ID: 1156419294

View in Genome Browser
Species Human (GRCh38)
Location 18:36933630-36933652
Sequence GGTGTGGAGGACAGAACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 232}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156419294_1156419304 5 Left 1156419294 18:36933630-36933652 CCCACAGTTCTGTCCTCCACACC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1156419304 18:36933658-36933680 GGTTGGGCACCAGCTGTTCTAGG 0: 1
1: 1
2: 5
3: 18
4: 173
1156419294_1156419306 7 Left 1156419294 18:36933630-36933652 CCCACAGTTCTGTCCTCCACACC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1156419306 18:36933660-36933682 TTGGGCACCAGCTGTTCTAGGGG 0: 1
1: 0
2: 4
3: 11
4: 114
1156419294_1156419305 6 Left 1156419294 18:36933630-36933652 CCCACAGTTCTGTCCTCCACACC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1156419305 18:36933659-36933681 GTTGGGCACCAGCTGTTCTAGGG 0: 1
1: 0
2: 0
3: 14
4: 114
1156419294_1156419308 14 Left 1156419294 18:36933630-36933652 CCCACAGTTCTGTCCTCCACACC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1156419308 18:36933667-36933689 CCAGCTGTTCTAGGGGATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1156419294_1156419309 15 Left 1156419294 18:36933630-36933652 CCCACAGTTCTGTCCTCCACACC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 107
1156419294_1156419310 25 Left 1156419294 18:36933630-36933652 CCCACAGTTCTGTCCTCCACACC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1156419310 18:36933678-36933700 AGGGGATCCAGGGTGCTTCCTGG 0: 1
1: 0
2: 2
3: 28
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156419294 Original CRISPR GGTGTGGAGGACAGAACTGT GGG (reversed) Intronic
900842456 1:5065169-5065191 GGTATGGATTACAGCACTGTTGG + Intergenic
902867368 1:19288379-19288401 GGTGGGGGGGACAAAACTTTGGG + Intronic
903164517 1:21510772-21510794 GGTGGGGAGGACTAAACAGTTGG - Intronic
904343379 1:29852503-29852525 GGAGTGGAAGACAGAACTCCAGG - Intergenic
904870360 1:33613878-33613900 GGTGTGGAGGACATCAGTGTGGG - Intronic
905791891 1:40794098-40794120 TGTGTGGAGCACTGAGCTGTGGG + Intronic
906500867 1:46341215-46341237 GGAGTGGGGGACAGAAAGGTAGG - Intronic
908779867 1:67680489-67680511 GGTGTGGGGGGCTGAACAGTGGG + Intergenic
909476251 1:76084193-76084215 GATGGGGAGGACACACCTGTTGG + Intronic
910462207 1:87459647-87459669 GGTGTAGAGGGCAGAGCAGTGGG + Intergenic
911786877 1:101962173-101962195 GGGGTGATGGATAGAACTGTAGG + Intronic
912812220 1:112803084-112803106 GGAGAGGAGGGCAGGACTGTGGG - Intergenic
914376440 1:147077514-147077536 GATTTGGAGGACAGAACAGAAGG + Intergenic
914845520 1:151281804-151281826 GGAGTGGAGCACAGAAGTGTAGG - Exonic
915038553 1:152948716-152948738 GGGGTGGGGGACAGCACTGCTGG - Intergenic
915409841 1:155691963-155691985 AGTGTGGAGATCAGAACTCTGGG - Intronic
917929042 1:179811362-179811384 GGTGTGGGGGACAGAAGACTGGG + Intronic
918181459 1:182088489-182088511 GGTGGGGAGGACAGAGCTGGAGG - Intergenic
919526112 1:198652878-198652900 GGTGTGGATGAAAGAACTATTGG + Intronic
919975341 1:202607119-202607141 GGTGGAGAGGACAGAATTATGGG - Intronic
922336984 1:224625705-224625727 GGTGTGGAGGAGGGCACTGCTGG + Intronic
922573862 1:226649199-226649221 GGTGCAGAGGAGAGAGCTGTGGG - Intronic
1064447161 10:15406044-15406066 TGTGTGGATGTCAGAATTGTGGG + Intergenic
1066448162 10:35503045-35503067 GGTATGCAGGTTAGAACTGTGGG - Intronic
1066795173 10:39112321-39112343 AGTGTGGAGACCAGAACTCTGGG + Intergenic
1067208464 10:44239340-44239362 GGTGGGGAGGGCAGGACTGAGGG - Intergenic
1067451848 10:46386574-46386596 GGTGTGGAGGTGAGAGCTGCAGG - Intronic
1067585390 10:47473181-47473203 GGTGTGGAGGTGAGAGCTGCAGG + Intronic
1067816574 10:49482043-49482065 GCTGTGGATGCTAGAACTGTGGG - Intronic
1068530136 10:58176220-58176242 GGTGTGGATTACAGAACTTTGGG - Intergenic
1069421719 10:68252446-68252468 GGAGTGGAGGACAGGACAGCAGG + Intergenic
1071177392 10:82942240-82942262 TGTATGGAGGACAGAGGTGTGGG - Intronic
1072798871 10:98377918-98377940 GATGTGGTGGACAGACCTGTAGG - Intergenic
1073376848 10:103042413-103042435 GCTGTGGAGAACATAACAGTAGG - Intronic
1074442456 10:113490464-113490486 AGTCTGGAGGACATGACTGTGGG + Intergenic
1075337643 10:121619920-121619942 GGTTTGGAGCTCAGAACTGAAGG - Intergenic
1076167486 10:128294093-128294115 GGTGTGGAGGACACAACGTTGGG - Intergenic
1076327274 10:129635300-129635322 AGTTTGCAGGACAGAACTGGAGG - Intronic
1077526302 11:3067788-3067810 GGGTTGGAGGAAAGAAGTGTGGG - Intergenic
1077664029 11:4092488-4092510 TGAGTGGATGCCAGAACTGTAGG + Exonic
1078760816 11:14249961-14249983 GGTGTGGAGGAAAGAACCCAGGG - Intronic
1079057958 11:17223744-17223766 GGTGTGGAGGAAAGAAGTAAAGG - Intronic
1080116632 11:28628722-28628744 GATGTGGAGGAAAGAACATTGGG + Intergenic
1081030837 11:38080764-38080786 GCTGTAGAAGACAGAGCTGTAGG - Intergenic
1084316156 11:68347080-68347102 GGGGTGGTGGAGAGAAGTGTAGG + Intronic
1084783165 11:71424677-71424699 GGTCTGTAGGACAGAGCTTTGGG + Intergenic
1085339422 11:75721698-75721720 GGTGTGGAGGTCAGAGCAGCAGG - Intronic
1087592528 11:100209251-100209273 GATGTGGAGGAGAGAGGTGTAGG + Intronic
1089209761 11:116791994-116792016 GCTGGGGAGCACAGAGCTGTTGG + Intronic
1093074407 12:14742727-14742749 AGTGTGGAAGAAAGATCTGTGGG + Intergenic
1094672121 12:32580542-32580564 GGAATGGAGCACAAAACTGTGGG - Intronic
1096456981 12:51795571-51795593 GCTCTGGAGGACAGAACTAGAGG - Intronic
1096635130 12:52953310-52953332 GGGTTGGAGGAAAAAACTGTGGG - Intergenic
1097818227 12:64098931-64098953 GGTGGGGAGGACAGAGTTGTGGG - Intronic
1098588239 12:72181217-72181239 GGGGTGAAGGAAAGAAATGTTGG + Intronic
1099221285 12:79917995-79918017 GGAGTGGATCACAGAACTGTTGG - Intronic
1101126527 12:101640853-101640875 GGTGTGGTGGCCAGCACTTTGGG + Intronic
1101571425 12:105957322-105957344 GGTGTAGAAGAAAGAACTGAAGG + Intergenic
1102030686 12:109738482-109738504 GGGATGGAGGTGAGAACTGTGGG + Intronic
1102701754 12:114845306-114845328 GGGGTGGAGAGCAGATCTGTGGG + Intergenic
1102910899 12:116713132-116713154 GGGGAGGAGGGCAGTACTGTGGG - Exonic
1103321268 12:120093956-120093978 GGGGTGGAGGAGGGAGCTGTGGG - Exonic
1103851164 12:123934456-123934478 GGTGGGCAGGACAGAAATGCTGG + Exonic
1104447271 12:128844640-128844662 GCTCTGGAGGACAGAAGTCTGGG - Intergenic
1104447282 12:128844694-128844716 GCTCTGGAGGACAGAAGTCTGGG - Intergenic
1104492926 12:129209882-129209904 GGGGTGGAGGACAGAAAAGGTGG + Intronic
1110145912 13:72189650-72189672 GGAGTGGAGGAAAAAAATGTAGG + Intergenic
1113801375 13:113088179-113088201 GGAGAGGAGGAAAGCACTGTGGG - Intronic
1113818760 13:113195323-113195345 GGTGTGGAGCACCGCATTGTGGG - Intronic
1114460510 14:22883449-22883471 GGTGGGGAGGTCAGAACTAGGGG + Intronic
1115067036 14:29275940-29275962 GGTGGGAAAGACAGAAGTGTTGG - Intergenic
1119531552 14:75364943-75364965 GGTTTGGAGACCAGAACTGTAGG + Intergenic
1119859167 14:77924116-77924138 GGTATGGAGGAGAGAAATGGGGG + Intronic
1121028952 14:90641366-90641388 GGAGTGGAGGACATAGCTGATGG - Intronic
1121719915 14:96101970-96101992 GGTGTGGAGCCCAGGACAGTGGG - Intergenic
1122135657 14:99631468-99631490 GGTGTTGGGGCCAGGACTGTAGG - Intergenic
1123125171 14:105941109-105941131 GGAGTAGAGGGTAGAACTGTAGG - Intergenic
1124490997 15:30155462-30155484 GGTGGAGAGGACAGAATTATGGG - Intergenic
1125050754 15:35295637-35295659 GGGGTGGAGGAAAGGATTGTTGG - Intronic
1125522161 15:40354389-40354411 GGTCTGGAGGACATGACAGTGGG - Intronic
1127531752 15:59850296-59850318 GGAGTGGAGGACAGCTCTGTGGG + Intergenic
1128650614 15:69410136-69410158 GGTGGGGAGAAGAGAACTGAGGG - Intergenic
1129250574 15:74306695-74306717 GGTGTGGAGGAAAGAATGGATGG + Intronic
1129665330 15:77576374-77576396 GGGGAGGAGGACAGGCCTGTAGG + Intergenic
1129825602 15:78633075-78633097 GGGCTGGAGGACAGAACAGAGGG - Intronic
1131151801 15:90051949-90051971 GGGGTGGAGGACAGGTCTGCTGG + Intronic
1131998557 15:98157168-98157190 AGTGTTGGGGACAGAGCTGTTGG - Intergenic
1132404761 15:101535614-101535636 GGTGTGCAGGACAGGCCAGTGGG + Intergenic
1133364014 16:5196792-5196814 GGTGTGCAGGAAGGAGCTGTGGG - Intergenic
1133995672 16:10746142-10746164 GGGGAGGAGGACAGCAGTGTTGG + Intronic
1139673653 16:68508743-68508765 GGCGTGGAGGACAGCACTTGGGG - Intergenic
1140082739 16:71764947-71764969 GCTGTGGAGTACTGAAGTGTGGG - Intronic
1141755950 16:85991061-85991083 GGTGCGGGTGACAGAACTGGGGG + Intergenic
1142046792 16:87930614-87930636 GGTGGGGAGGAGAGAGCGGTGGG + Intronic
1142107921 16:88316145-88316167 GGTGAGGAGGACGGACCTGGGGG - Intergenic
1143621421 17:8082691-8082713 AGTGTGGAGACCAGAACTCTGGG + Intronic
1143943019 17:10562548-10562570 ATTGTGGAAGACAGAACTGGAGG - Intergenic
1144128685 17:12225252-12225274 GTTATGGGGGAGAGAACTGTTGG - Intergenic
1145271257 17:21406068-21406090 GGGGTGGGGGCCAGAAGTGTGGG - Intronic
1145309460 17:21693455-21693477 GGGGTGGGGGCCAGAAGTGTGGG - Intronic
1146320979 17:31846176-31846198 GGGGTCGAGGACAGAACTTTGGG - Intergenic
1146552929 17:33797746-33797768 TGTTTGGAGGACTGAAATGTGGG + Intronic
1147899465 17:43774576-43774598 GGGGTGAACGACAGAGCTGTAGG - Intronic
1150857061 17:68763369-68763391 GGAGTGGAGGACAAAGCTGATGG + Intergenic
1151517155 17:74604059-74604081 GGCCAGGAGGCCAGAACTGTTGG - Intergenic
1152431813 17:80252501-80252523 GGTGTGCAGGAAGGAGCTGTGGG - Intronic
1154162493 18:11990543-11990565 CGTGTGGAGGGCAGAATTGCAGG + Intronic
1155394891 18:25376849-25376871 GGTGTGGCGGAGAGAACAGAAGG + Intergenic
1156419294 18:36933630-36933652 GGTGTGGAGGACAGAACTGTGGG - Intronic
1157587730 18:48815796-48815818 GGTGTGGGGGACTGGGCTGTGGG + Intronic
1157955089 18:52087947-52087969 GGTTTGGAGGACTGGAATGTGGG + Intergenic
1158230521 18:55249438-55249460 GCTGTGGAGGACAGGTGTGTGGG + Intronic
1158788421 18:60744144-60744166 GGAGTGTAGGACATAGCTGTTGG - Intergenic
1159194391 18:65093644-65093666 GAAGAGGAGGACAGAAATGTTGG + Intergenic
1161347145 19:3774131-3774153 GATGGGGAGGACAGAAGGGTGGG + Intergenic
1161579542 19:5073291-5073313 CGTGTGGACGACAGAGGTGTGGG - Intronic
1162066333 19:8127547-8127569 GGTGTGGAAGACAGTCTTGTGGG - Intronic
1162966918 19:14160471-14160493 GGTCTGGAAGGCAGGACTGTGGG - Intronic
1163408062 19:17136003-17136025 GGTGGGGGGGACAGTCCTGTTGG - Intronic
1163846587 19:19641780-19641802 GGTCTGGAGGCCAGGACAGTGGG - Intronic
1165076281 19:33281549-33281571 GGCGTGGAGGCCAGCTCTGTGGG + Intergenic
1165490662 19:36121124-36121146 GGTGTGGAGGGCAGGACAGGTGG + Intronic
1167135919 19:47615460-47615482 GGTGTGGAGGTCAGGAGCGTGGG + Intronic
1168115613 19:54220157-54220179 GGTGTGGAGGGCGGCCCTGTGGG + Exonic
1168118600 19:54239903-54239925 GGTGTGGAGGGCGGCCCTGTGGG + Exonic
925178013 2:1798423-1798445 GGAGCGGAGGAAAGAACGGTAGG - Intronic
925364763 2:3304381-3304403 GGAGTGGAGGGCTGAACTGCAGG - Intronic
925364791 2:3304495-3304517 GGAGTGGAGGGCTGAACTGATGG - Intronic
925364949 2:3305138-3305160 GGAGTGGAGGGCTGAACTGATGG - Intronic
925365005 2:3305367-3305389 GGAGTGGAGGGCTGAACTGATGG - Intronic
925365032 2:3305481-3305503 GGAGTGGAGGGCTGAACTGACGG - Intronic
925574030 2:5341524-5341546 TTTGGGGAGGACAGAACTTTGGG - Intergenic
925751648 2:7095096-7095118 GGTGCCCAGGACAGAAATGTGGG - Intergenic
932682294 2:73836511-73836533 GGGGTGGAGGAGGGAGCTGTGGG + Intronic
933835939 2:86245599-86245621 AGTGTGGAGACCAGAACTCTGGG + Intronic
934745397 2:96756381-96756403 GGAGTGGAGGAGAAACCTGTTGG - Intergenic
937426665 2:121805613-121805635 GGTGTGGAGTCCAGCACTGGTGG + Intergenic
940736423 2:157458181-157458203 TGTGTTGAGGACTGAACTTTGGG - Intronic
945824840 2:214709017-214709039 GGTGTGGCTGACAGAACTAGTGG + Intergenic
946879250 2:224160949-224160971 GGTGAGGAGGAGAGGACTGTGGG + Intergenic
947791736 2:232872677-232872699 GGTGTGGAGGACGGAACTCACGG - Intronic
948127697 2:235576828-235576850 GGTGTGAAGGGCAGAAAGGTGGG + Intronic
948417221 2:237818773-237818795 GGAGAGGAGGATAGAACTGGTGG - Intronic
948537879 2:238659621-238659643 AGTGTGGAGACCAGAACTCTGGG + Intergenic
1169040640 20:2492324-2492346 GGTGAGGAGGTTAGAACTGTAGG - Intronic
1169220260 20:3818501-3818523 TGTGTGGAGGAGACAGCTGTGGG - Intergenic
1170282872 20:14670802-14670824 GGTGTGGTAGAAAGAACAGTTGG - Intronic
1170613741 20:17933476-17933498 GGTGTGCAGGAAGGAACTGCAGG + Intergenic
1170706584 20:18749377-18749399 GGTGTGGAGGAAAGCTGTGTTGG + Intronic
1171035059 20:21707441-21707463 GGAGTGGGGGACAGAACCCTTGG - Intronic
1171133829 20:22678725-22678747 GGTATGGAAAACAGAACAGTGGG - Intergenic
1172035824 20:32010288-32010310 GGTGTGGAGGACACAGCCTTGGG - Intergenic
1173991944 20:47310269-47310291 GGTGTGGAGGAACCAAGTGTGGG + Intronic
1174983224 20:55420899-55420921 GGTGTTCAGTACAGATCTGTTGG + Intergenic
1175285624 20:57834815-57834837 GCTGTGGAGCACACAGCTGTGGG - Intergenic
1175571580 20:60026766-60026788 GGTCTGTAGGTCAGAAGTGTGGG - Intronic
1176054940 20:63140234-63140256 TGTGTGGAGGAAAACACTGTGGG + Intergenic
1181527200 22:23496702-23496724 GGTGAGGAGGCCAGAGGTGTGGG + Intergenic
1182522347 22:30891633-30891655 GGTGTGGTGGCCAGACCTGGGGG + Intronic
1183068233 22:35378323-35378345 AGTGTGGTGGTCAGGACTGTGGG + Intergenic
1185096102 22:48806908-48806930 GGAGTGGAGGAAAGAATTGTGGG - Intronic
950363186 3:12464222-12464244 GGTGTGGAAGACAGAAATAGTGG - Intergenic
951522053 3:23619459-23619481 GATGTGGGTGATAGAACTGTAGG - Intergenic
953234895 3:41097626-41097648 TGTGTTGAGAATAGAACTGTAGG - Intergenic
954305342 3:49722574-49722596 GGTGTGTAGGAGACAGCTGTTGG - Exonic
954427941 3:50453491-50453513 GGTGTGAAGGACAGGGCTGGGGG - Intronic
955688561 3:61567879-61567901 GAGGTGGAGGACAGGACTTTGGG + Intronic
962755686 3:138464115-138464137 AGTGTGGAGGCCAGGGCTGTGGG + Intronic
966425740 3:179777951-179777973 AGTGTGGGAGACAGAACTGGAGG + Intronic
966837007 3:184057021-184057043 TGTGTAGAGGAAAGAACTGAAGG - Exonic
967356134 3:188573802-188573824 CATGTGGAGGACAGAATTGAAGG + Intronic
968236856 3:197036966-197036988 GGTGGGGAGGACACAACACTTGG + Intergenic
969940274 4:10725013-10725035 GGTGAGGAGGAGAGGCCTGTGGG + Intergenic
970177407 4:13353392-13353414 GGGGTAGAGGACAGAACTGCTGG + Intergenic
970795574 4:19908747-19908769 GGTTTGGAGGAGAAAAATGTTGG - Intergenic
971126330 4:23759262-23759284 AGTGTGGAGGACAGACCGGATGG - Intronic
974365614 4:60945395-60945417 TGTGTGAAGGACATAACTTTTGG - Intergenic
976009957 4:80475137-80475159 GGAGTGGAGGCCAGAACAGTAGG + Intronic
979351560 4:119649738-119649760 GGTGTGGTTGACAGAATAGTGGG + Intergenic
981935976 4:150240360-150240382 GGTGAGGGGGAGAGAACTGATGG - Intronic
982888051 4:160808628-160808650 GGAATGGAGAACATAACTGTTGG - Intergenic
984363579 4:178769957-178769979 GATGTAGAGGAGAGAACTGGTGG - Intergenic
984621183 4:181953940-181953962 GCTGGGGAGGACAGATGTGTAGG - Intergenic
985606028 5:858476-858498 GATGAAGAGGACAGACCTGTGGG - Intronic
986767421 5:10940365-10940387 GGTGTGGAGGTCAGTACTGTGGG - Intergenic
987496707 5:18653897-18653919 CCTGTGGAGGGCAGAATTGTTGG + Intergenic
988486905 5:31674915-31674937 GGGGTGGAGGACTCAAGTGTGGG + Intronic
989202583 5:38779155-38779177 AGTCTGGAGGACAGAAATCTGGG - Intergenic
996058789 5:119009902-119009924 GGTGAGCAGGAGAGACCTGTTGG + Intergenic
997680032 5:135743663-135743685 GGGGAGGAGGACAGCAGTGTTGG - Intergenic
997711453 5:136008267-136008289 GGAGTGGAGGGCTGAAGTGTAGG + Intergenic
997734310 5:136202215-136202237 GGTGTGGGACTCAGAACTGTGGG + Intergenic
999508523 5:152223589-152223611 GGTGATGAGGTCAGAAATGTTGG - Intergenic
1001141339 5:169146531-169146553 GGTGTGGAGGTCAGAAGGGATGG - Intronic
1001774995 5:174321835-174321857 GGTGTGGAAGTCAGAGCTGAGGG + Intergenic
1002423565 5:179163072-179163094 AGTGTGTAGGACAGAGCTGCGGG + Intronic
1003042144 6:2698268-2698290 GCAGTAGAGGACAGAGCTGTAGG - Intronic
1004678014 6:17863245-17863267 GGGGTGGAGGACAGAAAGGGTGG + Intronic
1005447943 6:25944579-25944601 GATTTAGAGAACAGAACTGTGGG - Intergenic
1005517227 6:26566251-26566273 TGTGTGGAGAACAGAACCGAGGG + Intergenic
1006223225 6:32513229-32513251 AGTGTGGAGACCAGAACTCTGGG + Intergenic
1007227787 6:40327100-40327122 GGTGGGGAAGCCAGAACTGGGGG + Intergenic
1007337097 6:41161890-41161912 GATGTGCAGAACAGAACTGGAGG - Intronic
1007997293 6:46321779-46321801 GGTGTGGAGAACTGAAGTGTTGG + Intronic
1008657532 6:53631006-53631028 GCTGTGGTGGACAGGGCTGTAGG - Intergenic
1008690950 6:53977865-53977887 GGTGTGGTAGACAGAAATGCTGG + Intronic
1010495510 6:76530316-76530338 TGTCTTGAAGACAGAACTGTTGG + Intergenic
1010793297 6:80089887-80089909 GGTGGGGAGGCCAGAAATGGGGG + Intergenic
1013808446 6:114018211-114018233 AGTGTGGAGACCAGAACTCTGGG + Intergenic
1014236299 6:118959237-118959259 GGGGTTGAGGATAGAACTTTGGG - Intergenic
1014976668 6:127893539-127893561 GATGTGAAGCACAGAATTGTGGG - Intronic
1015345101 6:132147173-132147195 GGTGGGGAGGAGAGGACTTTTGG + Intergenic
1015571409 6:134624948-134624970 GAGGTGCAGGACAGCACTGTGGG - Intergenic
1017589328 6:155961565-155961587 GGTGTAGAAAACAGAAATGTGGG + Intergenic
1018574503 6:165245087-165245109 GGTGTGAAGGAAAGAACTTTGGG + Intergenic
1021111324 7:16697877-16697899 GGTGAGGGGAACAGAACAGTAGG - Intronic
1022904514 7:34842875-34842897 AGAGTGGAGGAGAGAACTGAAGG - Intronic
1023028842 7:36075703-36075725 GGAGTGGAGGACAGAACAAAAGG + Intergenic
1023905798 7:44520948-44520970 GCTGGGGAGGACAGACATGTGGG - Intronic
1024308225 7:47945931-47945953 TGAGTGGAGGACACACCTGTTGG - Intronic
1026486528 7:70826357-70826379 AGTGTTGAGGACAAAACAGTGGG - Intergenic
1028623291 7:92847813-92847835 AGTGAGGAAGACAGACCTGTAGG - Intergenic
1031080092 7:117249710-117249732 GGAGTAGAGGACAGAAATGTTGG - Intergenic
1031204794 7:118742967-118742989 GGGATGGAGGACAGAAGTTTGGG + Intergenic
1033973591 7:147072463-147072485 GGTGTAGAGGACAGGTCTGAAGG + Intronic
1034764036 7:153700887-153700909 TGTATGGAGGACAGTGCTGTAGG - Intergenic
1036565068 8:9931541-9931563 GGTGTGGTGCACACACCTGTAGG - Intergenic
1037205678 8:16316901-16316923 GGTGTGGAGGAGAAAAACGTGGG + Intronic
1038023750 8:23571399-23571421 GGTGTGGAGGACCGAGGGGTTGG + Exonic
1041215886 8:55599689-55599711 GGAGTTGAGGACAGAGTTGTGGG + Intergenic
1041389820 8:57338421-57338443 GCTGTGGGGGACAGAAATGCAGG + Intergenic
1042939029 8:74089035-74089057 GGTGCAGAGGAAAGAACTGCTGG + Intergenic
1044015972 8:87049190-87049212 GGTGTGGATGACATAACTGAGGG - Intronic
1044494297 8:92858751-92858773 GGTGTGGAGGAGAAATCTGAAGG - Intergenic
1047179523 8:122573789-122573811 GGTGGGAAGCACAGAACTCTGGG - Intergenic
1048475490 8:134738855-134738877 GCTGTGGAGCAGAGAACAGTGGG + Intergenic
1049323995 8:142012346-142012368 GGAGGGGAGGGCAGCACTGTTGG - Intergenic
1049717350 8:144099211-144099233 GGGGTGGAGCTCAGGACTGTGGG + Intronic
1050330917 9:4545307-4545329 GCAGTGGTGGACAGAGCTGTAGG - Intronic
1052673576 9:31589720-31589742 TATTTGGAGGACAGAAATGTGGG + Intergenic
1053437129 9:38083374-38083396 TGTCTGAAGGAGAGAACTGTTGG + Intergenic
1056378332 9:86035526-86035548 GTGGTGGAAGACAGACCTGTAGG - Exonic
1056945296 9:90990020-90990042 ACTCTGGTGGACAGAACTGTAGG - Intergenic
1057116073 9:92523537-92523559 CGTGTGGAGACCAGAACTCTGGG - Intronic
1060268911 9:122127759-122127781 GGGCTGGTGAACAGAACTGTGGG + Intergenic
1060275696 9:122180708-122180730 GGAGTGGAGGACAGAAGAGATGG - Intronic
1061259497 9:129472119-129472141 GGTGAGGAGGCCAGAAGTATAGG - Intergenic
1186323059 X:8451586-8451608 GGTTTGGAGGAAAGAGCTGAGGG + Intergenic
1186607810 X:11110253-11110275 ATTGTGGGAGACAGAACTGTGGG + Intergenic
1188629288 X:32332238-32332260 GGTGTTGAGGACACAGCAGTGGG + Intronic
1189698182 X:43687482-43687504 GGTTTGAAGGACAGCACTGATGG + Intronic
1192233951 X:69284552-69284574 TGTGTGCATGACAGAACTGGGGG - Intergenic
1196900247 X:120375503-120375525 GGTCTGGAGGACCCAACTTTTGG + Exonic
1196920486 X:120580481-120580503 GATGAGGAGGAGAGAACTGGGGG + Intergenic
1198634644 X:138682501-138682523 GGTTTGGAAGACTGCACTGTAGG - Intronic
1199743653 X:150758251-150758273 GGTGTGGAGGGGAGACCTGAGGG - Intronic
1200090841 X:153635235-153635257 GGTGTGGAGGGAAGAACTTTGGG + Intergenic