121329309-121329331 GGACCAGGTGGGTGAAGGACAGG + Exonic
1060591590 9:124820471-124820493 GTGCCAGGAGGGTGATGGGCAGG - Intergenic
1060959550 9:127670349-127670371 GGCCAAGGTGGGTGGATAGCTGG - Intronic
1061178035 9:129009102-129009124 GGCCCTGCTGGCTGATGAGGTGG - Exonic
1061204169 9:129153345-129153367 GGCCCAGGTCAGGGTTGAGCCGG + Intergenic
1061669820 9:132182459-132182481 GGCCCAAGTGGGTGGGGGGCTGG + Intronic
1061678067 9:132229491-132229513 GGCCCTGGAGGGTGATGGGCTGG - Intronic
1061700982 9:132415417-132415439 GCCCCAGGGTGGTGACGAGCCGG - Intronic
1062367305 9:136216970-136216992 GGCGCAGGTGGGTGAGCTGCAGG - Intronic
1062562852 9:137149469-137149491 GGCCCAGGGAAGTGATGTGCAGG + Intronic
1186355282 X:8783827-8783849 GCCGCAGGGGGGCGATGAGCAGG + Intergenic
1189962597 X:46338601-46338623 GGCCGAGGTGGGTGATCACAAGG + Intergenic
1192310961 X:70013624-70013646 GGCCCTGCTTGGTGAAGAGCAGG - Intronic
1195141168 X:101961697-101961719 GGCCCAGGTGAGTGATAAGTTGG + Intergenic
1196111811 X:111954496-111954518 GGCCTAGTTGGGTGATGGGTTGG + Intronic
1196651623 X:118173898-118173920 GGCCAAGGTGGGTGATCATGAGG + Intergenic
1197768792 X:130075951-130075973 GGCCCAGGAGGAGGAAGAGCAGG + Intronic
1200256481 X:154585552-154585574 GGGCCAGGTGGGGGAGGAGGCGG + Intronic
1200261288 X:154618851-154618873 GGGCCAGGTGGGGGAGGAGGCGG - Intronic
1200411466 Y:2866115-2866137 GGCCAAGTTGGGTGATCACCAGG - Intronic