ID: 1156411243

View in Genome Browser
Species Human (GRCh38)
Location 18:36829497-36829519
Sequence CAGGGTGGGCAGAGGGACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 641
Summary {0: 1, 1: 1, 2: 5, 3: 62, 4: 572}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156411243_1156411248 -7 Left 1156411243 18:36829497-36829519 CCGAGGTCCCTCTGCCCACCCTG 0: 1
1: 1
2: 5
3: 62
4: 572
Right 1156411248 18:36829513-36829535 CACCCTGTCAGAGTGCCCCCAGG 0: 1
1: 0
2: 2
3: 14
4: 120
1156411243_1156411257 30 Left 1156411243 18:36829497-36829519 CCGAGGTCCCTCTGCCCACCCTG 0: 1
1: 1
2: 5
3: 62
4: 572
Right 1156411257 18:36829550-36829572 CGGAGCTAGCTCGAAGTTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 29
1156411243_1156411256 29 Left 1156411243 18:36829497-36829519 CCGAGGTCCCTCTGCCCACCCTG 0: 1
1: 1
2: 5
3: 62
4: 572
Right 1156411256 18:36829549-36829571 GCGGAGCTAGCTCGAAGTTGAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1156411243_1156411254 10 Left 1156411243 18:36829497-36829519 CCGAGGTCCCTCTGCCCACCCTG 0: 1
1: 1
2: 5
3: 62
4: 572
Right 1156411254 18:36829530-36829552 CCCAGGCTGACTTGAGTGTGCGG 0: 1
1: 0
2: 4
3: 21
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156411243 Original CRISPR CAGGGTGGGCAGAGGGACCT CGG (reversed) Intronic
900230660 1:1555409-1555431 CAGCCTGGGCAGTGGCACCTCGG + Intronic
900294930 1:1944052-1944074 ATGGTTGGGGAGAGGGACCTTGG - Intronic
900427618 1:2587629-2587651 GAGGGTGGGCAGAGGAACAGAGG + Intronic
900554861 1:3275399-3275421 AGGGGTGGGCAGAGGGGCCAGGG - Intronic
900623366 1:3597278-3597300 CAGGGTGGGCAGGCGGATCCTGG - Intronic
900718540 1:4160404-4160426 CAGGGCTGGCACAGGGACCATGG + Intergenic
900910455 1:5593649-5593671 GAGAATGGGGAGAGGGACCTGGG + Intergenic
900950751 1:5857093-5857115 CAGGTTGGGCAGATCCACCTCGG - Intergenic
901024909 1:6274078-6274100 CACGGTGTGCAGAGGGGCCTGGG - Intronic
901040152 1:6358728-6358750 AAGGGTGGGTAGAGGGGACTCGG - Intronic
901183562 1:7357870-7357892 CCAGGTGGGGACAGGGACCTGGG - Intronic
901529108 1:9842661-9842683 CAGGGTGGCCAGAGGCCTCTGGG - Intergenic
901628061 1:10634807-10634829 CAGGGAGTGCCGTGGGACCTGGG + Intergenic
901672623 1:10865118-10865140 CAGGGAGGGGAGAAGGACCAGGG + Intergenic
902232389 1:15036279-15036301 CGGGCAGGGCAGAGGGAGCTGGG - Intronic
902232397 1:15036302-15036324 CAGGCTAGGCAGAGGGAGCTGGG - Intronic
902776895 1:18680597-18680619 CAGTGAGGTCAGACGGACCTGGG - Intronic
902786982 1:18739048-18739070 AAGGGAGGACAGATGGACCTGGG - Intronic
903138426 1:21324318-21324340 CTGGGTGGGCAGAGGAAGCAGGG + Intronic
903174178 1:21570769-21570791 CAGGATGGGCAGAGATAACTTGG - Intronic
903341229 1:22655774-22655796 CAGAGTGGCCACAGGGACCCAGG - Intronic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903690694 1:25171384-25171406 CAGAGTGAGCAAAGGGACCCTGG - Intergenic
903861636 1:26368055-26368077 CAGGGTGGTCAGAGGTACATGGG - Intronic
904276011 1:29384719-29384741 CAGGGCTGGCAGAGTGACCAAGG + Intergenic
904301497 1:29557452-29557474 CAGTGTGAGCAAAGGCACCTGGG + Intergenic
904386873 1:30148664-30148686 GAGGGTGGGCAGATGGAGCAGGG + Intergenic
904752041 1:32747027-32747049 CTGAGTGGCCAGAGGGAACTTGG - Intronic
905012031 1:34754400-34754422 GAAGGTGGGCAGGGGCACCTGGG - Intronic
905033396 1:34902408-34902430 CAGAGTGGACAGAGGGATCCTGG + Intronic
905442513 1:38004464-38004486 AAGTGGGGGCAGAGAGACCTAGG - Intronic
905457839 1:38100679-38100701 CAGTCTGGGAAGAGGGGCCTTGG + Intergenic
906150334 1:43583818-43583840 AAGCTTGGGCAGAGGGGCCTGGG - Intronic
907237524 1:53062327-53062349 CGGGGTGGGCCGAGGGGCCGGGG + Intronic
907279755 1:53339850-53339872 CAGAGTGGCCAGAAGGATCTGGG - Intergenic
907359950 1:53906319-53906341 CAGGGAGGGCAAAGGGGCCCAGG + Intronic
907452999 1:54559236-54559258 GAGGGTGGGCAGAGGAGGCTGGG - Intronic
910723617 1:90314665-90314687 CAGGCTGTGCAGAGGAACATGGG + Intergenic
911123591 1:94319801-94319823 AAGGGTGGGCAGAGTGACCCTGG - Intergenic
914883270 1:151564379-151564401 CAGGATGGAGGGAGGGACCTTGG - Intronic
914897306 1:151688202-151688224 CAGGGTGGTCAGAGAGACTCAGG + Intronic
915219878 1:154366239-154366261 CTGGGGCGGCAGAGGGACGTGGG - Intergenic
915265965 1:154718042-154718064 CCTGGTGGGCAGAGGCACCAGGG + Intronic
915286375 1:154855992-154856014 CAGGGCGGGGAGAGGGAGCATGG - Intronic
915364989 1:155309944-155309966 AAGCGTGGACAGAGGAACCTCGG + Exonic
915569870 1:156738651-156738673 ATGGGGGGGCAGAGTGACCTTGG + Exonic
915648000 1:157287639-157287661 AAGGCTGGACAGAGAGACCTGGG + Intergenic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
915917596 1:159950325-159950347 CAGGGTGGGTTGGGGGCCCTGGG - Intergenic
915955132 1:160214556-160214578 CAGGGTGGGGAGGGGCATCTTGG - Exonic
917514512 1:175696380-175696402 CAGGGTGGGCAGAGAGAAAATGG + Intronic
919923366 1:202179124-202179146 CAGGGTGGGCAGTGGGGCCGAGG - Intergenic
920088089 1:203432666-203432688 CAAGGTGGGGACAGAGACCTTGG + Intergenic
920216245 1:204363236-204363258 CAGGCTGGGCAGTGAGACCCCGG - Intronic
920854717 1:209653106-209653128 CAGGGTTGGCAGGGAGCCCTGGG + Intergenic
922798650 1:228353788-228353810 CAGGATGGGAAGAGGGTCATCGG + Intronic
924633439 1:245763373-245763395 CAGGGTGGGCAGAGAGCTGTAGG + Intronic
1065883658 10:30058974-30058996 CAGCGTGGGAACTGGGACCTCGG + Intronic
1067063954 10:43093303-43093325 CAGGGGTGGCAGAGGGGACTTGG + Intronic
1069591127 10:69642643-69642665 AATGGGGAGCAGAGGGACCTGGG - Intergenic
1069876605 10:71566966-71566988 CAGGGTGGGAAGAGGCAGCTGGG - Intronic
1069996174 10:72343456-72343478 GGGGGTGAGCAGAGGGGCCTCGG - Exonic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070662419 10:78316787-78316809 CAGGGCAGGCAGAGGGAACCAGG + Intergenic
1070676025 10:78411849-78411871 CAGAGTGGACTGAGGGGCCTGGG + Intergenic
1070793335 10:79202738-79202760 CAGCCTGGGCAGTGGGAGCTGGG - Intronic
1070976586 10:80610247-80610269 CAGGGTGAGCTGAGGGACACTGG - Intronic
1072740748 10:97907680-97907702 CAAGGTGGGGAGAGGCAGCTTGG + Intronic
1073895814 10:108156208-108156230 CAGGATGGGTAGAGCTACCTAGG - Intergenic
1074362252 10:112832889-112832911 CAGGGTAGGCAGTGGGGCTTTGG + Intergenic
1074757218 10:116632974-116632996 CAGTGTGGGCACAGGGAACGTGG + Intronic
1074971854 10:118545469-118545491 CAGTGTGGGGAGAGGGTGCTGGG - Intergenic
1075081048 10:119384151-119384173 CAGGGAGGCCTGAGGGAGCTAGG - Intronic
1075375596 10:121975490-121975512 CTGGGCAGGCAAAGGGACCTAGG - Intergenic
1075511249 10:123074448-123074470 CAGGGTGGACAGAGCTGCCTGGG - Intergenic
1076380808 10:130023533-130023555 CAGGGTGGGGAGGGAGGCCTGGG - Intergenic
1076470184 10:130713324-130713346 CAGTGGGGGCAGTGAGACCTGGG - Intergenic
1076624079 10:131810981-131811003 CAGGGTGGGAGGAAGGCCCTGGG - Intergenic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1076696177 10:132248471-132248493 CTAGGTGGACAGAGGGTCCTTGG - Intronic
1076884494 10:133255547-133255569 GAGGGTGGGCGGCGGGACCGCGG - Intergenic
1076904742 10:133356267-133356289 CAGGATGGGGCGAGAGACCTGGG + Intronic
1077169189 11:1158825-1158847 CAGGGCTGGGCGAGGGACCTGGG - Intronic
1077228798 11:1449629-1449651 CAGGGTGTGCAGCAGGACCCAGG + Intronic
1077476319 11:2792113-2792135 CAGGGGTGGCGGAGGGACCCGGG - Intronic
1077483929 11:2830313-2830335 AAGGGTTGACAGAGGGATCTGGG + Intronic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1078931143 11:15912875-15912897 AAGGGAGGGCAGTGGAACCTTGG - Intergenic
1079083670 11:17430655-17430677 CTGGTTGGTCAGAGGGACATTGG - Intronic
1079279372 11:19073656-19073678 CAGGGTGGCGACAGGGACCAGGG + Intergenic
1079396295 11:20066843-20066865 CAGGGAGGGAAGAGTGACTTGGG - Intronic
1080640541 11:34155892-34155914 TGGGGAGGGCAGAGGGACCTGGG - Intronic
1081038279 11:38177226-38177248 CAGGGTGGGCTGAGCGAACAGGG + Intergenic
1081682940 11:45021602-45021624 CTGGGAGGCCAGAGGCACCTGGG - Intergenic
1081964872 11:47163426-47163448 AAGGATGGGCAGAGGGAGCCAGG - Intronic
1083147959 11:60772822-60772844 CTGGGTGGGCTGAGAGGCCTAGG - Intronic
1083302480 11:61746175-61746197 CAGGGTGGGCAGGGGCTCCCAGG - Exonic
1083657678 11:64237522-64237544 CAGCGTGGGCAGAGGGGCCTGGG - Exonic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1083962107 11:66020386-66020408 CAGGCTGGGGAGAGGGACAGGGG + Exonic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1084114347 11:67033154-67033176 CAGAGTGGGCAGAGTGGCCGGGG - Intronic
1084476757 11:69393806-69393828 CAGGGTGGGCAGCTGGCCCCAGG + Intergenic
1084529164 11:69717023-69717045 GAGGGTGGCCAGAGGGAGCCAGG + Intergenic
1084608674 11:70187055-70187077 CAGGCTGGGAAGAGGGAGATGGG + Intronic
1084617719 11:70247504-70247526 CAGAGTGGGGAGAGGGCCCCTGG - Intergenic
1084792498 11:71483422-71483444 CAGGGTGTGCAGCAGGTCCTGGG + Intronic
1087829919 11:102808279-102808301 CAGCGTCGGCAGAGGGACAGGGG - Intergenic
1087855929 11:103091889-103091911 CAGGGTGGGCAGGGGAGCCGGGG + Exonic
1087951093 11:104220938-104220960 CAGTGTTGGAAGAGGGGCCTGGG - Intergenic
1088585385 11:111356336-111356358 CTGGGTAGGCAGGTGGACCTGGG + Intronic
1088844511 11:113653434-113653456 CAGAGTGTGCTGAGGGACTTGGG - Intergenic
1089201329 11:116726279-116726301 GAGGGTGGGCAGCGGGCTCTAGG - Intergenic
1089327805 11:117669288-117669310 CAGGGTGGGCAGATGGTCTGGGG + Intronic
1089452364 11:118607459-118607481 AAGGGTGGGTGGGGGGACCTTGG + Intronic
1090191891 11:124777068-124777090 CAAGGAGGGCAGAGGGCGCTGGG - Intronic
1090228265 11:125084471-125084493 GAGGGTCAGCAGAGGCACCTTGG + Intronic
1090271613 11:125389909-125389931 CAGAGTGGGCCCAGGGGCCTGGG - Intronic
1090378516 11:126308711-126308733 GAGGGTGGGTAGAGGGATTTCGG - Intronic
1090925676 11:131248474-131248496 GGGGCTGGGCAGAGGAACCTAGG + Intergenic
1091403382 12:194453-194475 CAGTGGAGTCAGAGGGACCTGGG + Intronic
1092237343 12:6818630-6818652 ACGAGTGGGCAGAGGGAGCTGGG - Intronic
1093641186 12:21528099-21528121 CAGGGTGTGCAGAGGTCCCCAGG + Intronic
1096242624 12:49967440-49967462 CAGGGTGGACAGTGGACCCTTGG + Intronic
1096434415 12:51576605-51576627 CAGGGTGCGCAGTAGGCCCTAGG + Intergenic
1096537481 12:52284597-52284619 CAGGGGTGGCTGAGAGACCTTGG + Intronic
1096618539 12:52848222-52848244 CAGGTTGGGCAGGGGGACAGGGG - Intronic
1096800127 12:54105055-54105077 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1096871317 12:54594127-54594149 CAGGCTTGGCAGAGGGTACTGGG + Intergenic
1097055664 12:56247757-56247779 CAGTGTGGCCAGAGGCAGCTAGG + Exonic
1098285474 12:68902919-68902941 TAGAGTGGGGAGAGGGACATGGG - Intronic
1098466172 12:70788779-70788801 CATGATAGGCAGAGGGTCCTCGG - Intronic
1101946726 12:109143000-109143022 CAGGAGGGACAGAGGGATCTTGG + Intronic
1102008055 12:109601331-109601353 TATGGTGGGGAGAGGGAGCTCGG - Intergenic
1102171604 12:110846873-110846895 CTGGGAGGGCACAGGGCCCTCGG - Intronic
1102173751 12:110861187-110861209 CAGTGTTGGAGGAGGGACCTGGG - Intronic
1102256649 12:111418984-111419006 CAGAGTGTCCAGAGGGAACTAGG + Intronic
1102289439 12:111686775-111686797 CAGGGTGGGGAGGAGGACCCCGG - Intronic
1102513242 12:113429480-113429502 CAGGGTGGGCAGAGGAAAGTTGG - Intronic
1102534534 12:113570653-113570675 CAGGGTGGGCAGGGGGGCGGGGG + Intergenic
1102576904 12:113861357-113861379 CAGTGTGGGCAGAAGGAACTGGG - Intronic
1102902528 12:116649342-116649364 CAATGTTGGAAGAGGGACCTGGG + Intergenic
1103779758 12:123390314-123390336 CAGGGAGGTCAAAAGGACCTGGG - Intronic
1104940543 12:132392543-132392565 CAGGGTGGCCGGAGGGTCCGGGG - Intergenic
1105632041 13:22179144-22179166 CGGGGTGGGCAGAGTGAAATGGG - Intergenic
1106410198 13:29506118-29506140 AGGGGTGGGCGCAGGGACCTGGG - Intergenic
1108316326 13:49241117-49241139 GGGGGTGGGCAGAGGGGCCTGGG - Intergenic
1110223518 13:73096530-73096552 CAGGGTCGGCAAAGGGACAAGGG + Intergenic
1111749165 13:92305896-92305918 TAGGGTGGCCAGAGGTAACTAGG + Intronic
1112175430 13:97018771-97018793 CAGGGTGAGCACAGGGCCCAGGG - Intergenic
1112765058 13:102732923-102732945 CAGGGAGGGAATAGGGACTTCGG + Exonic
1113415172 13:110123424-110123446 CAGGGAGGACCCAGGGACCTCGG + Intergenic
1113693615 13:112329179-112329201 CAGGGTGGACAGAAGGACCCAGG - Intergenic
1113842098 13:113366090-113366112 CAGGGTGGGCAGCCAGACCGAGG + Intergenic
1117557139 14:56897096-56897118 AAGGGAGGGCGGAGGGGCCTGGG + Intergenic
1117656395 14:57960831-57960853 CAGGAGCTGCAGAGGGACCTGGG - Intronic
1118758184 14:68860727-68860749 CAGGGTTGTCAGAGGGTCCCAGG - Intergenic
1119191300 14:72683919-72683941 CAGTGTGGTCAGAAGCACCTGGG - Intronic
1119601187 14:75978443-75978465 GAGGCTGAGCAGACGGACCTGGG - Intronic
1119968494 14:78943382-78943404 CTTGGAGGGCAGAGGAACCTGGG + Intronic
1119968915 14:78947724-78947746 CAGGGCAGGCTGAGGGACCATGG - Intronic
1120645468 14:87069244-87069266 CTGGGTGGTCAGAGGGCCCCGGG - Intergenic
1121585745 14:95061831-95061853 CAGGGTGCTAGGAGGGACCTTGG - Intergenic
1121998957 14:98630237-98630259 CAGGGTGGGGAGAGGGCTCTTGG + Intergenic
1122094744 14:99362738-99362760 CAGGGTGCGCAGGGGGCCCTGGG + Intergenic
1122123396 14:99566546-99566568 CTGGGGGAGCCGAGGGACCTTGG - Intronic
1122886919 14:104714323-104714345 CAGGGTGGGCTGAGGGCCGGGGG - Exonic
1123033786 14:105463599-105463621 GAGGGTGGGCACAGGGTGCTGGG + Intronic
1123059053 14:105586193-105586215 CAGGGAAGCCAGAGGGGCCTGGG + Intergenic
1123083381 14:105706424-105706446 CAGGGAAGCCAGAGGGGCCTAGG + Intergenic
1123439021 15:20276656-20276678 CAGGGTATGAAGAGGTACCTGGG - Intergenic
1124170272 15:27366821-27366843 CAAGGTGGGCAGGGGGACACGGG - Intronic
1124801230 15:32834818-32834840 CAAGGTGATCAGAGGGAACTAGG - Intronic
1125181197 15:36882459-36882481 CAGGGAGGGGACAGGGACCCCGG - Intergenic
1125859656 15:42986910-42986932 CAGGGTGGGCTCAGGGGCCGAGG - Intronic
1129177856 15:73852912-73852934 CAGAGTGGGGTGAGGGAGCTGGG - Intergenic
1129607236 15:77030908-77030930 AAGGGTAGTGAGAGGGACCTCGG - Intronic
1129695364 15:77737921-77737943 GAGGCTGGTGAGAGGGACCTGGG - Intronic
1130657104 15:85799323-85799345 CAGGGTGGTCAGGAGGGCCTAGG - Intergenic
1131257633 15:90872261-90872283 CAGCGGGGGCACAGGGGCCTCGG - Intronic
1131890863 15:96970236-96970258 CAGTGTGCTCAGAGGGGCCTTGG - Intergenic
1132022750 15:98377195-98377217 CAGGATGGGTAGAGGAATCTGGG - Intergenic
1132028973 15:98425292-98425314 GAGGGAAGGCAGAGGGCCCTAGG + Intergenic
1132143432 15:99412908-99412930 CAGGGAGGGGAGAGGGGCATAGG - Intergenic
1132156134 15:99496368-99496390 CAGGGAGGGCAGAAGGACAGAGG + Intergenic
1132321118 15:100926379-100926401 GAGGGTGGGGACAGGGACCTTGG + Intronic
1132409034 15:101562746-101562768 CAGGGTGGCGAGGAGGACCTGGG - Intergenic
1132590111 16:722903-722925 GCAGGTGGGCAGAGGGAGCTGGG - Exonic
1132675278 16:1118813-1118835 CAGGCTGGGCAGAGGGGCCTGGG - Intergenic
1132690712 16:1180717-1180739 CAGGGTGTGCAGCGGGGGCTGGG + Intronic
1132695177 16:1198857-1198879 CACGGTGGGCAGAGCCACGTGGG - Intronic
1133001037 16:2851922-2851944 CAGGCTGGGATGAGGGCCCTGGG + Intergenic
1133873825 16:9714272-9714294 CAGAGTGGGGAGAGGGAGATTGG - Intergenic
1134044857 16:11093643-11093665 GAGGGTGGGCAGATGCACCCTGG + Intronic
1134203151 16:12215529-12215551 CTGGGTAGGCACAGGAACCTGGG + Intronic
1134567791 16:15266144-15266166 CAGGGTGGGCTGGGGGATATGGG - Intergenic
1134734644 16:16490209-16490231 CAGGGTGGGCTGGGGGATATGGG + Intergenic
1134932828 16:18221697-18221719 CAGGGTGGGCTGGGGGATATGGG - Intergenic
1135060905 16:19270664-19270686 CAGGGTAGGCAGCTGGGCCTGGG - Intergenic
1135161672 16:20102059-20102081 CTGGGTGTGCAGAGGCACTTAGG + Intergenic
1135321580 16:21501578-21501600 CAGGGAGGGGAGAGGCACTTAGG + Intergenic
1135437370 16:22437641-22437663 CAGGGAGGGGAGAGGCACTTAGG - Intergenic
1135643776 16:24143527-24143549 CAGGGATGGGAGAGGGAGCTAGG + Intronic
1135938896 16:26803909-26803931 GAGGTTGGGCAGAAGGCCCTTGG - Intergenic
1135990827 16:27217788-27217810 CAGGGTTGCCAGAGGGACACAGG - Intronic
1136011635 16:27367297-27367319 CAGAGTGGGCTGAGTGGCCTGGG + Intergenic
1136333058 16:29594688-29594710 CAGGGAGGGGAGAGGCACTTAGG + Intergenic
1136447754 16:30334776-30334798 CAGGGAGGGGAGAGGCACTTAGG + Intergenic
1136846148 16:33577688-33577710 CAGGGTATGAAGAGGTACCTGGG + Intergenic
1137009959 16:35311946-35311968 CAGGATGGCCAGAAGTACCTGGG - Intergenic
1138294825 16:55877133-55877155 GTGGGAGGGCAGAGGGAGCTTGG - Intronic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1139374358 16:66487544-66487566 CTGGCTGGGCAGAGGGTCCCAGG - Intronic
1139560043 16:67736101-67736123 AAGGGTGGACTGAGGGCCCTGGG - Intronic
1140231243 16:73119009-73119031 CAGGGTGGGCACTGTGTCCTGGG + Intergenic
1140515095 16:75535678-75535700 GGGGGTGGGGAGAGGGAGCTGGG - Intronic
1141566581 16:84906504-84906526 CTGGGTGGGCAGGGAGACCTGGG - Intronic
1141675540 16:85515480-85515502 GCGGGTGGGCGGAGGGACGTGGG + Intergenic
1142263147 16:89051787-89051809 CAGGCTGGGCAGAAAGAGCTGGG - Intergenic
1142264302 16:89056750-89056772 CAGGGTGGGCCATGGGACCCTGG - Intergenic
1142283617 16:89161764-89161786 CAGGGTGGGCACAGGACCCCAGG + Intergenic
1142362936 16:89635855-89635877 CAGGGCGGCCACTGGGACCTGGG - Intronic
1203107856 16_KI270728v1_random:1426342-1426364 CAGGGTATGAAGAGGTACCTGGG + Intergenic
1142718656 17:1762284-1762306 GAGAGAGGGCAGAGGGAGCTGGG + Intronic
1143482873 17:7237757-7237779 CTGGCCTGGCAGAGGGACCTGGG - Intronic
1143877145 17:10000512-10000534 CAGGTTGGTCAGAGAGATCTAGG + Intronic
1143941919 17:10551346-10551368 CTGGATGGGGAGGGGGACCTTGG - Intergenic
1144839329 17:18175936-18175958 CAGTGAGGGCAGAGGGCCCAGGG - Intronic
1144997327 17:19279216-19279238 CTGGGAGGGCAGCGGCACCTTGG + Intronic
1145995149 17:29100651-29100673 GAGAGTGGGCAGAGACACCTAGG + Intronic
1146163834 17:30573412-30573434 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1146458886 17:33028206-33028228 CAGGGTGGCCACAGGGCCCTGGG - Intronic
1146610746 17:34302943-34302965 CAGAGTGGGCATTGGGTCCTGGG - Intergenic
1146909841 17:36641616-36641638 CAGTGGGGGCAGACGGGCCTGGG - Intergenic
1147580844 17:41626266-41626288 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1147667392 17:42157197-42157219 CCTGTTGGGCACAGGGACCTGGG + Intronic
1147965720 17:44193343-44193365 CAGGGTGGGCAGGAGGAACACGG + Exonic
1148129574 17:45254863-45254885 GAGGGTGGGCACAGGGGCCTGGG - Intronic
1148578729 17:48728644-48728666 CTGGGTGGGGAGAGCGAGCTGGG - Exonic
1148872207 17:50665155-50665177 CAGCCAGGACAGAGGGACCTAGG - Exonic
1148887872 17:50786677-50786699 CAGCGGGAGCAGAGGGAGCTGGG + Intergenic
1149500814 17:57150951-57150973 CAGGCTGGGCAGTGGGAGTTGGG - Intergenic
1151328776 17:73394607-73394629 GAGGGCTGGCAGAGGGACCAGGG + Intronic
1151671029 17:75571796-75571818 CAGGGAGAGCAGAGGGTGCTCGG + Intronic
1151696728 17:75721709-75721731 CAGCGTGGACAGAGGGACCGGGG - Intronic
1152190287 17:78883871-78883893 AAGGGAGGGCAGCGGGACGTGGG - Intronic
1152638495 17:81439862-81439884 GAGGGTGGGCAGACTGGCCTCGG - Intronic
1152776727 17:82206522-82206544 CAGGGTGTGGAGAGGTTCCTGGG + Intronic
1152811644 17:82385435-82385457 CGGGGAGGGCAGAGGGGGCTGGG - Intergenic
1152941379 17:83174468-83174490 CAGTGGGGGCAGACAGACCTGGG - Intergenic
1153230038 18:2926434-2926456 CAGGGGGAGCAGAGGCACCTGGG + Intronic
1154200120 18:12293884-12293906 CAGGATGGGCAGGGGGAGCCAGG - Intergenic
1154322607 18:13367322-13367344 CAGGTGGGGCAGAGGGGCCTGGG + Intronic
1155390683 18:25333382-25333404 GAGGGTGGGCAGAAGGGCCAGGG + Intronic
1155823580 18:30409363-30409385 CAGGAGGGCCAGAGAGACCTTGG - Intergenic
1156411243 18:36829497-36829519 CAGGGTGGGCAGAGGGACCTCGG - Intronic
1157584851 18:48794450-48794472 CAGGGTGGGCGAAGGGTCTTGGG + Intronic
1158615590 18:58983614-58983636 CAGGGTGGGATGAGGGCCATGGG - Intronic
1159893909 18:73978855-73978877 CAGGGTGAGCACAGAGAGCTAGG + Intergenic
1160435117 18:78845670-78845692 CCAGGTGGGCAAAGGGACCCTGG - Intergenic
1160736860 19:666965-666987 CAGGGTGGCCGGTGGGGCCTGGG - Intergenic
1161013864 19:1973565-1973587 CAGCCAGGGCTGAGGGACCTGGG - Intronic
1161094420 19:2381313-2381335 CAGGGTCAGCAGAGGCAGCTGGG + Intergenic
1161976020 19:7608043-7608065 CAGGCTGGGCAGGGAGGCCTGGG - Intronic
1162327107 19:10005986-10006008 CTGGGTGGGCAGAGGGAACAAGG + Intronic
1162376523 19:10308533-10308555 CATGCAGGCCAGAGGGACCTGGG + Exonic
1162750486 19:12826336-12826358 AAGGGTGGGAGCAGGGACCTGGG + Intronic
1162782807 19:13015400-13015422 CAGGCTGGGCCTAGGGTCCTGGG - Intronic
1163603854 19:18263830-18263852 CAGGGAGGGCAGGGTGGCCTCGG - Intronic
1163633282 19:18427618-18427640 CAGGGTGGGCAGAGGGCCCCAGG - Intronic
1164089892 19:21940640-21940662 CGGGGAGGACAGAGGGACCCAGG - Intronic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1164698208 19:30262659-30262681 CCAGGTGGTCAGAGGGACCTGGG + Intronic
1164760170 19:30722690-30722712 ATGGGTTGGGAGAGGGACCTGGG - Intergenic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165825875 19:38705478-38705500 CAGGATGGGCAGAGCCACCTGGG + Intronic
1166048999 19:40246993-40247015 TAGGGTGGGCAGTGGGAGCCAGG - Intronic
1166270204 19:41708818-41708840 GAGGGTGGGAGGAGGGAGCTGGG + Intronic
1166326519 19:42054225-42054247 CAGGGAGGGCAGAGGGCCACAGG + Intronic
1167153415 19:47723131-47723153 CAGGGTGGGCAGGGGGATCCAGG - Intronic
1167502955 19:49857656-49857678 CGGGGTGGGAAGAGGGGCCCAGG - Intronic
1167596368 19:50430352-50430374 CTGGGTGGGCAGGTGGATCTAGG + Exonic
1167738850 19:51312085-51312107 CTGGCTGGGCAGGGGGACCTCGG + Intronic
1167955214 19:53058532-53058554 CGGGGTCTGCAGAGGGACCGCGG + Intergenic
1168307357 19:55442756-55442778 CAGGGCGGGCAGCGGGCCCGCGG + Exonic
1168310278 19:55456492-55456514 GGGGGTGGGCAGAGGGACGGTGG + Intronic
1168483039 19:56737357-56737379 CAGGGTGGGCTGTGGGAAGTGGG - Intergenic
924974798 2:162725-162747 CAGAGTGGCCAGAGTGACATAGG - Intergenic
925327408 2:3034491-3034513 CAGGCGGGGCACAGAGACCTGGG - Intergenic
926139599 2:10360265-10360287 CAGGGTGAGCCGAAGGGCCTTGG + Intronic
926736628 2:16078428-16078450 CCAGGTGGGCACAGGGACCGAGG + Intergenic
927062955 2:19441379-19441401 CAGTGTTGGAAGAGGGGCCTGGG - Intergenic
927463790 2:23322021-23322043 CAGAGTGTGCAGAGGGAGATGGG + Intergenic
927915639 2:26934366-26934388 CAAGGAGGACAGAGGGACATGGG - Intronic
929583798 2:43101198-43101220 CGGGGTGGGCAGGGGGCCCAGGG + Intergenic
931691490 2:64838078-64838100 CAAGCTGGGCAGAGTGCCCTGGG + Intergenic
932002522 2:67897775-67897797 TGGGGTGGGGAGAGGGCCCTGGG - Intergenic
932002532 2:67897794-67897816 CAGGTTGGGGAGAGGGCCCTGGG - Intergenic
932992957 2:76811067-76811089 CAGGGTGGGGTGAGGGGACTTGG - Intronic
934753484 2:96809526-96809548 CAGGGTGGGCAGGGGGCCCCGGG - Exonic
934991217 2:98922768-98922790 CAGGGAGGATAGAGGGGCCTGGG + Intronic
935396338 2:102613422-102613444 CAGGAAGGCCAGAGAGACCTTGG - Intergenic
935756072 2:106276930-106276952 CAGGTTGGGAAGAGGGTCTTAGG - Intergenic
936173489 2:110197492-110197514 CAGGGTGAGCAGGGGGCCCACGG + Intronic
936174207 2:110204870-110204892 CAGGCTGTGCAGAGGGCCCTGGG - Intronic
937043958 2:118841372-118841394 CAGGGTGTCCTGAGGGCCCTGGG + Intergenic
937254804 2:120547649-120547671 CAGGATGGGCCATGGGACCTGGG + Intergenic
937612209 2:123875759-123875781 TAGAGTGAGCAGAGGGATCTGGG + Intergenic
938201152 2:129374130-129374152 CAGGGTGGGCAGCAGGTGCTGGG + Intergenic
941917334 2:170821434-170821456 CAGGTTGGGAAGAGGGGCCAGGG + Intronic
944605912 2:201351252-201351274 TGGGGTAGGCACAGGGACCTTGG - Intronic
944606462 2:201355973-201355995 CAGGGTTGGAACAGGGTCCTGGG + Intronic
946037348 2:216754707-216754729 GTGGGTGGGCAGAGGGATGTAGG + Intergenic
946153629 2:217792743-217792765 CAGTGTGGGCAAAGGGAGCCAGG - Intergenic
946185017 2:217975876-217975898 CAGGGTGGGAGTAGGGACATGGG - Intronic
947602889 2:231465200-231465222 CAGGGCAGGGAGAGGGGCCTGGG + Intronic
947641449 2:231709720-231709742 CAGGGCGGGCAGTGGGACCGAGG - Intronic
947793123 2:232878953-232878975 AAGGGTGGGCAGAGGCAGCTGGG + Exonic
947851928 2:233295181-233295203 CAGGCTTGGCAGAGGGGCCATGG - Exonic
948271454 2:236676951-236676973 CAGGCAGGGCAGGGGGAGCTGGG + Intergenic
948567210 2:238894672-238894694 GAAGGTGGGGAGAGGGATCTGGG - Intronic
948592808 2:239062252-239062274 CAGGAAGCGCAGAGGGGCCTTGG - Intronic
948775269 2:240284720-240284742 CTGTGTGGGCAGTGGGACCCGGG + Intergenic
948786170 2:240354104-240354126 CAGGGTGTGCAGTGGGGCCAGGG - Intergenic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
1168752037 20:289540-289562 CCAGGTGGGCGGAGGCACCTGGG - Exonic
1169214112 20:3783951-3783973 CATCCTGGGCAGAGGGGCCTGGG - Exonic
1169422643 20:5472182-5472204 CAGGGTGGGCACAGTGACCAGGG + Intergenic
1169426827 20:5503600-5503622 CAGGGTGGGCACAGTGACCAGGG - Intergenic
1169800293 20:9506906-9506928 GAGGGTGGGCTCAGGGACCGAGG - Intergenic
1169911558 20:10651505-10651527 CACGCTGGGGAGAGGTACCTAGG - Intronic
1171134776 20:22686421-22686443 CTGGGAGGGCACAGAGACCTTGG + Intergenic
1171265841 20:23771845-23771867 CAGGGTGGGCTGTGTGACTTAGG + Intergenic
1171851916 20:30314881-30314903 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1172107436 20:32525060-32525082 CAGGCTGGGCAGCGGGAAGTGGG + Intronic
1172344061 20:34183054-34183076 CATGTTGGGCATAGGGACTTTGG - Intergenic
1172499924 20:35418459-35418481 AAAGATGGGCAGAGGGAGCTTGG - Intergenic
1172520142 20:35560796-35560818 CAGGGTGGTCAGTGACACCTGGG - Intergenic
1172765111 20:37346688-37346710 CAGGGCGGGCTGAGGGGCCCCGG + Intronic
1173074869 20:39808076-39808098 CAAGGGGGGCAGAAGGCCCTAGG + Intergenic
1173338085 20:42129595-42129617 CTGGTTGGGAGGAGGGACCTTGG + Intronic
1173930589 20:46814726-46814748 CAGGCTTGGCAGAGGCATCTGGG - Intergenic
1173973187 20:47168119-47168141 CACTGTGGCCAGGGGGACCTTGG + Intronic
1174311472 20:49658727-49658749 CAGTCTGGGTAGTGGGACCTAGG - Intronic
1174401420 20:50278012-50278034 GAGGGTGGGGAGAGGGTCGTGGG + Intergenic
1174457905 20:50662575-50662597 CTGGGTGGGCAGAGGCATCCAGG - Intronic
1174837549 20:53872492-53872514 CAAAGTGGGGAGAGGGGCCTTGG + Intergenic
1174885098 20:54325140-54325162 GAGAGTGGGCAGAGGGAGGTAGG + Intergenic
1175125838 20:56750848-56750870 CGGGGTGAGCAGAGGGACACAGG - Intergenic
1175215076 20:57388037-57388059 CAGGCTGGGCAGAGGTGACTTGG - Intergenic
1175247708 20:57591647-57591669 CAGAGGGGCCAGAGGGACATGGG + Intergenic
1175541381 20:59750252-59750274 AAAGGTGGGCAGGAGGACCTAGG + Intronic
1175547180 20:59785925-59785947 CAGGGGAGGCAGAGGGCCGTTGG - Intronic
1175624793 20:60481379-60481401 CAGGGAATGCAGAGGGACCCTGG - Intergenic
1175705095 20:61170952-61170974 CTGGATGGGCAGAGGCAGCTGGG - Intergenic
1175804674 20:61820861-61820883 CCAGGTGGACAGAGGGTCCTGGG - Intronic
1175828822 20:61951097-61951119 GAGGGTGGGAAGAGGGGCCCAGG - Intergenic
1175914816 20:62420903-62420925 CAGGCTGGGCCTGGGGACCTGGG + Intronic
1175933394 20:62503891-62503913 CAAGGTGGGCACAGGCACCAGGG + Intergenic
1175944824 20:62553796-62553818 CTGGGTGGAGAGAGGAACCTTGG - Intronic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176022136 20:62967272-62967294 CAGGGTGGGGTGTGGGGCCTGGG + Intronic
1176023609 20:62974867-62974889 AAGGGGGGTCACAGGGACCTCGG - Intergenic
1176110910 20:63410324-63410346 CAGGAGGGGCACAGGGTCCTTGG - Intronic
1176138918 20:63536762-63536784 CAGGGAGGACAGAGGGTCCAGGG - Intronic
1176266927 20:64214522-64214544 CAGGATGGGCAGGGTGGCCTTGG - Intronic
1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG + Intergenic
1178252808 21:31020742-31020764 CAGGCTGGGTAGAGGGACAACGG + Intergenic
1178351537 21:31875175-31875197 CAGGCTGGGCAGAGGCCCCCAGG - Intronic
1178407313 21:32335263-32335285 TGAGGTGGGCAGAGGGGCCTGGG - Intronic
1179739695 21:43411202-43411224 CAGGGTGCACAGTGGGCCCTGGG - Intergenic
1179887073 21:44318767-44318789 CTGGGTGGGACGTGGGACCTGGG + Intronic
1179905048 21:44418396-44418418 CAGGGTGGGCGGACAGACCAGGG - Intronic
1180168118 21:46040516-46040538 CAGGCTGGGCGCAGGGACCAGGG + Intergenic
1180744609 22:18078920-18078942 CGGGGAGGGCGGAGGTACCTGGG - Intronic
1180833097 22:18915978-18916000 CTGGGAGGGGAGGGGGACCTAGG + Intronic
1181022979 22:20113179-20113201 CAGGGTGGGCACCAGGTCCTCGG + Exonic
1181030051 22:20145313-20145335 TAGGGCTGGCAGAGGGCCCTGGG - Intronic
1181066728 22:20310276-20310298 CTGGGAGGGGAGGGGGACCTAGG - Intergenic
1181527871 22:23500465-23500487 CTGGGTGGGGAGAGGGAAGTGGG + Intergenic
1181549335 22:23628011-23628033 CAGGGTGGGTAGAGGGGCCCTGG - Intronic
1181799279 22:25333869-25333891 CAGGGTGGATAGAGGAACCCTGG + Intergenic
1182129620 22:27841330-27841352 CAGGCTGGGCAGTGGGAACTGGG - Intergenic
1182358940 22:29735384-29735406 CTGGGTGGCCAGAGGGACAATGG + Intronic
1182394921 22:30028309-30028331 ATGGGTGGGCAGAGAGAACTGGG + Intronic
1182428547 22:30287321-30287343 CAGGGTGGATATAGGTACCTGGG - Intronic
1182784590 22:32896952-32896974 CAGGGTGGGGACAGGGGCATAGG - Intronic
1182831023 22:33304522-33304544 GAGGGTGAGCCGCGGGACCTGGG + Intronic
1183431413 22:37768188-37768210 CAGGGTGGGCAGTTGGGCCCCGG - Intronic
1183640352 22:39088939-39088961 AAGGCAGGGCAGAGGGACCCTGG - Intergenic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184290994 22:43498168-43498190 CAGGGTGGTCAGAGGGAATGCGG - Intronic
1184409061 22:44316189-44316211 CACCCTGGGGAGAGGGACCTGGG + Intergenic
1184723668 22:46330566-46330588 GAGGGTGGGCTGAGGGACTGGGG + Exonic
1184795782 22:46731646-46731668 CAGGGAGGGCAGAGGGCACCTGG + Intronic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185014605 22:48335628-48335650 CAGTGGGGACACAGGGACCTTGG - Intergenic
1185018240 22:48358164-48358186 CGGAGTGGGCAGGGGGCCCTCGG + Intergenic
1185088447 22:48753114-48753136 CATGGGGAGCAGAGGGAGCTTGG - Intronic
1185380485 22:50505509-50505531 CAGGGTGGCCAGCAGGGCCTTGG + Exonic
1203283181 22_KI270734v1_random:141282-141304 CTGGGAGGGGAGGGGGACCTAGG + Intergenic
949605831 3:5652493-5652515 CAGGGATGGCAAAGGGACCCTGG + Intergenic
949660602 3:6274209-6274231 AAGGGTGGGGAGAGCAACCTAGG - Intergenic
949693884 3:6671296-6671318 CAGGTTGGGCTGTGGGAACTAGG + Intergenic
950263081 3:11555768-11555790 CAGGGTGGTCACAGGTACCTAGG - Exonic
951016905 3:17742157-17742179 CAGGGCGGGCAGGGCGAGCTGGG - Intronic
951264901 3:20553199-20553221 CAGGGAGGGCAGAGGGGCGTGGG + Intergenic
952956775 3:38562520-38562542 CAGGCTGACCAGAGAGACCTGGG + Exonic
953547637 3:43875386-43875408 TAGGGTGGGCTGAGGGGCCCTGG - Intergenic
953629105 3:44597196-44597218 CATGGTGGGCAGAGGCACTTTGG - Exonic
953851231 3:46466917-46466939 CTGGGAGGTCAGAGGGCCCTGGG + Intronic
953868978 3:46609755-46609777 CGGGGTGGGCAGAGGGAGCAGGG + Intronic
954443421 3:50534096-50534118 CAGGCTGGGGAGAGAGACCGGGG - Intergenic
954590463 3:51777925-51777947 CAGGGAGGGGAGAGAGACTTGGG - Intergenic
954610614 3:51942899-51942921 GAGGGTGGGCAGAGGATCCTGGG - Intronic
954618509 3:51982942-51982964 CAGTGTGGGCAGACAGACATTGG + Intronic
954681253 3:52347250-52347272 CAGCATGGGCAGAGGCACCGAGG + Intronic
954798428 3:53173267-53173289 CAAGGTGATCAGAGCGACCTTGG - Intronic
955029654 3:55203997-55204019 CAGGCTGGGGAGAGGAAGCTGGG - Intergenic
955996611 3:64685960-64685982 AAGGGTGGGCCGAGGGCTCTGGG - Intronic
959580340 3:107976866-107976888 CAGTTTGAGCAGAGGGCCCTTGG - Intergenic
960234951 3:115271404-115271426 CAGGGGGTGCAGAGGTGCCTTGG + Intergenic
960474797 3:118110631-118110653 GAGGGTCTGCAGAGGGACCCTGG + Intergenic
960818419 3:121699108-121699130 CAGGATTGGCAGAGTGCCCTTGG - Intronic
961370148 3:126423846-126423868 CAGGGTGGGCACGGGTGCCTGGG - Intronic
961632673 3:128312721-128312743 CTGGATTGGCAAAGGGACCTGGG + Intronic
961664255 3:128486392-128486414 CAGGGTGGGCAGAAAGATCAGGG + Intronic
962350820 3:134654526-134654548 CAGGGTAGGCTGAGGGAGTTAGG - Intronic
962384487 3:134921885-134921907 GAGGGAGGGCAGAGGGACGGGGG + Intronic
965544358 3:169900134-169900156 AAGGGTGGGGAGAGGATCCTAGG + Intergenic
965602190 3:170466610-170466632 CAGGGTGGGTAGATGGGCATTGG - Exonic
966336579 3:178874502-178874524 CAGAGTGGGAAGAGAGAGCTAGG - Intergenic
967833675 3:193943246-193943268 CAGGGTAGGAGGAGGGACCAAGG - Intergenic
968052034 3:195661535-195661557 CAGGGTGGAAAGGAGGACCTGGG + Intergenic
968103778 3:195986803-195986825 CAGGGTGGAAAGGAGGACCTGGG - Intergenic
968302080 3:197624396-197624418 CAGGGTGGAAAGGAGGACCTGGG - Intergenic
968504073 4:963969-963991 CAGGGTGGGCAGCGGCACAGGGG + Intronic
968517634 4:1021509-1021531 GGGGGTGGGCAGACAGACCTGGG + Intronic
968579122 4:1381552-1381574 CAGGGCGGGCAGATGGGCCTGGG - Intronic
968588805 4:1447418-1447440 CAGGAGGGGCACAGGGTCCTTGG + Intergenic
968621580 4:1605656-1605678 CAGGGTCGGCAGGGAGCCCTGGG - Intergenic
968729909 4:2264767-2264789 CAAGATGGGCAGAGGCATCTTGG + Intergenic
968801078 4:2743606-2743628 CAGGGTGTGAACAGGGACCCTGG - Intronic
968816793 4:2825776-2825798 CAGGGTGGGCGTAGGGGGCTGGG - Intronic
968831413 4:2934483-2934505 CAGGGTGGGGGGCGGGACCGGGG - Intronic
969123167 4:4924465-4924487 TAGGGTAGGCAGAGGGGCATGGG + Intergenic
969355048 4:6620330-6620352 CAAGGTGGGCAGAAGCCCCTGGG - Intronic
969497068 4:7532223-7532245 CAAGGTCGGCAGAGGCACCAGGG + Intronic
969636154 4:8370484-8370506 CAGAGGGGACAGAGGGGCCTGGG + Intronic
969689781 4:8698131-8698153 CAGTGTGGACAGATGGACCCGGG - Intergenic
970546796 4:17137938-17137960 GAGGGTGGGCATAGAGCCCTGGG - Intergenic
970712594 4:18880834-18880856 ATAAGTGGGCAGAGGGACCTGGG - Intergenic
971348873 4:25838641-25838663 CAGGGTGGGTGGCGGGGCCTTGG - Intronic
971388394 4:26162224-26162246 CAGGGTGGTCACAGAGGCCTAGG + Intergenic
975984363 4:80189141-80189163 GGGGGTGGGCAGAGAAACCTGGG - Intronic
976828320 4:89284654-89284676 CAGGGTGAGAAAAGGGAGCTAGG - Intronic
978138569 4:105292318-105292340 CATGGTTGACTGAGGGACCTGGG + Intergenic
978189475 4:105895633-105895655 CATGTTGGGCAGCGGGTCCTGGG - Exonic
979505155 4:121486477-121486499 CAGGGAGAGCTGAGTGACCTAGG - Intergenic
981588123 4:146326568-146326590 TAGGGGAGGCAGAGGGACCGAGG - Intronic
984818500 4:183859473-183859495 CAGGGGTGGCAGAGGGGACTGGG + Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985520943 5:373700-373722 CAGGGAGGGCGGGGGGACCTGGG + Intronic
985540593 5:485730-485752 CTGGGTGGGCCGAGGCCCCTGGG + Intronic
985619764 5:948050-948072 CGGGGCGGGGAGGGGGACCTGGG + Intergenic
985631662 5:1017251-1017273 GATGGTGGGCAGAGGGACATGGG - Intronic
985662670 5:1165103-1165125 CAGGGAGGGCACAGGGCTCTCGG + Intergenic
985912140 5:2892839-2892861 CAGTGGGGGCAGGGTGACCTGGG + Intergenic
985937000 5:3105047-3105069 CAGGATGGTCAGAGGGCACTGGG - Intergenic
986004202 5:3654410-3654432 CAGAGTGGGGAGAGGGACTTTGG + Intergenic
986107259 5:4671603-4671625 CATGGAGGGCAAAGGAACCTGGG - Intergenic
986732995 5:10649112-10649134 CAGGGTTCGCAGAGTGAACTAGG + Intronic
987394929 5:17413882-17413904 GAGGTGGGGCAGAGGGACCATGG + Intergenic
988555013 5:32229049-32229071 CAGGGAGTGCAGAGGGACAGCGG + Exonic
991444125 5:66681526-66681548 CAGTGTGGTGACAGGGACCTGGG - Intronic
992048844 5:72925549-72925571 CTGGGTGGGCACAGGGTCCACGG + Intergenic
992162575 5:74017157-74017179 CAGGAAGGGCTGAGGTACCTGGG + Intergenic
997206720 5:132054513-132054535 TAGGGAGGGCAGTGGGACTTCGG + Intergenic
997237059 5:132278779-132278801 CAGGTGGGGCAGAGGGACTCAGG - Intronic
997368033 5:133338356-133338378 CAGGGTGGGAAGATGGAGCATGG - Intronic
998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG + Intronic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
998967894 5:147560488-147560510 TAGGGTGGGCAGAGACAGCTAGG - Intergenic
999148617 5:149412259-149412281 TAGGGTGGGCTGAGTAACCTTGG + Intergenic
999274635 5:150321290-150321312 CAGGGTAGGGAGAGCTACCTTGG + Intronic
1000122673 5:158212196-158212218 CATGGTGGGCAGAGAGAGATGGG + Intergenic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1000447988 5:161348004-161348026 CAGGGCGGGGACAGGAACCTAGG - Intronic
1001333171 5:170776639-170776661 CAGGGTGGGCAGGGTCAACTTGG + Intronic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001596548 5:172902375-172902397 CAGGCTGGGTAGAGGGCCCCAGG + Intronic
1001600329 5:172924168-172924190 CAGAGAGGGCAGAGGGCACTGGG - Intronic
1002167492 5:177357577-177357599 CAGGGTGGACAAAGGTGCCTAGG + Intergenic
1002529281 5:179834302-179834324 CAGGTTGTGCACACGGACCTTGG - Intronic
1002565984 5:180113192-180113214 CAGGATGGACAGAGGGACCGGGG + Intronic
1002566017 5:180113287-180113309 CAGGATGGACGGAGGGACCGGGG + Intronic
1002591593 5:180294448-180294470 CAGGGTGGGGAGGGGGGCCTTGG + Intergenic
1002664401 5:180811645-180811667 TAGGGAGGGCAGGGAGACCTAGG - Intronic
1003047185 6:2744632-2744654 CAGGATGTGCAGAGGGACAGTGG - Intronic
1005140663 6:22627888-22627910 AAGTGTGGGCAGTGGGAGCTGGG + Intergenic
1006024762 6:31139734-31139756 CTGGGTGGGAAGAGGGAACCAGG - Exonic
1006143315 6:31943912-31943934 CAGGGAAGGCAGATGGGCCTGGG - Exonic
1006321177 6:33320415-33320437 CAGAGTGGGAAGAGGTGCCTTGG + Exonic
1006414057 6:33893039-33893061 CGGGGTGGGGAGAGGGGCCGGGG + Intergenic
1006455680 6:34130520-34130542 CAGGGTGGGGTGAGGGGCCTGGG - Intronic
1007260454 6:40559549-40559571 GAGGGAGGGAAGAGGGACCGAGG + Intronic
1010277068 6:73981107-73981129 CAGGGTAGGGAGAGGGAGCTGGG - Intergenic
1014109792 6:117607779-117607801 CATGGTGAGCAGAGGGAGTTAGG + Intergenic
1016862688 6:148736706-148736728 CAGGCTTGGGAGAGGGACATGGG - Intergenic
1017817669 6:158027322-158027344 CGGGGTGGGAAGAGTGTCCTTGG + Intronic
1018279977 6:162174985-162175007 CAGGGTGGGGAAAGACACCTCGG - Intronic
1018432670 6:163735250-163735272 CTGAGTAGGCACAGGGACCTCGG - Intergenic
1018576390 6:165264372-165264394 CAGGGTTAGGGGAGGGACCTGGG - Intergenic
1019050942 6:169183161-169183183 CGGTGTAGGCAGAGGGAACTCGG - Intergenic
1019053166 6:169200235-169200257 GAGGGTGGGCAGAGGGGTTTGGG - Intergenic
1019435898 7:1021978-1022000 CTGGGTGTGCCGAGGGACTTGGG - Intronic
1019537728 7:1537804-1537826 CAGGGTGTGGGGAGGGTCCTGGG + Intronic
1019662461 7:2232526-2232548 CACGGTAGGCAGCGGGACCCCGG + Intronic
1022471342 7:30683413-30683435 CAGGGTGGGGTGGGGGGCCTGGG - Intronic
1022485190 7:30772144-30772166 CAGGGTGGAGATGGGGACCTCGG + Intronic
1022794309 7:33719757-33719779 CAGGGTGTGCACTGGGACCTTGG - Intergenic
1024023054 7:45388231-45388253 CGTGGTGGGCAGAGCAACCTGGG - Intergenic
1024577662 7:50777913-50777935 CAGGGAGGGGAGAGGGACTGAGG + Intronic
1024597854 7:50955085-50955107 AGGGCTGGGCAGAGGAACCTGGG - Intergenic
1025025758 7:55515019-55515041 CAGGGTGTGGACAGAGACCTCGG - Intronic
1025105750 7:56170877-56170899 AAGTGGGGGCAGAGGCACCTAGG - Intergenic
1026314847 7:69219397-69219419 AAGTGGGGGCAGAGGCACCTAGG - Intergenic
1026586761 7:71661782-71661804 CAGGGAGAGCTGAGGGACTTTGG + Intronic
1026907159 7:74069115-74069137 CCTGGTGGGCAGGGGGAGCTGGG - Intronic
1027249378 7:76389578-76389600 CAGGGGCTGCAGAGGAACCTGGG - Exonic
1027252632 7:76408666-76408688 CAGGCTTGGCAGAGGGCTCTGGG - Intronic
1028503888 7:91550209-91550231 CAGGGTGGGCAGAGATCCCATGG - Intergenic
1028922408 7:96322287-96322309 CGGCGTGGGCAGAGGTAACTTGG + Intergenic
1029478361 7:100798636-100798658 CAGGGAGGGCAGAAGGAACAGGG + Intergenic
1029804967 7:102986459-102986481 CAGCTTGGGCACAGGGACCATGG - Intronic
1032792859 7:135255244-135255266 CAAGGTGGGCAGAGGTACCACGG - Intronic
1033253036 7:139777391-139777413 CAGGGCGGGGAGAGGGGCCGGGG - Intronic
1035414072 7:158668196-158668218 AAGGGGGGGCGGAGGGACCCAGG - Intronic
1035519928 8:267172-267194 AAGGGTGGCCAGGGGGACCCTGG + Intergenic
1036390363 8:8319147-8319169 CAGGGCAGGCACAGGGTCCTTGG + Exonic
1036587300 8:10136169-10136191 CACGCTGGGCACAGGGACCCCGG + Intronic
1036754687 8:11464448-11464470 CATGGTGGGCAGGGGGAGGTGGG - Intronic
1037417648 8:18668170-18668192 CAGAGTGGGCAGAGAGGCCGAGG + Intronic
1037744871 8:21635121-21635143 CAAGGTGGGCAGAATGATCTGGG + Intergenic
1037776242 8:21837810-21837832 TAGGGTGGGCAGAGGGAAGGAGG - Intergenic
1037823192 8:22145512-22145534 CATGGTGGGCAGAGGCTCATGGG + Intergenic
1038327016 8:26579089-26579111 CAGGGTGGGCGCGGGGACCGCGG + Intronic
1039376612 8:37040928-37040950 AAGGCTGGGAAGAGGGTCCTGGG + Intergenic
1039474000 8:37829825-37829847 CAGGGTGGGCAGAGGGGTCACGG - Intronic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1041461688 8:58118552-58118574 CAGGGTGGGGCGTGGTACCTGGG + Intronic
1042400600 8:68341677-68341699 CAGGATGGGCAGAGGGGCACAGG - Intronic
1042801727 8:72725712-72725734 CAGTCTGGGCAGAAGGACCGGGG - Intronic
1042856538 8:73273351-73273373 CAGAGTGGGCACTGGGAGCTGGG - Intergenic
1043666748 8:82825102-82825124 CAGTGTGGGAGGAGCGACCTGGG + Intergenic
1045481964 8:102600134-102600156 CAGGGAAGGCAGAGGGAAGTAGG - Intergenic
1045801727 8:106109966-106109988 CAGGGTGGGCAGAGTGGCACTGG - Intergenic
1046984198 8:120369421-120369443 CAGGCTGGCCAGAAGGACCTTGG - Exonic
1047343005 8:124000908-124000930 TAGAGAGGGCAGAGGGACCCAGG + Intronic
1047715517 8:127591550-127591572 CAAAGTGGGCAGAGGGGCTTAGG + Intergenic
1047719716 8:127628386-127628408 CACGGTGAGCAGAAGGATCTAGG - Intergenic
1047889399 8:129291231-129291253 CAGGGAGGGCAAGGGGAACTAGG + Intergenic
1048025066 8:130578503-130578525 CTGGCTTGGCAGAGGGACCAGGG + Intergenic
1048165766 8:132059912-132059934 CAGGGCTGGCAGAGGAACCTTGG - Intronic
1048969775 8:139638999-139639021 GAGGGTGGGATGAGGGACATGGG - Intronic
1049093682 8:140535287-140535309 TGGGGTGGGGAGAGGGGCCTGGG - Intronic
1049189706 8:141280219-141280241 CAGGGTGGGCAGGGGGCACGTGG - Intronic
1049190367 8:141284258-141284280 GCTGGTGGGCACAGGGACCTGGG + Intronic
1049217592 8:141415239-141415261 CAGGCTGGGAAGAGGGTCCCAGG - Intronic
1049219976 8:141424711-141424733 CTGGGTGGCCCAAGGGACCTAGG + Intronic
1049392975 8:142381504-142381526 CAGGGTGGGCTCAGGGACGGTGG + Intronic
1049412298 8:142478680-142478702 CAGGGTGCACAGTGGGACTTGGG + Intronic
1049470113 8:142771501-142771523 AAGGGTGGACAGAGCCACCTGGG - Intronic
1049472437 8:142782504-142782526 CAGGGTGTGCGAAGGCACCTGGG - Intergenic
1049600473 8:143505160-143505182 CAGGGATGGGAGAGGGAGCTGGG + Intronic
1049603925 8:143520416-143520438 CAGGGTGGGCAGCTGGCCATCGG - Intronic
1050287024 9:4114127-4114149 CAGAGTGAGTAGAGGGACCCAGG - Intronic
1050308746 9:4331795-4331817 CTGGGTGGGAAGAGAGACATTGG + Intronic
1051598640 9:18850218-18850240 CAGGGAGGGCACATGGGCCTGGG - Intronic
1052746662 9:32448359-32448381 CTTGGTGGGCAGAGGGGCATCGG - Intronic
1053299220 9:36936741-36936763 CAGGGTGGGGACAGGGAGGTGGG + Intronic
1053789702 9:41678135-41678157 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054155442 9:61636618-61636640 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054178040 9:61889825-61889847 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054475227 9:65567728-65567750 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054659489 9:67690999-67691021 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1056587854 9:87939971-87939993 GAGGGTGGGGAGAGGGAGCAGGG + Intergenic
1056609013 9:88112974-88112996 GAGGGTGGGGAGAGGGAGCAGGG - Intergenic
1057020773 9:91696036-91696058 GCTGGTGGGCAGAGGGACCTGGG - Intronic
1057192746 9:93096457-93096479 CAGCGGGGGCCGAGTGACCTTGG + Intronic
1057791422 9:98127459-98127481 CAGAGTGGGCAGAGGGACCTGGG + Intronic
1058531701 9:105912301-105912323 CAGGCTGGGCAGAGGAGTCTAGG - Intergenic
1058645148 9:107124996-107125018 CAGGGTGAGGAGAGAGCCCTTGG + Intergenic
1059990636 9:119862055-119862077 CAGTGTGGGTAGAGGCAGCTGGG - Intergenic
1060401626 9:123353080-123353102 CAGAGGGAGCAGGGGGACCTGGG + Intergenic
1060403766 9:123362817-123362839 CAGGGTGGGCAGAGGTTACAAGG - Intronic
1060497659 9:124130182-124130204 CAGGGTGGGCTATGGGACCAAGG - Intergenic
1060757526 9:126224044-126224066 CAGGGTGGGCAGGCAGGCCTGGG - Intergenic
1060926169 9:127456917-127456939 CAGGGCTGGCAGAGGGGCCAGGG - Intronic
1060952006 9:127609965-127609987 AACGGTGGTAAGAGGGACCTGGG - Intergenic
1061249837 9:129420286-129420308 CTAGGTGGGCAGAGGGAGCCGGG + Intergenic
1061674788 9:132209597-132209619 CAGCGTGGGCCCATGGACCTGGG + Intronic
1061761994 9:132857622-132857644 CAGGGAGGGCAGAGGAATCTGGG - Intronic
1061805066 9:133133230-133133252 CAGGGTGGGCAGGGCTACCCGGG + Intronic
1061954301 9:133953631-133953653 CATGGTGGTCAGAGGGAACTGGG - Intronic
1062029485 9:134355816-134355838 CAGGGTGAGCCCAGGGCCCTGGG - Intronic
1062105498 9:134752781-134752803 GAGGGTGGCCAGGGGGACCAGGG + Intronic
1062446728 9:136598362-136598384 CAGTGTGGGCAGGAGCACCTGGG + Intergenic
1062446756 9:136598460-136598482 CAGTGTGGGCAGGAGCACCTGGG + Intergenic
1062446770 9:136598509-136598531 CAGTGTGGGCAGGAGCACCTGGG + Intergenic
1062446803 9:136598632-136598654 CAGTGTGGGCAGGAGCACCTGGG + Intergenic
1062446832 9:136598730-136598752 CAGTGTGGGCAGGAGCACCTGGG + Intergenic
1062489613 9:136798953-136798975 CAGGGCGGGAGGAGGGATCTTGG + Intronic
1062504335 9:136865694-136865716 CAGGGTGGGCACTGGGAACGGGG - Intronic
1062505229 9:136870674-136870696 CATGGTGGGCAGAGGGACAGGGG - Intronic
1062589434 9:137266789-137266811 GGAGGTGGGAAGAGGGACCTGGG + Intronic
1062672237 9:137717915-137717937 CAGGGTTGGGAGGGAGACCTCGG - Intronic
1062682546 9:137789532-137789554 CAGGTTTGGCAGCCGGACCTTGG + Intronic
1186422291 X:9435884-9435906 ACGGGTGGGCAGAGGTGCCTGGG - Intergenic
1186803899 X:13120285-13120307 CAGGGTGCTGAGAGGTACCTGGG - Intergenic
1189318055 X:40069660-40069682 GAAGGTTGTCAGAGGGACCTGGG - Intronic
1189539761 X:41973556-41973578 CAGGTTGGGAAGAGGGATTTTGG + Intergenic
1190004827 X:46725768-46725790 CAGGCTGGGCAGTGGAGCCTTGG + Intronic
1193226307 X:78988353-78988375 CAGGGTGGGGATAGGGAGATGGG + Intergenic
1195990432 X:110677026-110677048 CAGGGTGGGCAGAGACAACAGGG - Intronic
1196441508 X:115723427-115723449 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196445039 X:115841416-115841438 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1197720049 X:129738998-129739020 CAGGGTGGGCAGAGGAGCTTTGG - Intronic
1198429792 X:136553852-136553874 AAGGGTAGTCAGAGAGACCTTGG + Intronic
1199679796 X:150216641-150216663 GAGGGAGGGAAGAGGTACCTTGG + Intergenic
1199695432 X:150340408-150340430 GAGGGAGGGAAGAGGTACCTTGG - Intergenic
1200078321 X:153562942-153562964 CATGGTGGACAGAGGGAGCAAGG + Intronic
1200213697 X:154358158-154358180 CAGGGGAGGCAGGGGGGCCTGGG - Intronic
1200246107 X:154526662-154526684 CTGGGTGGGCAAAGGCAACTTGG + Intergenic
1200988693 Y:9328294-9328316 CAGGGAAGACATAGGGACCTTGG - Intergenic
1201280911 Y:12341127-12341149 CAGGGTTGGAACAGGGACTTTGG - Intergenic
1201943453 Y:19484018-19484040 CTGGGTGGGAAGGTGGACCTGGG + Intergenic
1201980782 Y:19908333-19908355 CAGTGTTGGGAAAGGGACCTGGG - Intergenic
1202340639 Y:23861282-23861304 CAGAGTGGGCACTGGGAGCTTGG - Intergenic
1202530127 Y:25808800-25808822 CAGAGTGGGCACTGGGAGCTTGG + Intergenic