ID: 1156411045

View in Genome Browser
Species Human (GRCh38)
Location 18:36828755-36828777
Sequence GTCGCGAGCCATGGAGGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 174}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156411045_1156411054 3 Left 1156411045 18:36828755-36828777 CCTCCTCCTCCATGGCTCGCGAC 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1156411054 18:36828781-36828803 GATTCGCGCGCGGCGGGAGCGGG 0: 1
1: 0
2: 1
3: 8
4: 75
1156411045_1156411057 10 Left 1156411045 18:36828755-36828777 CCTCCTCCTCCATGGCTCGCGAC 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1156411057 18:36828788-36828810 GCGCGGCGGGAGCGGGTGGAGGG 0: 1
1: 0
2: 0
3: 38
4: 438
1156411045_1156411049 -7 Left 1156411045 18:36828755-36828777 CCTCCTCCTCCATGGCTCGCGAC 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1156411049 18:36828771-36828793 TCGCGACCGCGATTCGCGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 5
1156411045_1156411058 14 Left 1156411045 18:36828755-36828777 CCTCCTCCTCCATGGCTCGCGAC 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1156411058 18:36828792-36828814 GGCGGGAGCGGGTGGAGGGCCGG 0: 1
1: 1
2: 6
3: 112
4: 1228
1156411045_1156411055 6 Left 1156411045 18:36828755-36828777 CCTCCTCCTCCATGGCTCGCGAC 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1156411055 18:36828784-36828806 TCGCGCGCGGCGGGAGCGGGTGG 0: 1
1: 0
2: 2
3: 34
4: 283
1156411045_1156411051 -3 Left 1156411045 18:36828755-36828777 CCTCCTCCTCCATGGCTCGCGAC 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1156411051 18:36828775-36828797 GACCGCGATTCGCGCGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 13
1156411045_1156411056 9 Left 1156411045 18:36828755-36828777 CCTCCTCCTCCATGGCTCGCGAC 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1156411056 18:36828787-36828809 CGCGCGGCGGGAGCGGGTGGAGG 0: 1
1: 0
2: 3
3: 54
4: 545
1156411045_1156411050 -4 Left 1156411045 18:36828755-36828777 CCTCCTCCTCCATGGCTCGCGAC 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1156411050 18:36828774-36828796 CGACCGCGATTCGCGCGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 10
1156411045_1156411053 2 Left 1156411045 18:36828755-36828777 CCTCCTCCTCCATGGCTCGCGAC 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1156411053 18:36828780-36828802 CGATTCGCGCGCGGCGGGAGCGG 0: 1
1: 0
2: 1
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156411045 Original CRISPR GTCGCGAGCCATGGAGGAGG AGG (reversed) Exonic
900138239 1:1127865-1127887 GTCTCCAGCCACGGTGGAGGAGG - Intergenic
902895209 1:19474978-19475000 GCAGGGAGCTATGGAGGAGGCGG + Intronic
903808658 1:26022445-26022467 GTCACCAGCCAGGCAGGAGGAGG - Exonic
904028268 1:27518600-27518622 GATAGGAGCCATGGAGGAGGGGG + Intergenic
905356727 1:37389956-37389978 GTCTCCAACCATGGAGGTGGAGG - Intergenic
905518315 1:38578401-38578423 GGAGCGAGCCAGAGAGGAGGGGG + Intergenic
905973474 1:42157764-42157786 GTGTGGAGCCATGGAGGAGTAGG - Intergenic
906488206 1:46247642-46247664 CTCGCGACCCAAGGAAGAGGCGG - Intergenic
907946114 1:59138033-59138055 GGGGAGAGCCAAGGAGGAGGTGG - Intergenic
907971880 1:59391148-59391170 ATCCCAAGCCAGGGAGGAGGTGG - Intronic
908455219 1:64296883-64296905 GTTGTGAGCCCTGGAGGAAGAGG + Intergenic
910104726 1:83619333-83619355 GAGGCTAGCCTTGGAGGAGGTGG + Intergenic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
913317871 1:117567594-117567616 GTCCCGGGCCATTGAAGAGGAGG - Intergenic
917219828 1:172716952-172716974 GGAGGGGGCCATGGAGGAGGAGG + Intergenic
920043069 1:203116407-203116429 GGGTCCAGCCATGGAGGAGGAGG + Intronic
922170508 1:223150571-223150593 GACGGGGGCTATGGAGGAGGAGG - Intergenic
923064274 1:230503894-230503916 GTGGGGAGGCAGGGAGGAGGAGG + Intergenic
1064040300 10:11956902-11956924 TGCTTGAGCCATGGAGGAGGAGG - Intronic
1067319657 10:45205738-45205760 GGCGCGAGCCAAGGAAGAGCAGG - Intergenic
1069741815 10:70689736-70689758 GCCGCGAACCATGGAGGACTCGG - Intronic
1078451130 11:11441783-11441805 GTAGCTGGCCCTGGAGGAGGAGG - Intronic
1081863535 11:46347549-46347571 AGCGCGCGCCATGGAGGTGGCGG + Intronic
1083258656 11:61511333-61511355 GTCTAGAGTCATGGAGGGGGTGG - Intergenic
1083317030 11:61822051-61822073 GGCGTGAGCCCTGGAGGCGGAGG - Intronic
1089581463 11:119484130-119484152 GTGGCTGGGCATGGAGGAGGGGG + Intergenic
1091793220 12:3283279-3283301 GTGGAGTGCCAGGGAGGAGGAGG + Exonic
1094499474 12:31009279-31009301 GTCGGCAGGCCTGGAGGAGGAGG - Intergenic
1095974360 12:47929140-47929162 CTGGGGAGCCATGGAGGAAGTGG - Intronic
1097170994 12:57112531-57112553 GTAGCAAGGGATGGAGGAGGAGG - Intronic
1099083992 12:78222178-78222200 TTCTCCAGCCATGGAGGAGACGG + Intergenic
1102965958 12:117125592-117125614 GAAGTGAGCCATGTAGGAGGGGG - Intergenic
1103883839 12:124186437-124186459 GTTGGGAGCCATGGAGGAGAGGG + Intronic
1103954281 12:124567658-124567680 GGCGCGAGCCCGGGAGGCGGTGG + Intergenic
1104987220 12:132603895-132603917 CTCACCAGCCCTGGAGGAGGAGG - Intronic
1114007721 14:18332655-18332677 GGCGCGAGCCAAGGAAGAGCAGG + Intergenic
1114627893 14:24141292-24141314 CTCGCTCGCCATGGGGGAGGTGG - Exonic
1117141056 14:52791530-52791552 GGCGCGGGCGGTGGAGGAGGAGG - Exonic
1119612465 14:76075105-76075127 GTCAGGAGCCATGCAGGAGCAGG - Intronic
1121332547 14:93058483-93058505 GTCACGAGGCAGGGTGGAGGGGG + Intronic
1121332582 14:93058591-93058613 GTCACGAGGCAGGGTGGAGGGGG + Intronic
1121865134 14:97355950-97355972 GGCGTGAGCCAGGGAGGCGGAGG - Intergenic
1124493966 15:30175275-30175297 GTAGCAGGCAATGGAGGAGGTGG + Intergenic
1124749603 15:32363371-32363393 GTAGCAGGCAATGGAGGAGGTGG - Intergenic
1126457329 15:48878027-48878049 GTGGCGCGCCAAGTAGGAGGCGG + Exonic
1131302302 15:91210328-91210350 GTCCCGAACCAAGCAGGAGGTGG + Intronic
1132398310 15:101489798-101489820 GGCGGGAGCCGGGGAGGAGGAGG + Exonic
1134125720 16:11614681-11614703 ATCTCGAGCCCTGGAGGTGGAGG - Intronic
1135024617 16:18989550-18989572 GTCCCCACCCTTGGAGGAGGAGG + Intronic
1143029386 17:3959477-3959499 GTCCAGAGCCAGGGAGAAGGGGG + Intronic
1143290718 17:5825957-5825979 GTCTCCAGCCCTGGGGGAGGAGG - Intronic
1145035020 17:19534565-19534587 ATCCCGAGGCACGGAGGAGGGGG + Intronic
1146353854 17:32118054-32118076 GTCCCGAGGCATGGAGGACGTGG + Intergenic
1147475144 17:40703652-40703674 GCCTCCAGCCCTGGAGGAGGAGG + Exonic
1149545490 17:57500482-57500504 GGAGCGAGCTCTGGAGGAGGAGG + Intronic
1152100175 17:78296822-78296844 GTCACAAGCCATGAAGAAGGCGG - Intergenic
1152314797 17:79573878-79573900 GTCCTGAGCCAGGGAGGAGAAGG - Intergenic
1152417207 17:80170495-80170517 GTCACAAGCCCAGGAGGAGGGGG - Intronic
1152581249 17:81166381-81166403 GAGGGGAGGCATGGAGGAGGGGG + Intergenic
1152810955 17:82382715-82382737 GGCGCCTGCCTTGGAGGAGGAGG + Intergenic
1154529741 18:15331308-15331330 GGCGCGAGCCAAGGAAGAGCAGG - Intergenic
1156411045 18:36828755-36828777 GTCGCGAGCCATGGAGGAGGAGG - Exonic
1160268680 18:77364012-77364034 GTCGAGAGCCCTGCAGGAGGTGG + Intergenic
1161120953 19:2526052-2526074 GGCGTGAACCCTGGAGGAGGAGG - Intronic
1161216502 19:3097356-3097378 TACGGGAGCCATGGGGGAGGAGG - Intronic
1161761394 19:6175531-6175553 GTAGCCAGCCATGGGGGTGGGGG + Intronic
1161802765 19:6424927-6424949 ATCGCGAGCTCTGTAGGAGGTGG + Intergenic
1161821912 19:6534861-6534883 GTTCCGAGCCTCGGAGGAGGCGG - Exonic
1165081847 19:33311467-33311489 CTCTGGAGCCATGGTGGAGGGGG - Intergenic
1165313067 19:35040167-35040189 GCCGCCAGGCAGGGAGGAGGCGG - Intronic
1166142087 19:40810694-40810716 GGCGCGCGTCCTGGAGGAGGCGG - Intronic
1166378659 19:42343408-42343430 ATCAGGAGCCATGGAGGTGGTGG + Intronic
1167119404 19:47507682-47507704 CTCGAGAGCCGTGCAGGAGGTGG - Intronic
1167569850 19:50280278-50280300 GGTGCGAGCCATGGAGGCTGAGG + Exonic
1168699963 19:58431906-58431928 GGCGTGAGCCATTTAGGAGGTGG + Intergenic
928089341 2:28364436-28364458 GTCCCTTGCAATGGAGGAGGTGG - Intergenic
929790002 2:45015148-45015170 GTCACCAGCCAGGCAGGAGGGGG - Intergenic
929894505 2:45946642-45946664 GTGGAGTTCCATGGAGGAGGAGG + Intronic
930391136 2:50763040-50763062 GAAGAGAGCCCTGGAGGAGGAGG - Intronic
932476767 2:72011318-72011340 GTCGCTGGCCACGGGGGAGGGGG - Intergenic
933734137 2:85481445-85481467 GTCGTGAGCCATGGGGCAGGTGG - Intergenic
936427839 2:112435144-112435166 GTCGAGAGCGAGGGAGGAGGTGG - Intergenic
937448298 2:121976908-121976930 CTGGGGAGCCATGGAGAAGGTGG + Intergenic
938528835 2:132162748-132162770 GGCGCGAGCCAAGGAAGAGCAGG - Intronic
942164643 2:173230357-173230379 GCCTCGAGCCATGGTAGAGGAGG + Intronic
942578604 2:177392780-177392802 GGCGGTAGCCATGGCGGAGGCGG + Exonic
943593094 2:189822155-189822177 GGCGCGGGCAGTGGAGGAGGAGG + Intronic
946965320 2:225031145-225031167 GTTGCCAGTCCTGGAGGAGGAGG - Intronic
947468884 2:230381982-230382004 GCCAGGAGCCATGTAGGAGGAGG - Intronic
947592359 2:231393049-231393071 GTCCCAAGCCAAGGTGGAGGTGG - Intergenic
1169195998 20:3682200-3682222 GGCGCGCGCCATGGGGGAGCCGG + Exonic
1169354710 20:4896997-4897019 GGTGGGAGCCCTGGAGGAGGTGG - Intronic
1171115728 20:22523369-22523391 TTGGCGAGCCCTGGAGCAGGCGG + Intergenic
1171255869 20:23688738-23688760 GCTGCGAGCCAGGGAGCAGGTGG - Exonic
1171973374 20:31578601-31578623 ACCGGGCGCCATGGAGGAGGGGG + Intergenic
1173778817 20:45736222-45736244 ACCGGGAGCCATGGAGCAGGGGG - Intergenic
1175233246 20:57489671-57489693 GGCTTGAGCCATGGAGGCGGAGG - Intergenic
1176374409 21:6080067-6080089 GTTGAGAGCGAGGGAGGAGGTGG + Intergenic
1176550155 21:8217346-8217368 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1176569083 21:8400381-8400403 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1176576997 21:8444616-8444638 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1176767671 21:13037164-13037186 GGCGCGAGCCAAGGAAGAGCAGG + Intergenic
1177213787 21:18103643-18103665 GTCTGGAGCCATGGTGGAGATGG + Intronic
1179267468 21:39817051-39817073 GTTGGGAGCAAGGGAGGAGGAGG - Intergenic
1179457266 21:41508131-41508153 GGCGCGAGCTAAGCAGGAGGCGG - Intronic
1179749067 21:43458178-43458200 GTTGAGAGCGAGGGAGGAGGTGG - Intergenic
1180189426 21:46155389-46155411 GGCCCAGGCCATGGAGGAGGTGG - Intronic
1180432226 22:15263465-15263487 GGCGCGAGCCAAGGAAGAGCAGG + Intergenic
1180825554 22:18858564-18858586 GCGCCGAGGCATGGAGGAGGTGG - Intronic
1181187178 22:21115983-21116005 GCGCCGAGGCATGGAGGAGGTGG + Intergenic
1181212022 22:21294510-21294532 GCGCCGAGGCATGGAGGAGGTGG - Intergenic
1181397475 22:22632376-22632398 GCGCCGAGGCATGGAGGAGGTGG + Intergenic
1181491502 22:23263141-23263163 GGCGGCAGCCAGGGAGGAGGAGG + Intronic
1181500225 22:23311751-23311773 GCGCCGAGGCATGGAGGAGGTGG + Exonic
1181651931 22:24263686-24263708 GCGCCGAGGCATGGAGGAGGTGG - Intergenic
1181705447 22:24647057-24647079 GCGCCGAGGCATGGAGGAGGTGG + Intergenic
1182620764 22:31617249-31617271 GTAGAGAGCCATGGTGGAGATGG - Intronic
1184610282 22:45599021-45599043 GTCGGGGGCCATGGAGATGGCGG + Intronic
1184788044 22:46681214-46681236 GAGCCGGGCCATGGAGGAGGCGG + Intergenic
1203214933 22_KI270731v1_random:922-944 GCGCCGAGGCATGGAGGAGGTGG + Intergenic
1203255048 22_KI270733v1_random:133678-133700 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1203263104 22_KI270733v1_random:178757-178779 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1203275706 22_KI270734v1_random:84471-84493 GCGCCGAGGCATGGAGGAGGTGG - Intergenic
950387723 3:12673224-12673246 GAGGTGAGCCATGGAGGTGGTGG - Intergenic
951436480 3:22670787-22670809 GTCCTGAGCCATGGGAGAGGAGG + Intergenic
955911557 3:63863880-63863902 GTAAACAGCCATGGAGGAGGAGG + Exonic
957084954 3:75669910-75669932 GTCGCGAGCTTCGGAGGTGGAGG - Intergenic
959398259 3:105868646-105868668 GGCGCGGGCCAAGGAGGAAGAGG - Intronic
959894738 3:111593649-111593671 GGAGCGAGCCCTGGAGGAGGTGG - Exonic
960704034 3:120464861-120464883 GTCAGGAGCCAGGGAGCAGGTGG - Intergenic
961333250 3:126155229-126155251 GAAGAGAGCCGTGGAGGAGGAGG - Intronic
961519734 3:127460073-127460095 ATCACCAGGCATGGAGGAGGGGG - Intergenic
968986668 4:3879419-3879441 GTCTCTAGCCAAGGAGGAGGGGG + Intergenic
975838965 4:78454383-78454405 GTCCAGAGCAATGGTGGAGGAGG + Intronic
977880777 4:102202931-102202953 GTCTTGAGCCCTGGAGGCGGAGG + Intergenic
993837758 5:92835612-92835634 GGCACGACCCATGGAGAAGGAGG - Intergenic
995072266 5:107937953-107937975 GTCTCTAGCCATGTAGGAGAAGG - Intronic
996006880 5:118432073-118432095 GTCGTGAGCCCTTGAGGTGGAGG - Intergenic
999105006 5:149063112-149063134 CTCGTGTGCCAGGGAGGAGGCGG - Exonic
999645705 5:153715033-153715055 GTCACAAGGGATGGAGGAGGTGG + Intronic
1000014705 5:157266492-157266514 GCCGCCAGCCCGGGAGGAGGCGG + Intronic
1002447059 5:179296210-179296232 CCAGAGAGCCATGGAGGAGGTGG + Intronic
1010609092 6:77930528-77930550 GTCCTGAGCCATGGTGGAAGGGG - Intergenic
1011325169 6:86142712-86142734 GCCATGAGCCAAGGAGGAGGGGG + Intergenic
1011686626 6:89829082-89829104 CTCTCGAGCCTTGGAGGTGGAGG + Intergenic
1017905706 6:158756366-158756388 GTTGCGGGGAATGGAGGAGGGGG + Intronic
1019261082 7:82363-82385 GGCCCGCGCCAGGGAGGAGGCGG - Intergenic
1019571917 7:1716834-1716856 GACGGCAGCCATGGAGGGGGAGG + Intronic
1019623080 7:2002091-2002113 GTCGCAGGCCCTGGAGGAGCTGG - Exonic
1024548171 7:50539454-50539476 GTCCAGAGCCTTGGAGCAGGGGG - Intronic
1024550045 7:50555132-50555154 GTCAGCAGGCATGGAGGAGGAGG + Intronic
1025994310 7:66518549-66518571 GTCGCGGGCCATGGTGCGGGCGG + Intergenic
1026832502 7:73618705-73618727 GTAGGGAGACATGGAGGTGGGGG + Intronic
1026979792 7:74519549-74519571 GAAGCTGGCCATGGAGGAGGAGG - Exonic
1026985920 7:74555238-74555260 GTCGGGAGCCATGGTGTGGGCGG + Intronic
1028600110 7:92591762-92591784 GTCGGGGGTAATGGAGGAGGAGG - Intergenic
1033147111 7:138880819-138880841 GGAGCGAGGCAGGGAGGAGGCGG + Intronic
1033285883 7:140040217-140040239 CTGGCGTGACATGGAGGAGGGGG - Intronic
1033360893 7:140638500-140638522 GTGGGGAGGCCTGGAGGAGGAGG - Intronic
1041167329 8:55102611-55102633 GTCGGGAGCCGAGGACGAGGAGG + Exonic
1043441950 8:80283948-80283970 GCCGGGAGCCAGAGAGGAGGAGG + Intergenic
1045249196 8:100468982-100469004 GTCTATAGCCATGGAGGGGGAGG + Intergenic
1049563617 8:143325819-143325841 GCTGCCCGCCATGGAGGAGGAGG + Intronic
1049612520 8:143562110-143562132 CCTGCGAGCCTTGGAGGAGGCGG + Exonic
1051166385 9:14266509-14266531 TTCACGAGCCAGGGAGGTGGAGG + Intronic
1052680687 9:31688034-31688056 GGCGTGAACCCTGGAGGAGGTGG - Intergenic
1053707449 9:40769077-40769099 GGCGCGAGCCAAGGAAGAGCAGG - Intergenic
1054417361 9:64889845-64889867 GGCGCGAGCCAAGGAAGAGCAGG - Intergenic
1056083284 9:83119570-83119592 GAAGCAAGCCATGGAGGAGTTGG + Intergenic
1061158329 9:128878866-128878888 CGCGGGAGCCTTGGAGGAGGTGG + Intronic
1062621862 9:137426440-137426462 GCCAGGAACCATGGAGGAGGGGG - Intronic
1203471448 Un_GL000220v1:116818-116840 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1203479269 Un_GL000220v1:160790-160812 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1186133848 X:6497781-6497803 GTGGGGAGGCATGGAGGAAGAGG - Intergenic
1188003494 X:25002568-25002590 CGCGCGCGCCCTGGAGGAGGGGG - Intergenic
1189446545 X:41085859-41085881 GTCGCCGGCCAAGGAGGAGGAGG + Exonic
1190328267 X:49219776-49219798 GGTGCCAGACATGGAGGAGGAGG - Exonic
1192738909 X:73874752-73874774 GTGGGGAGCCATGGAGGTGAGGG - Intergenic
1195200635 X:102547132-102547154 GTCGTCGGCCAAGGAGGAGGAGG + Intergenic
1196172994 X:112610369-112610391 GTCCCTAGCTCTGGAGGAGGTGG - Intergenic
1196393487 X:115234016-115234038 GCGGCGAGTCAGGGAGGAGGCGG - Exonic
1200022779 X:153226016-153226038 GAAGTGAGCCATGGAGCAGGTGG + Intergenic
1200123794 X:153803874-153803896 GACGCGAGGCCTGGAGGAGCTGG - Exonic