ID: 1156419292

View in Genome Browser
Species Human (GRCh38)
Location 18:36933620-36933642
Sequence ACAGAACTGTGGGCTGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 286}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156419292_1156419308 24 Left 1156419292 18:36933620-36933642 CCAGGACCAGCCCACAGTTCTGT 0: 1
1: 0
2: 0
3: 29
4: 286
Right 1156419308 18:36933667-36933689 CCAGCTGTTCTAGGGGATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1156419292_1156419304 15 Left 1156419292 18:36933620-36933642 CCAGGACCAGCCCACAGTTCTGT 0: 1
1: 0
2: 0
3: 29
4: 286
Right 1156419304 18:36933658-36933680 GGTTGGGCACCAGCTGTTCTAGG 0: 1
1: 1
2: 5
3: 18
4: 173
1156419292_1156419309 25 Left 1156419292 18:36933620-36933642 CCAGGACCAGCCCACAGTTCTGT 0: 1
1: 0
2: 0
3: 29
4: 286
Right 1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 107
1156419292_1156419296 -7 Left 1156419292 18:36933620-36933642 CCAGGACCAGCCCACAGTTCTGT 0: 1
1: 0
2: 0
3: 29
4: 286
Right 1156419296 18:36933636-36933658 GTTCTGTCCTCCACACCCTCTGG 0: 1
1: 0
2: 2
3: 25
4: 264
1156419292_1156419306 17 Left 1156419292 18:36933620-36933642 CCAGGACCAGCCCACAGTTCTGT 0: 1
1: 0
2: 0
3: 29
4: 286
Right 1156419306 18:36933660-36933682 TTGGGCACCAGCTGTTCTAGGGG 0: 1
1: 0
2: 4
3: 11
4: 114
1156419292_1156419297 -6 Left 1156419292 18:36933620-36933642 CCAGGACCAGCCCACAGTTCTGT 0: 1
1: 0
2: 0
3: 29
4: 286
Right 1156419297 18:36933637-36933659 TTCTGTCCTCCACACCCTCTGGG 0: 1
1: 0
2: 5
3: 27
4: 370
1156419292_1156419305 16 Left 1156419292 18:36933620-36933642 CCAGGACCAGCCCACAGTTCTGT 0: 1
1: 0
2: 0
3: 29
4: 286
Right 1156419305 18:36933659-36933681 GTTGGGCACCAGCTGTTCTAGGG 0: 1
1: 0
2: 0
3: 14
4: 114
1156419292_1156419298 -2 Left 1156419292 18:36933620-36933642 CCAGGACCAGCCCACAGTTCTGT 0: 1
1: 0
2: 0
3: 29
4: 286
Right 1156419298 18:36933641-36933663 GTCCTCCACACCCTCTGGGTTGG 0: 1
1: 0
2: 0
3: 17
4: 157
1156419292_1156419299 -1 Left 1156419292 18:36933620-36933642 CCAGGACCAGCCCACAGTTCTGT 0: 1
1: 0
2: 0
3: 29
4: 286
Right 1156419299 18:36933642-36933664 TCCTCCACACCCTCTGGGTTGGG 0: 1
1: 0
2: 1
3: 19
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156419292 Original CRISPR ACAGAACTGTGGGCTGGTCC TGG (reversed) Intronic
901413596 1:9102049-9102071 AGAGAGCTCTGGGCTGCTCCAGG - Exonic
901754925 1:11435585-11435607 CCAGAACTAGGGGCTGGGCCAGG + Intergenic
901803866 1:11725492-11725514 ACAGAAATGTGGGGTGGTCAGGG + Exonic
902458787 1:16555261-16555283 ACAGAAATGGGGTCTGGGCCAGG - Intergenic
902493369 1:16852655-16852677 ACAGAAATGGGGTCTGGGCCAGG + Intronic
903151975 1:21416019-21416041 ACAGAAATGGGGTCTGGGCCAGG - Intergenic
903303134 1:22393095-22393117 ACAGAGCTGTGGGATGTTCTGGG + Intergenic
903396096 1:23002926-23002948 ACAAAACTGTAAGCTGGACCGGG + Intergenic
903543917 1:24111806-24111828 ACAGAACAGTGGGATGGGGCAGG + Intronic
903545418 1:24120852-24120874 CCAGTTCTGTGGGCTGCTCCAGG + Exonic
904624248 1:31793277-31793299 ACACAGCTGTCGGCTTGTCCAGG - Exonic
905320185 1:37110575-37110597 TCACTTCTGTGGGCTGGTCCTGG + Intergenic
905542467 1:38771349-38771371 AAAGAAATGTGGGCTGGAGCTGG + Intergenic
906201994 1:43966412-43966434 ACTGAACTCTGAGGTGGTCCGGG + Intronic
906877097 1:49551594-49551616 ACACAGCTCTGGGCTGGTACTGG + Intronic
906898493 1:49806814-49806836 ACAGAGCTTTGGGGTGGTACTGG - Intronic
907145281 1:52225351-52225373 ACAAATCTGGGGGCTTGTCCAGG - Intronic
910325904 1:86006919-86006941 ACAACAATGTGGGCTGGTTCTGG + Intronic
912812218 1:112803074-112803096 GCAGGACTGTGGGCTGGTTCAGG - Intergenic
913171977 1:116241365-116241387 ACAAAAGAGTGTGCTGGTCCAGG + Intergenic
913606858 1:120475124-120475146 ACAGAAATGGGGTCTGGGCCAGG + Intergenic
914209575 1:145565018-145565040 ACAGAAATGGGGTCTGGGCCAGG - Intergenic
914268494 1:146057386-146057408 ACAGAAATGGGGTCTGGGCCAGG - Intergenic
914368598 1:147003477-147003499 ACAGAAATGGGGTCTGGGCCAGG + Intergenic
914584335 1:149046712-149046734 ACAGAAATGGGGTCTGGGCCAGG - Intronic
915109462 1:153553764-153553786 ACAGAATTGGGGACTGGGCCTGG + Intergenic
915440130 1:155940776-155940798 ACAGAACTGAGGGCATGCCCAGG + Intergenic
915475775 1:156152003-156152025 TCAGAACTGTGGACTGGGGCAGG + Intronic
915479996 1:156177927-156177949 AAAGTGCTGTGGGCTGGTTCTGG - Intergenic
916054349 1:161057859-161057881 ACAAAACTGTGGGCTGAGCATGG + Intronic
916194433 1:162210308-162210330 GCAGAGCTGTGGGCTGGGCATGG - Intronic
916678525 1:167084061-167084083 CCAGAAATGTGGGCTGGGCCTGG + Intronic
917331309 1:173883186-173883208 AGAGTACTGTTGGCTGGGCCTGG + Intronic
919061974 1:192644978-192645000 CCAGAACTGAGGGCTGGACATGG - Intronic
919798184 1:201333905-201333927 ACTAAACTGTGGGATGGTCCAGG - Intergenic
920145253 1:203855338-203855360 GCAGAACTGTTGGCTGGGCGTGG - Intergenic
920184076 1:204149884-204149906 GCAGGACTGCGTGCTGGTCCGGG - Exonic
920955897 1:210619817-210619839 AGAGAGCTCTGGTCTGGTCCCGG - Intronic
922723057 1:227908614-227908636 CCACGACCGTGGGCTGGTCCTGG + Intergenic
923770009 1:236930264-236930286 ACAGGACTGTGGGTTGGTGGAGG - Intergenic
924816742 1:247448587-247448609 ACAGAGCTGTGGTCTTGGCCTGG - Exonic
1063446603 10:6121859-6121881 ACAGAAGAGTGGGCTGGGCATGG - Intergenic
1064557147 10:16559023-16559045 ACAGGGCTCTGGGCTGGTACTGG + Intergenic
1065414293 10:25467694-25467716 AGAGAAGAGTGGGCTGGTCTGGG + Intronic
1067702009 10:48580518-48580540 GCAGTGCTGTGGGCTGGTACAGG + Intronic
1068121920 10:52789417-52789439 AAAGACCTGTCGGCTGGGCCCGG - Intergenic
1069640859 10:69954667-69954689 TCAGAACTAGGGGATGGTCCAGG + Intronic
1069752698 10:70754378-70754400 ACAGGACTGTGGGCTGCACGAGG - Intronic
1070483540 10:76909051-76909073 AGAGGACAGTGGGCTGGCCCAGG - Intronic
1072452389 10:95548745-95548767 TTAGAACTATGGGCTGGGCCTGG - Intronic
1074569892 10:114614761-114614783 ACACAAGTGTGGGCTGGGCGTGG + Intronic
1076247443 10:128958428-128958450 ACTGAACTGTGGCCTGGCCAGGG + Intergenic
1076724754 10:132408131-132408153 CCAGAGCAGGGGGCTGGTCCCGG - Intronic
1077049361 11:559919-559941 AAGGAGCTGTGGGCTGGGCCTGG - Intronic
1077411875 11:2407490-2407512 CAAGAACTCTGGGCTTGTCCAGG - Intronic
1077926495 11:6686819-6686841 ACAAATCTGGGGGCTTGTCCAGG + Intergenic
1080382423 11:31787412-31787434 ACAGAACCGTGGGCCGGAACTGG + Exonic
1081036129 11:38148784-38148806 ACAGAGCTGCCGGCTGGACCTGG - Intergenic
1081486129 11:43530848-43530870 AGAGAACAGAGGGCTGGACCAGG - Intergenic
1081487367 11:43542022-43542044 AAAGAAATGTGGGCTGGGCATGG + Intergenic
1081688046 11:45056442-45056464 ACAGAAGTCTGGGGTGGGCCAGG - Intergenic
1081779367 11:45699374-45699396 GCAGAACTGGGGGCAGGTGCAGG - Intergenic
1081891511 11:46546328-46546350 ATGGAACTGTGGGCTGGGCGCGG - Intronic
1084437759 11:69154334-69154356 CCTGTACTGAGGGCTGGTCCTGG + Intergenic
1084674205 11:70624679-70624701 TCACAACTGGGGGCTGGTGCTGG + Intronic
1085152050 11:74260171-74260193 TCAGAAATGTGGGCTGATGCTGG + Intronic
1088439030 11:109847907-109847929 ACAGGACTGTGGGCTTCTCAAGG + Intergenic
1088981719 11:114870620-114870642 ACAGACCTGTGGGCAGGCCCTGG + Intergenic
1089680938 11:120118569-120118591 ACAGAGCTCTGGGCTGCTCTTGG - Intronic
1090996924 11:131875047-131875069 ACAGAACTGGGGCCTTGTCCTGG + Intronic
1091399211 12:172389-172411 ACAGAACAGAGGGCTGGGCACGG - Intronic
1096529692 12:52234791-52234813 ACAGAAGGGAGGGCTGGGCCTGG + Intronic
1096559565 12:52425744-52425766 ACAGAGCAGGAGGCTGGTCCAGG + Intronic
1096900190 12:54869425-54869447 ACAAATCTGTGAGCTGGGCCTGG - Intergenic
1097546351 12:61005802-61005824 AGAGCATTGTGGGCTGGTCATGG - Intergenic
1102157809 12:110744357-110744379 ACAGGACTTTGGGCTACTCCAGG + Intergenic
1102242951 12:111336736-111336758 ACTGAAGTGTGGGCTGGGCACGG - Intronic
1107865199 13:44696409-44696431 AAAGGAGTGTGGGCTGGGCCGGG + Intergenic
1110064412 13:71085811-71085833 TAAGCACTGTGGGCTGGTTCAGG + Intergenic
1110852561 13:80262301-80262323 ACACAGCTCTGGGCTGGTACTGG + Intergenic
1111008746 13:82284211-82284233 ACAGAAATGTCGGCTGGGCACGG - Intergenic
1113496147 13:110730852-110730874 AAAGAGCTGTGGGCTGGTCATGG - Intergenic
1114447191 14:22798003-22798025 AGAGAACTGAGGGCTGGGCACGG + Intronic
1114674012 14:24429369-24429391 ACAGCACTGAGGGCTGGACCTGG + Exonic
1116620559 14:47197618-47197640 AAAGTACTGTAGGCTGGGCCTGG + Intronic
1117782553 14:59249080-59249102 ACAAAACTGAGGGATGGGCCAGG - Intronic
1118603598 14:67487359-67487381 ACAAAAGTCTGGGATGGTCCTGG + Intronic
1119693017 14:76691635-76691657 ACAGAACACTGGGCTGGGCACGG - Intergenic
1120660889 14:87249964-87249986 AAAGAAATGTGGGCTGGGCATGG + Intergenic
1121233584 14:92376523-92376545 ACAGAAGTCTGGGCTGGGGCTGG + Intronic
1121453284 14:94022974-94022996 GCAGAGCTGGGGGCTGGCCCTGG - Intergenic
1121639874 14:95478138-95478160 ACCGAACTGTGGGCTGGGCGAGG + Intergenic
1122555573 14:102577614-102577636 CAAGAACTGTAGGCTGGGCCCGG + Intergenic
1122701642 14:103593519-103593541 ACACATCAGTGGGCTGGTCGCGG - Intronic
1122820910 14:104344341-104344363 ACAGATCTGTGGGCAGGAGCTGG - Intergenic
1125732041 15:41897997-41898019 ACAGAACTTTGTACTGGTCCTGG + Exonic
1126407064 15:48332105-48332127 CCAGAACTGTGGACTCGTCCCGG + Intronic
1127139156 15:55956102-55956124 AAAGAAATGTGGGCTGGGCATGG - Intronic
1127957538 15:63865975-63865997 CCAGACCTCTGGGCTGCTCCAGG + Intergenic
1129374942 15:75123999-75124021 AAAGACCTGAGGTCTGGTCCTGG - Intergenic
1131386467 15:92012379-92012401 CCAGAACTGTGGGCTGGGAAGGG - Intronic
1131927674 15:97403584-97403606 ACTAAACTGTGGCTTGGTCCTGG - Intergenic
1132697305 16:1207684-1207706 ACAGAAGTCTGGGCTGGCCTGGG - Intronic
1133765802 16:8836956-8836978 AATGAACTGTAAGCTGGTCCAGG + Intronic
1135982283 16:27157223-27157245 ACAAAACTTTGGTCTGGGCCAGG + Intergenic
1136368174 16:29819282-29819304 ACAGAACTCTGTTCTTGTCCTGG + Intronic
1137516314 16:49147602-49147624 ACAGAAGGGAGTGCTGGTCCTGG - Intergenic
1138318842 16:56093783-56093805 AGAGAGCAGTGGGCTGGGCCCGG + Intergenic
1140508699 16:75491938-75491960 CCAGGACTGTGGGCTGGGCCAGG + Intronic
1140895267 16:79319141-79319163 AGAGAACTCTGGGCTGTGCCAGG + Intergenic
1141689920 16:85590967-85590989 ACACAGCTGTGGGCTGTCCCTGG - Intergenic
1141859280 16:86705466-86705488 TCCAAACTGTGGGATGGTCCTGG + Intergenic
1142016703 16:87752623-87752645 ACAGTGCTGTGGGCTGGGCATGG - Intronic
1142115852 16:88355765-88355787 GCAGAACTGTGAGCGGGGCCGGG + Intergenic
1142497466 17:314019-314041 CTGGAGCTGTGGGCTGGTCCGGG - Intronic
1142692188 17:1613326-1613348 GCAGGACTCTGGGCTGGTCCCGG - Intronic
1142850630 17:2703114-2703136 ACAGAGCCGTGGGCTGGGCATGG - Intronic
1143480095 17:7223174-7223196 TCACAACTTTGGGCTGATCCAGG + Exonic
1146288952 17:31594503-31594525 ACAGAACTGTGGGCTTGGCAAGG - Intergenic
1146306475 17:31733473-31733495 GGAGAAGTGTGGCCTGGTCCTGG - Intergenic
1147017650 17:37505234-37505256 TCAGAAATGTGGGCCGGACCTGG + Intronic
1147189087 17:38728682-38728704 ACAGTCCTGAGGGCTTGTCCTGG - Exonic
1147565065 17:41530904-41530926 ACTGAACTGTTGGCTGGGCTAGG + Intergenic
1148139985 17:45321521-45321543 ACACCACTGTGTGCTGGTTCTGG + Intergenic
1148426121 17:47598177-47598199 ACTGAACTATTGGCTGGGCCAGG + Intronic
1148737759 17:49874415-49874437 ACTGACCTGTGGGCTGCACCCGG + Intergenic
1148790346 17:50169176-50169198 ACAGAAGTGGAGGCTGGCCCTGG - Exonic
1149996995 17:61410746-61410768 TCAGACCTGCGGGCAGGTCCGGG + Intergenic
1150804252 17:68306644-68306666 GCAGCATTGGGGGCTGGTCCTGG + Intronic
1151372755 17:73659281-73659303 ACAGAACTGTAGTTTGGTGCTGG + Intergenic
1151396577 17:73826954-73826976 ACAGGTCTGGGGGCTGGTGCTGG - Intergenic
1152665959 17:81569648-81569670 ACGGAGCTGTGGGCTTTTCCAGG + Intronic
1152754791 17:82082688-82082710 ACAGGACTGTGGGCTGGACTGGG + Intronic
1152885354 17:82846130-82846152 GCAGAACTGTGGGATGGGACTGG + Intronic
1152919332 17:83058064-83058086 GCAGAGCTGAGGGCAGGTCCCGG - Intergenic
1153055798 18:945193-945215 AGAGAACAGTGGGCTGCCCCTGG - Intergenic
1155491846 18:26407634-26407656 CCACAACTGAGGGCTGTTCCTGG + Intergenic
1156419292 18:36933620-36933642 ACAGAACTGTGGGCTGGTCCTGG - Intronic
1157126369 18:44960185-44960207 ACGGCACTATGGGCTGGTCACGG - Intronic
1157975516 18:52323074-52323096 ACAGACCTGTGGGCAGAGCCAGG + Intergenic
1158576769 18:58644931-58644953 ACAAAACTGTAAGCTGGACCGGG + Intergenic
1160748163 19:720974-720996 CCAGGACTGTGGGGTGGCCCGGG + Intronic
1161230354 19:3171953-3171975 ACAGAGTGGGGGGCTGGTCCTGG + Intergenic
1161562875 19:4983529-4983551 ACTGAACCGTGGACTGGTCCTGG + Intronic
1161872149 19:6878418-6878440 AGAGAACAGTGGCCTGGTCTGGG - Intergenic
1161879106 19:6934895-6934917 AGAGAACTCTGGGCTGGGCGTGG - Intronic
1162349749 19:10141616-10141638 ACAGGCATGTGGGCTGGGCCTGG + Intronic
1162649254 19:12073444-12073466 ACAGTACTGTGGGCCGGGCGCGG - Intronic
1163669413 19:18618543-18618565 AGAGAGCTGTTTGCTGGTCCTGG + Intronic
1164521461 19:28983199-28983221 ACACACCTGTGGGCTTGTGCAGG - Intergenic
1165164497 19:33842016-33842038 ACAGAGCTGAGGGCTGGGGCAGG + Intergenic
1166305107 19:41932920-41932942 ACAGATGTGGGGGCTGGTCCAGG + Intergenic
1166670000 19:44704022-44704044 CCAAGACTGTGGGCTGGGCCAGG - Exonic
1166712599 19:44946859-44946881 AAAGAACTGTAGGCTGGGCGTGG + Intronic
1167847470 19:52176390-52176412 AAAGAACAGTGGGCTGGGCATGG - Intergenic
1168305726 19:55433948-55433970 CCAGCATTGTGGGCTGGGCCTGG - Intronic
1168473103 19:56656232-56656254 AAAGAACTCTGGGCTGGGCACGG - Intergenic
1202708746 1_KI270714v1_random:4872-4894 ACAGAAATGGGGCCTGGGCCAGG + Intergenic
925680344 2:6414439-6414461 ACAGAAGTGTGGGCTTGGGCAGG + Intergenic
925733621 2:6941888-6941910 ACAGAGCTGTGAGCTGGGACTGG + Intronic
926147623 2:10406291-10406313 ACAGAGCTGAGGGCTGAGCCAGG - Intronic
927024512 2:19051650-19051672 GCAGAACAGTGGGATGTTCCTGG - Intergenic
928345424 2:30489639-30489661 AGATAACTGTGGGCTGGGCGCGG - Intronic
929551461 2:42895765-42895787 ACAGACCCCAGGGCTGGTCCTGG + Intergenic
930230987 2:48843666-48843688 ACAGAGCTGTGGGTTGGGGCAGG - Intergenic
930487432 2:52026089-52026111 ACAAAACTGTAAGCTGGACCGGG + Intergenic
930924735 2:56803201-56803223 ACAGATCTGTGAGCTTCTCCTGG - Intergenic
931558728 2:63533325-63533347 GCAGAACTGTGTTCAGGTCCTGG - Intronic
931983253 2:67716650-67716672 ACAGCACTGTGTGCTGTGCCAGG - Intergenic
934720682 2:96573748-96573770 ACACCACTGTGGGCAGATCCAGG + Intergenic
937248367 2:120508674-120508696 ACAGAACTGGGGTCTGAGCCAGG - Intergenic
940796741 2:158088778-158088800 ACTGGACTCTGGGCTGGTACTGG + Intronic
940864562 2:158804934-158804956 AGAGAGCTGTGGGCTGGATCAGG + Intronic
941116681 2:161480171-161480193 ACAGCTCTGGGGGCTGCTCCTGG + Intronic
941116746 2:161480490-161480512 ACAGTCCTGTGCGCTGCTCCTGG + Intronic
942184579 2:173412809-173412831 AGAGGCCTGTGGGCTGATCCTGG + Intergenic
943207551 2:184919823-184919845 AAAGAACTGTAGGCTGGTCATGG + Intronic
944132613 2:196363054-196363076 ACAGAGCTTTGGGCTGATTCTGG + Intronic
945179838 2:207080587-207080609 ACAGAACTGTTGACTGGTTTTGG - Exonic
945958754 2:216110101-216110123 AAAGAACTGTGGGCTTTTCCTGG + Intronic
947840067 2:233202127-233202149 AGAGAACTGGGGGCAGGACCAGG - Intronic
948145004 2:235702134-235702156 ACAGAATTGGGGGCTGGGCTGGG + Intronic
948375894 2:237520013-237520035 ACTGACCTGTGGGCTGTCCCTGG - Exonic
948562771 2:238865205-238865227 ACAGAGCTGTGGGCAGAGCCAGG + Intronic
948861414 2:240754468-240754490 AGAGAGCTGTGAGCTGGGCCCGG + Intronic
1172485879 20:35297667-35297689 ACTGAACTGTGAGCTCCTCCAGG - Intergenic
1172523249 20:35582720-35582742 AGAGACCTGGAGGCTGGTCCTGG + Intergenic
1172718665 20:36982946-36982968 ACAGAGTTGAAGGCTGGTCCCGG + Intergenic
1172990364 20:39031631-39031653 TCAAAACTGTGGGCTGGGGCCGG - Intronic
1173718851 20:45235849-45235871 ACAGACCTGTGGGCTGCCCCTGG - Intergenic
1173778488 20:45733077-45733099 ACAGCCCTGTGGGTTGCTCCTGG - Intergenic
1173807799 20:45937370-45937392 ACAGACCTGTGGGATGCTGCAGG - Intronic
1176862404 21:14018065-14018087 ACTGCACTGTGGGCTGGGCATGG - Intergenic
1179026585 21:37683750-37683772 ACAGAGCTGGGGTCTGGACCTGG + Intronic
1179875167 21:44263299-44263321 CCTGAAGTGTGGGCTGGGCCTGG + Intergenic
1183202007 22:36391842-36391864 ACAGTCCTGTGGGCTGGGCCAGG - Intergenic
1183688121 22:39373844-39373866 GCAGAGCTGTGGGCTGGTCTGGG - Intronic
1183784138 22:40019565-40019587 AGGGAGCTCTGGGCTGGTCCTGG + Intronic
1183961858 22:41416021-41416043 ACAGTACTGGGGGCTGGGCGCGG + Intergenic
949217001 3:1582798-1582820 TCAGTACTGAGAGCTGGTCCTGG - Intergenic
949562468 3:5215062-5215084 ACAGAGATGTGGGCTGGTGGGGG + Intronic
949984637 3:9530887-9530909 ATTGAAATGTGGGCTGGGCCTGG - Intronic
951220179 3:20060309-20060331 AAAAAACTGTGGGCTGGGCATGG + Intronic
951302604 3:21017186-21017208 ACTGAGCTCTGGGCTGGTACTGG + Intergenic
953692698 3:45133426-45133448 ACAGAACTCTTGGCTGGGCATGG + Intronic
954041325 3:47889761-47889783 ACAGAACTGTAAGCTCTTCCTGG - Intronic
954580399 3:51700107-51700129 GCAGGAGTGTGGGCTGGCCCTGG - Intronic
954622474 3:52003988-52004010 ACAGAGCTATGGACAGGTCCTGG + Intergenic
955200062 3:56843555-56843577 ACAGAAATTTGGGCTGGGCATGG - Intronic
955231863 3:57106554-57106576 AGAGAACTTTGGAGTGGTCCTGG + Intronic
956709150 3:72024731-72024753 ACAAAACTGTAAGCTGGACCGGG - Intergenic
957079063 3:75621872-75621894 AAAGTGCTGTGAGCTGGTCCTGG + Intergenic
959268337 3:104171980-104172002 AGAAAACTGTGAGCTGCTCCTGG + Intergenic
960122511 3:113961326-113961348 ACACCACTGTGGACTGTTCCTGG + Exonic
963199630 3:142572790-142572812 AAAGAACTGTTCTCTGGTCCTGG + Intronic
966234622 3:177686812-177686834 CCTGAGCTGTGGCCTGGTCCAGG - Intergenic
966376346 3:179299893-179299915 AGGGAACTGTGGGCAGGTCGTGG - Intergenic
966460271 3:180168673-180168695 ACAGCCCTGTGGGCTTTTCCTGG - Intergenic
966785482 3:183619228-183619250 ACAGGACTTTGAACTGGTCCTGG + Intergenic
969313023 4:6365218-6365240 ACAGAACCGTGGGCAGGTAGTGG + Intronic
969483388 4:7458718-7458740 ACAGGACAGTGGGCTCCTCCTGG - Intronic
970551141 4:17182535-17182557 ACAGAACTCTAGGCTGGGCACGG - Intergenic
971858276 4:32071686-32071708 ACAAAGCTGTGTGCTGATCCAGG - Intergenic
972403702 4:38727639-38727661 AATGAACTGTGGGCTGGGCGCGG - Intergenic
972806531 4:42533865-42533887 ACCAGACTCTGGGCTGGTCCTGG - Intronic
978248832 4:106606346-106606368 AAAGAACTTTGGGCTGGGCGTGG - Intergenic
978348900 4:107800689-107800711 ACAGGACTGTGGGCTGGGCAGGG - Intergenic
984124853 4:175795457-175795479 AAAGCACTGTGGGCTGGGCATGG + Intronic
984820873 4:183881024-183881046 ACAGAGCTGTAGGGTGGTACAGG + Intronic
985084026 4:186294714-186294736 ATAAAACTGTGGGCTGGGCATGG + Intergenic
986156428 5:5181227-5181249 ACAGATATATGGGCTGGCCCTGG + Intronic
986634059 5:9802269-9802291 ACTGAGCTCTGGGCTGGTACTGG - Intergenic
995716424 5:115085569-115085591 ACAGCTCTGTTGGCTGGTCAGGG + Intergenic
996748119 5:126863624-126863646 ACAGCACTGTTGGCTGGGTCAGG + Intergenic
997423333 5:133786244-133786266 TCAGAAAAGTGGGATGGTCCAGG - Intergenic
997426427 5:133805812-133805834 AAGGAACTGAGGGCTGGTGCAGG - Intergenic
997612432 5:135224600-135224622 GCAAAACTGTAGGCTGATCCAGG + Intronic
997976616 5:138445076-138445098 ACAGAGCTGAGGGCTGGGGCAGG - Intronic
1000434875 5:161196139-161196161 AGAGAACAGTGGCTTGGTCCAGG - Intergenic
1001717306 5:173826775-173826797 ACAGAAGTATGGGGTGGGCCAGG - Intergenic
1002590127 5:180285377-180285399 GCAGGACTGTGTGCTGGTCCTGG - Intronic
1003123959 6:3340397-3340419 ACAGCCCTGTGGGCTGGCCTGGG + Intronic
1004021484 6:11779811-11779833 AAAGAACTGTAGGCTGGACAAGG + Intronic
1007320831 6:41027947-41027969 AAAGAACTGTGTGCTTGTCAGGG + Exonic
1009379076 6:63007045-63007067 ACAAAACTGTAAGCTGGACCGGG - Intergenic
1009589193 6:65643761-65643783 ACTGAGCTCTGGGCTGGTACTGG - Intronic
1009895531 6:69745122-69745144 ACAGCACTGTGGGCTGGGCATGG - Intronic
1010981200 6:82371911-82371933 ACAGAACTGATGGCTGGGCACGG - Intergenic
1011592311 6:88982130-88982152 CCAGAACTGAGGGCTGGGCGTGG - Intergenic
1014203112 6:118625943-118625965 AGAGACCAGTGGGCTGATCCTGG - Intronic
1015478738 6:133683047-133683069 ACAGAAGGGTGGGCTGCTCAAGG - Intergenic
1015801448 6:137065300-137065322 ACAAAACTGTAAGCTGGACCGGG + Intergenic
1016535824 6:145107094-145107116 ACAAAACTGTAAGCTGGACCAGG + Intergenic
1016767409 6:147810461-147810483 GCACAATTGTGAGCTGGTCCTGG + Intergenic
1016827318 6:148400457-148400479 ACTGAGCTCTGGGCTGGGCCTGG + Intronic
1017488026 6:154920907-154920929 ACAGAGAGGAGGGCTGGTCCTGG - Intronic
1018030890 6:159840716-159840738 ACAGAAATGTGTGGTGGTCAGGG + Intergenic
1018168687 6:161126591-161126613 ACCGGGCTCTGGGCTGGTCCAGG + Intergenic
1022628332 7:32061389-32061411 CCAGAACTGTGGACTGCTCCAGG + Intronic
1023199194 7:37675487-37675509 ATAGAACTGTGGGCTGAGGCGGG + Intergenic
1023989010 7:45117107-45117129 ACAGAACCTTGGGGTGGTCTTGG + Intergenic
1024083178 7:45872819-45872841 ACAAAGCTGTGGCCTGGTCCTGG - Intergenic
1026903990 7:74052228-74052250 AGACACCTGTGGGCTGGCCCTGG - Intronic
1029122783 7:98279825-98279847 AAGGAACTGAGGGGTGGTCCAGG - Intronic
1029805734 7:102994477-102994499 ACAAAACTGAGGGCAGGACCTGG - Intronic
1030710089 7:112739698-112739720 ACAGTACTGTGGGCTATCCCTGG - Intergenic
1031525526 7:122818686-122818708 ACAAAACTGTAAGCTGGACCAGG - Intronic
1033026906 7:137782834-137782856 ACAGAGCTCTGAGCTGGTACTGG - Intronic
1033163144 7:139015108-139015130 ATAGAACAGTGGGCAGGGCCAGG + Intergenic
1034196656 7:149253672-149253694 ACCGAACTCTGGGGTGGTCAGGG + Exonic
1034449770 7:151131036-151131058 ACAGAACTCTGGGCTGAGCCTGG + Intronic
1034475997 7:151282346-151282368 ACAGAGGTGTGGGCTTGTCCTGG + Intergenic
1034721871 7:153300755-153300777 ACAGAACTGTGAAGTGATCCTGG + Intergenic
1038398220 8:27262576-27262598 TGAGAAATGTGGGCTGGCCCTGG + Intergenic
1042404651 8:68390204-68390226 ACAGAATGGTGGGCTGGACAGGG - Intronic
1042768361 8:72352286-72352308 ACTGAGCTCTGGGCTGGTACTGG + Intergenic
1044885541 8:96773039-96773061 ACAGACCTGGGACCTGGTCCTGG - Intronic
1045003281 8:97896541-97896563 GCAGAACAGTGGGCTGGGCAGGG + Intronic
1047247533 8:123158398-123158420 ACAGAACTCTGGGCAAGGCCAGG + Intergenic
1048420066 8:134269468-134269490 ACAGAAGTGTGTGCAGGCCCAGG + Intergenic
1048580231 8:135724450-135724472 ACAGTTGTGTGGGCTGGTCGTGG - Intergenic
1049309913 8:141928350-141928372 ACAGATATTTGGGCTTGTCCCGG - Intergenic
1051076964 9:13250836-13250858 AATGAACTGTGGGCTGGGCATGG + Intronic
1051271173 9:15356295-15356317 AAAGAATTGTGGGCTGGGCGCGG - Intergenic
1053078536 9:35155185-35155207 ACAAAACTGTGAGCTGGACTGGG + Intergenic
1054815457 9:69470573-69470595 CCAAAACTGTGAGCTTGTCCTGG + Intronic
1055990662 9:82102225-82102247 CCAGATCTCTGGGCTGGTCAAGG + Intergenic
1057443497 9:95098322-95098344 ACAGAAATGGGAGCTAGTCCAGG - Intergenic
1057463734 9:95292299-95292321 ACACAACTGCGAGCTGGGCCTGG + Intronic
1057715403 9:97491220-97491242 ACAGAAATGTGGGCTGGGTGTGG - Intronic
1057817464 9:98306189-98306211 ACTGCACATTGGGCTGGTCCCGG + Exonic
1060523226 9:124306115-124306137 ACAGCACTGGGGGCTGGACATGG + Intronic
1060861206 9:126956296-126956318 ACAGAACTGGGGGCTCAGCCAGG + Intronic
1061090384 9:128422690-128422712 ACAGAACTGTGGTGGGGACCTGG + Intronic
1061244398 9:129394086-129394108 ACAGATCTGTGGGTGGCTCCGGG + Intergenic
1061537923 9:131260944-131260966 TCAGGATTTTGGGCTGGTCCTGG + Exonic
1062581260 9:137230211-137230233 GGAGAACTGTGCGCTGGGCCAGG + Intergenic
1186671382 X:11770630-11770652 ACAGTACTAGGGGCTGGTCTGGG + Intronic
1186798456 X:13068925-13068947 ACTGAACTGGGGGCTGGGCTAGG - Intergenic
1187023884 X:15412627-15412649 TCAGAAGTTTGGGCTTGTCCTGG - Intronic
1188333094 X:28896568-28896590 ACAAAACTGTAAGCTGGACCGGG + Intronic
1188430955 X:30105092-30105114 ACAAAACTGTAAGCTGGACCGGG - Intergenic
1189567269 X:42255491-42255513 ACTGGACTCTGGGCTGGTACTGG - Intergenic
1192208884 X:69114554-69114576 AGAGAACTGTGGGCTGGAGAAGG + Intergenic
1192523639 X:71823505-71823527 AGAGGGCTGTGGGCTGGCCCTGG + Intergenic
1192691161 X:73366467-73366489 ACAGGGCTCTGGGCTGGTACTGG + Intergenic
1193671325 X:84389853-84389875 ACAGACATGTGAGCTGGTCTGGG - Intronic
1194445593 X:93983458-93983480 ATCGAACTCTGGGCTGGTACTGG - Intergenic
1194543403 X:95203110-95203132 ACACAGCTTTGGGCTGGTACTGG + Intergenic
1194601336 X:95924675-95924697 ACAGGTCTTTGGGCTGGTACTGG - Intergenic
1194707535 X:97193302-97193324 ATAGAAATGTGGGCTGGGCACGG - Intronic
1196221055 X:113112677-113112699 ACAAAACTGTAAGCTGGACCCGG + Intergenic
1197515457 X:127422582-127422604 ACCGAGCTCTGGGCTGGTACTGG + Intergenic
1198943221 X:141981837-141981859 ACAGGGCTCTGGGCTGGTACTGG + Intergenic
1200050750 X:153429825-153429847 ACACAACTCTGGGCTGGGCATGG - Intergenic
1201391460 Y:13502052-13502074 ACAGAAATGAGGCCTGCTCCAGG - Intergenic