ID: 1156419295

View in Genome Browser
Species Human (GRCh38)
Location 18:36933631-36933653
Sequence GGGTGTGGAGGACAGAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 425}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156419295_1156419306 6 Left 1156419295 18:36933631-36933653 CCACAGTTCTGTCCTCCACACCC 0: 1
1: 0
2: 3
3: 53
4: 425
Right 1156419306 18:36933660-36933682 TTGGGCACCAGCTGTTCTAGGGG 0: 1
1: 0
2: 4
3: 11
4: 114
1156419295_1156419310 24 Left 1156419295 18:36933631-36933653 CCACAGTTCTGTCCTCCACACCC 0: 1
1: 0
2: 3
3: 53
4: 425
Right 1156419310 18:36933678-36933700 AGGGGATCCAGGGTGCTTCCTGG 0: 1
1: 0
2: 2
3: 28
4: 303
1156419295_1156419308 13 Left 1156419295 18:36933631-36933653 CCACAGTTCTGTCCTCCACACCC 0: 1
1: 0
2: 3
3: 53
4: 425
Right 1156419308 18:36933667-36933689 CCAGCTGTTCTAGGGGATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1156419295_1156419309 14 Left 1156419295 18:36933631-36933653 CCACAGTTCTGTCCTCCACACCC 0: 1
1: 0
2: 3
3: 53
4: 425
Right 1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 107
1156419295_1156419304 4 Left 1156419295 18:36933631-36933653 CCACAGTTCTGTCCTCCACACCC 0: 1
1: 0
2: 3
3: 53
4: 425
Right 1156419304 18:36933658-36933680 GGTTGGGCACCAGCTGTTCTAGG 0: 1
1: 1
2: 5
3: 18
4: 173
1156419295_1156419305 5 Left 1156419295 18:36933631-36933653 CCACAGTTCTGTCCTCCACACCC 0: 1
1: 0
2: 3
3: 53
4: 425
Right 1156419305 18:36933659-36933681 GTTGGGCACCAGCTGTTCTAGGG 0: 1
1: 0
2: 0
3: 14
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156419295 Original CRISPR GGGTGTGGAGGACAGAACTG TGG (reversed) Intronic
900091058 1:920931-920953 GGGTGGGGAGGAGAGAGATGGGG - Intergenic
900300632 1:1975106-1975128 GGGTGTCTAGGACAGAGCTGTGG - Intronic
900307556 1:2018737-2018759 GGGTGTGGAGGGCGGGCCTGGGG + Intergenic
900784819 1:4642426-4642448 GTGTGTTCTGGACAGAACTGTGG + Intergenic
902055667 1:13598664-13598686 GGCTGAGGAGGACAGAGATGGGG - Intronic
902180461 1:14684521-14684543 GGTTCTGGAGGCCAGAAGTGTGG + Intronic
902392728 1:16115753-16115775 GGGTGAGGAGGAGAGCCCTGGGG - Intergenic
902719058 1:18292095-18292117 GGGCTTGGAAGGCAGAACTGGGG + Intronic
902792456 1:18778532-18778554 GGGCACGGAGGACAGAAATGAGG - Intergenic
903350293 1:22712715-22712737 GGGTGTGGAGGGCAGCCCTGGGG + Intronic
903350657 1:22714509-22714531 GGGTGTTGAGGGCAGCAGTGGGG + Intronic
903769926 1:25757396-25757418 GGCTGTGGTGGACAGAGGTGGGG - Intronic
903876552 1:26478353-26478375 GGGTGTGGTGGCCAGCACTTTGG - Intergenic
903950727 1:26994459-26994481 GGGCGTGGAGGTCAGCGCTGCGG - Exonic
903958022 1:27038491-27038513 GGGTTTGGAAGGCAGAAGTGAGG + Intergenic
903999689 1:27331942-27331964 GGGTGGGGGGGCCAGAAGTGGGG - Intronic
904478531 1:30779713-30779735 GGGTGGGGAGGGCAGAGCGGAGG - Intergenic
904772260 1:32886797-32886819 GGGGCTGGGGGACAGAGCTGAGG + Intronic
904870361 1:33613879-33613901 GGGTGTGGAGGACATCAGTGTGG - Intronic
904910662 1:33931882-33931904 GTGTGAGCAGGAGAGAACTGGGG + Intronic
905648609 1:39641294-39641316 GGGTATGGAGTTCAGAACAGAGG + Intergenic
906524216 1:46485221-46485243 GGGTGGAGAGGGCAGAAATGAGG + Intergenic
906610555 1:47198974-47198996 GAGTCTGGAGGTCAGAACTGAGG + Intergenic
907442384 1:54487205-54487227 GGGAGAGGAAGACAGAACTTGGG - Intergenic
908565217 1:65347428-65347450 GGGTGAGGAGGATGGAATTGAGG - Intronic
910282914 1:85521328-85521350 GGGTGTGGAGGGCAATAATGAGG - Intronic
910462206 1:87459646-87459668 GGGTGTAGAGGGCAGAGCAGTGG + Intergenic
913158266 1:116121581-116121603 GGGTGGGGTGGAGGGAACTGAGG + Intronic
914207099 1:145541665-145541687 GGGTGTGGAGGGCAATAATGAGG + Intergenic
914959159 1:152190903-152190925 TGGTGTGGAGGATAGAAATGAGG + Intergenic
915098377 1:153480350-153480372 GGGTGGGGAGGACTCAATTGGGG - Intergenic
915473235 1:156138030-156138052 GGGAGGGGAGGACAGACGTGGGG + Intronic
915571754 1:156748764-156748786 GGGTGTGGTGGTCAGAACCCTGG - Intronic
915591590 1:156874094-156874116 GGGTAAGGAGGCCAGAACAGCGG - Intronic
916164574 1:161954335-161954357 GGGTGTGGGGTACACAAGTGTGG - Intronic
922025762 1:221747078-221747100 AGGTGTGGAGGACAAGATTGTGG - Intergenic
922445802 1:225696214-225696236 GGGGGTGGAGGAGAGAATGGAGG + Intergenic
924379623 1:243450321-243450343 TGGTGTGGTGGAAAGAACTGAGG - Intronic
1063968171 10:11362993-11363015 GTGAGAGAAGGACAGAACTGAGG + Intergenic
1064012399 10:11744947-11744969 GAGTGTGGAGGACAGAATTCAGG + Intronic
1064984305 10:21194699-21194721 GATTGTGCAGGACAGATCTGGGG - Intergenic
1065162906 10:22941758-22941780 GGGTGAGGAGGAAAGAAAGGGGG + Intronic
1065929628 10:30468235-30468257 GCTTCTGGAGAACAGAACTGGGG - Intergenic
1066364114 10:34760180-34760202 GGGTGTGGGGGACAGCGCAGCGG + Intronic
1066748686 10:38630319-38630341 GGGGGAGGAGGGTAGAACTGGGG + Intergenic
1066967987 10:42287458-42287480 GGGGGAGGAGGGTAGAACTGGGG - Intergenic
1067208465 10:44239341-44239363 GGGTGGGGAGGGCAGGACTGAGG - Intergenic
1067313118 10:45133853-45133875 GAGTTTGGAGGACAGAACAGGGG + Intergenic
1068530137 10:58176221-58176243 AGGTGTGGATTACAGAACTTTGG - Intergenic
1068629566 10:59285290-59285312 GAGTGTGGAAGCAAGAACTGAGG + Intronic
1069893665 10:71667279-71667301 GGGTGTGGAGGAGACCACAGGGG + Intronic
1070850977 10:79561274-79561296 TGGTGTGGCAGACAGCACTGGGG - Intergenic
1070856222 10:79610000-79610022 TGGTGTGGCAGACAGCACTGGGG + Intergenic
1071334534 10:84590037-84590059 GGCTGTGGAGGGGAGACCTGAGG - Intergenic
1072423711 10:95311147-95311169 GGAGGTGGAGGACAGAACCCAGG + Intergenic
1072904083 10:99434633-99434655 GGGAGGGAAGGAGAGAACTGAGG - Intergenic
1073149718 10:101303454-101303476 GGGTGAGGAGGAGAGAGCTGGGG + Intergenic
1073607725 10:104913173-104913195 GAGTGAGGTGGACAGATCTGGGG + Intronic
1074851845 10:117445371-117445393 GGGTGTGGTGGACAGAATGATGG - Intergenic
1076000218 10:126907203-126907225 GTGTGTAGAGGAGAGAGCTGAGG + Intronic
1076049438 10:127320925-127320947 GGCTGTGAAGGACAAAACAGAGG - Intronic
1076167487 10:128294094-128294116 TGGTGTGGAGGACACAACGTTGG - Intergenic
1076228425 10:128799774-128799796 GGAAGTGGTGGTCAGAACTGGGG + Intergenic
1076603257 10:131673152-131673174 GGGAGTGGGGGACAGAGGTGAGG - Intergenic
1076614807 10:131748254-131748276 TGATGTGGAGGACAGGGCTGCGG + Intergenic
1076736716 10:132462321-132462343 GGGGTTGGGGGACAAAACTGAGG + Intergenic
1077078605 11:712645-712667 AGGTGTGGAGGACAGCAAGGGGG - Intronic
1077139899 11:1019666-1019688 GGCTGTGGTGGCCAGAGCTGGGG + Intronic
1077162380 11:1119655-1119677 GGCTGTGGGGGACAGAACTTGGG + Intergenic
1077189823 11:1251249-1251271 GGCTGTGGTGGTCAGCACTGTGG - Exonic
1077211778 11:1374495-1374517 GGGTGGGGAGGACAGCACCCAGG - Intergenic
1077526303 11:3067789-3067811 GGGGTTGGAGGAAAGAAGTGTGG - Intergenic
1078575104 11:12494818-12494840 GGGTGGGGAGGAGAGGAGTGAGG - Intronic
1078760817 11:14249962-14249984 TGGTGTGGAGGAAAGAACCCAGG - Intronic
1079662988 11:23065131-23065153 GGATGTGGAGGACAACATTGAGG - Intergenic
1080398974 11:31916391-31916413 GGGTGAGAAGGACAGAGCTATGG - Intronic
1081706486 11:45184847-45184869 GGGTGTGGAGCGCAGAACCTAGG + Intronic
1083433841 11:62629534-62629556 GGGTGTGAAGGCCAGATCTCAGG - Intronic
1083957475 11:65993135-65993157 GGGTGTGGAGGACTGGGGTGGGG - Intergenic
1084014108 11:66368670-66368692 GGCTGTGGAGGACAGGGATGGGG + Exonic
1084087269 11:66860343-66860365 TGGTCTGGAGGCCAGAACCGAGG - Exonic
1084594066 11:70106785-70106807 TGGTGTGGAGGAGAGGAGTGGGG - Intronic
1084783164 11:71424676-71424698 GGGTCTGTAGGACAGAGCTTTGG + Intergenic
1086120736 11:83302366-83302388 GGCTGTGGAGCCGAGAACTGGGG - Intergenic
1087152213 11:94869261-94869283 GGCTATGGAGGACAGTGCTGAGG - Exonic
1088672123 11:112152408-112152430 GGGTGAGGAGGACAAAATTAAGG - Intronic
1089255195 11:117190403-117190425 GGGTGGGCCAGACAGAACTGGGG - Intronic
1089770463 11:120798838-120798860 GGGTCTGTAGGACAAAACTAAGG - Intronic
1089784491 11:120898403-120898425 GGGTGTGGAGTACGGAGCCGGGG - Intronic
1090076887 11:123585224-123585246 GGCTGTGAAGGACAGAGCTGAGG + Intronic
1090255989 11:125284809-125284831 GGGGGTGGAGGACAGCAGGGGGG - Intronic
1090265711 11:125351637-125351659 TGGGGTGGAGGCCAGGACTGTGG - Intronic
1091203069 11:133797517-133797539 CTGTGTGGAGGACAGATCTCAGG + Intergenic
1091838523 12:3602804-3602826 GGGGATGGGGGACAGAGCTGGGG - Intergenic
1092046132 12:5432845-5432867 GGGGGTGGCAGACAGAACTCCGG + Intronic
1092219238 12:6701297-6701319 AGGGGTGGAGGAAAGGACTGGGG + Intergenic
1094103937 12:26788788-26788810 GGCTCTGGAGGAGAGATCTGAGG - Intronic
1094672122 12:32580543-32580565 GGGAATGGAGCACAAAACTGTGG - Intronic
1095778346 12:46033338-46033360 GGGTGTGGAGGGAAGTATTGAGG - Intergenic
1096591441 12:52662562-52662584 GGGTGGGGAGGGCAGAAGTGGGG - Intergenic
1096635131 12:52953311-52953333 GGGGTTGGAGGAAAAAACTGTGG - Intergenic
1096798663 12:54094680-54094702 GGGTTTGGAGAAGAGAACAGAGG - Intergenic
1097247500 12:57614628-57614650 TGGGAAGGAGGACAGAACTGGGG + Intronic
1097264769 12:57738561-57738583 GGGCGGGGAGGACAGTAGTGGGG + Intronic
1097818228 12:64098932-64098954 TGGTGGGGAGGACAGAGTTGTGG - Intronic
1100979583 12:100153969-100153991 GGGAGGGGAGGACACAAGTGTGG - Intergenic
1102012630 12:109628017-109628039 GGGGCTGGAGGACAGAAGTTAGG - Intergenic
1102238004 12:111306850-111306872 GGGTGGGGAGGCCAGACCTGTGG + Intronic
1103556640 12:121770606-121770628 AGGTGGGGAGGACAGGAGTGAGG + Intronic
1104447272 12:128844641-128844663 GGCTCTGGAGGACAGAAGTCTGG - Intergenic
1105265306 13:18809807-18809829 GGGTGGGGAGGACAGAGATTGGG - Intergenic
1105939231 13:25132307-25132329 GTTTGGGAAGGACAGAACTGAGG - Intergenic
1110268344 13:73565323-73565345 GGGTGGGGAGGAGAGAGCTAAGG - Intergenic
1110268407 13:73565936-73565958 GGGTGAGGAGGAGAGAGCTAAGG + Intergenic
1111795574 13:92915087-92915109 GGGTGTTGAGGAAAGGCCTGTGG - Intergenic
1113801376 13:113088180-113088202 GGGAGAGGAGGAAAGCACTGTGG - Intronic
1113818761 13:113195324-113195346 GGGTGTGGAGCACCGCATTGTGG - Intronic
1114460509 14:22883448-22883470 TGGTGGGGAGGTCAGAACTAGGG + Intronic
1114563906 14:23614192-23614214 GGGGGTGGAGGAGAGTCCTGGGG + Intergenic
1114887888 14:26877697-26877719 ATGTGTGGAGGAAAGAATTGAGG + Intergenic
1116118142 14:40683930-40683952 GAGTGTGGTGGATAAAACTGTGG + Intergenic
1117036354 14:51733764-51733786 GGGTGTGGATGAGAAAACAGTGG - Intergenic
1117486653 14:56204591-56204613 GGGTGTGGAGCTCGGAAGTGGGG + Intronic
1119433912 14:74585724-74585746 GGGTGGGGAGGAGAGAAGGGAGG + Intronic
1119859166 14:77924115-77924137 GGGTATGGAGGAGAGAAATGGGG + Intronic
1119925413 14:78488879-78488901 GGGGGTGGAGGAAAGAGATGAGG + Intronic
1121437587 14:93929284-93929306 GGGAGTGGAGGGCAGGATTGGGG + Exonic
1121486000 14:94314761-94314783 CAGTGTGGAGGAAGGAACTGGGG - Intronic
1121719916 14:96101971-96101993 GGGTGTGGAGCCCAGGACAGTGG - Intergenic
1122392695 14:101401027-101401049 GGATGTGGAGGAGAAAACTTCGG + Intergenic
1122423327 14:101590887-101590909 GTGTGTGGACGGCAGGACTGAGG + Intergenic
1122504399 14:102222424-102222446 GGGTGTGCGGTCCAGAACTGCGG + Intronic
1122595092 14:102885038-102885060 GGGAGTGGAGGGCAGCACTGTGG - Intronic
1124404951 15:29384221-29384243 GGGTGTGGAGGAGTGAAGTCAGG - Intronic
1125522162 15:40354390-40354412 GGGTCTGGAGGACATGACAGTGG - Intronic
1127282785 15:57505977-57505999 AGGGGTGCAGGGCAGAACTGTGG + Intronic
1127531751 15:59850295-59850317 TGGAGTGGAGGACAGCTCTGTGG + Intergenic
1128198866 15:65786908-65786930 AGGTGAGGAGGATAAAACTGGGG + Intronic
1128650615 15:69410137-69410159 GGGTGGGGAGAAGAGAACTGAGG - Intergenic
1128842491 15:70861524-70861546 GGGAGTGGGAGACAGTACTGAGG - Intronic
1128931903 15:71712888-71712910 AGGTGTGGAGAACAGAGCAGTGG + Intronic
1129199313 15:73989332-73989354 AGGTGAGGAGGAGAGAAGTGAGG - Intronic
1129244612 15:74271818-74271840 GGGTGAGGAGGGCAGAGCAGAGG + Intronic
1129394303 15:75235837-75235859 GGGTGGGGAGGACAGGAGTCTGG - Intergenic
1129445265 15:75612604-75612626 GAGTGTGGAGGAAAGAAGTCTGG - Intronic
1129825603 15:78633076-78633098 GGGGCTGGAGGACAGAACAGAGG - Intronic
1130363493 15:83211529-83211551 TGGTGTGGTGAAAAGAACTGTGG + Intergenic
1132141867 15:99403636-99403658 GGGTGTGGAGGTTAGGGCTGGGG - Intergenic
1133368839 16:5232709-5232731 GTGTGTGCAAGACAGCACTGGGG - Intergenic
1133526303 16:6609194-6609216 GGCTGTGGAAGGCAGAATTGTGG - Intronic
1135133993 16:19874375-19874397 GGCTGTGGTGGAGAGGACTGGGG - Intronic
1136234172 16:28904272-28904294 GGGTGTGGGGGACAGGACGGGGG - Exonic
1139485830 16:67256109-67256131 GGGTGCTGAGGACAGCTCTGGGG - Intronic
1139673654 16:68508744-68508766 GGGCGTGGAGGACAGCACTTGGG - Intergenic
1139734071 16:68972242-68972264 GGGTGGGGAGGGCAGAAAGGAGG + Intronic
1140101407 16:71920942-71920964 GGGTGAGGAGGACAGCTGTGTGG + Intronic
1141707327 16:85674133-85674155 GGGGGTGGAGGCCTGAGCTGAGG + Exonic
1141755949 16:85991060-85991082 AGGTGCGGGTGACAGAACTGGGG + Intergenic
1141797562 16:86285493-86285515 GAGTGTGGAGCACAGACCTGGGG - Intergenic
1142046791 16:87930613-87930635 GGGTGGGGAGGAGAGAGCGGTGG + Intronic
1142107922 16:88316146-88316168 CGGTGAGGAGGACGGACCTGGGG - Intergenic
1142278161 16:89133688-89133710 GGATGTGGAGGGCACAAGTGTGG - Intronic
1142356638 16:89604545-89604567 GGGTTTGGAGGGGAGCACTGAGG + Intergenic
1142677105 17:1520652-1520674 GGGAGTGGGGGAGAGCACTGAGG + Intronic
1142899621 17:3004018-3004040 GGGTGGGAAGGGCAGAGCTGGGG + Intronic
1143514493 17:7413024-7413046 GGGTGAGGATGGGAGAACTGAGG + Intronic
1143637153 17:8171811-8171833 GAGTGTGGATGAGGGAACTGAGG + Intergenic
1144265669 17:13566374-13566396 GGCTGAGGAGGAGAGAAATGGGG - Intronic
1144623008 17:16830358-16830380 GGGTCTGGGAGGCAGAACTGAGG + Intergenic
1144883422 17:18442358-18442380 GGGTCTGGGAGGCAGAACTGAGG - Intergenic
1145148808 17:20502028-20502050 GGGTCTGGGAGGCAGAACTGAGG + Intergenic
1146320980 17:31846177-31846199 GGGGGTCGAGGACAGAACTTTGG - Intergenic
1146399339 17:32491341-32491363 GGGAGGGGAGGACAGAGTTGGGG + Intergenic
1146793735 17:35766952-35766974 AGGTATGGGGGACAGAAGTGGGG - Intronic
1146842022 17:36162814-36162836 GGGTGTGGAGGACAGAGAGATGG - Intergenic
1146854333 17:36250774-36250796 GGGTGTGGAGGACAGAGAGATGG - Intronic
1146870236 17:36374666-36374688 GGGTGTGGAGGACAGAGAGATGG - Intronic
1146877593 17:36425747-36425769 GGGTGTGGAGGACAGAGAGATGG - Intronic
1147073117 17:37975290-37975312 GGGTGTGGAGGACAGAGAGATGG - Intergenic
1147084639 17:38054828-38054850 GGGTGTGGAGGACAGAGAGATGG - Intronic
1147100586 17:38178794-38178816 GGGTGTGGAGGACAGAGAGATGG - Intergenic
1147142120 17:38465844-38465866 GGCGGTGGAGGCCAGGACTGGGG + Intronic
1147577332 17:41610294-41610316 GGGTCTGGGAGGCAGAACTGAGG + Intronic
1147685657 17:42285560-42285582 GGCTGTGGAGGAGAAAACTGAGG - Intergenic
1149850814 17:60032595-60032617 GGGTGTGGTAGACAGAACGATGG - Intergenic
1149859352 17:60113929-60113951 GGGTGTGGTAGACAGAACGATGG + Intergenic
1150083526 17:62261840-62261862 GGGTGTGGAGGACAGAGAGATGG - Intergenic
1150116070 17:62550723-62550745 GGGTGGGGTGACCAGAACTGGGG - Intronic
1150135491 17:62692881-62692903 GGGTGAGGGGCACAGAGCTGAGG - Exonic
1150643833 17:66965952-66965974 GGGTGTGCAGGACCGATCTGCGG + Intronic
1151968583 17:77445270-77445292 GGGTGCGGAGGAAAGGGCTGGGG - Intronic
1152799339 17:82323639-82323661 GGGCTTGGAGGGCAGAACAGAGG + Intronic
1153626765 18:7028786-7028808 GGGTGCGGAGGTCGGCACTGGGG + Intronic
1153812820 18:8766750-8766772 GGCTGGGCAGGACAGAGCTGAGG + Intronic
1154022448 18:10676331-10676353 CAGTCTGGAGGACAAAACTGGGG + Intronic
1154128532 18:11715576-11715598 GGGTGTGGAGGAAACAAAAGAGG + Intronic
1154327255 18:13400466-13400488 GGGTGTGGGGCCCAGACCTGCGG + Intronic
1154977037 18:21468380-21468402 GGGTGTTGAGGGAAGAATTGAGG + Intronic
1155374240 18:25138522-25138544 GGGTGGGGAGGACAGAGCTCAGG + Intronic
1156419295 18:36933631-36933653 GGGTGTGGAGGACAGAACTGTGG - Intronic
1157526936 18:48390735-48390757 GCATGTGGATGGCAGAACTGTGG - Intronic
1158878237 18:61752781-61752803 TGGTGTCGAGGACAGAGCGGAGG + Intergenic
1159584512 18:70270982-70271004 AGGTTTGGAGGACAGGATTGTGG + Intergenic
1160348581 18:78154575-78154597 GGGTGTGGAACACAGGGCTGGGG + Intergenic
1160913034 19:1483590-1483612 GGGTGTGGGGGACAGGCCTGAGG - Intronic
1161350772 19:3790292-3790314 GGGTGGGGAGTTCAGGACTGGGG - Intronic
1161501910 19:4620866-4620888 GGGGGTGGAGGAGAGCACTGGGG + Intergenic
1161678786 19:5668229-5668251 GGGTTTGGAGGCCAGAGCCGGGG + Exonic
1161728854 19:5946662-5946684 GGGTGTGGAGGCCTGGATTGGGG - Intronic
1162185540 19:8901909-8901931 GGGTGTGTAGGGCAGAAGTCAGG + Intronic
1162792347 19:13069587-13069609 GGGCGAGGAGGAAAGAAGTGGGG + Intronic
1163561291 19:18021028-18021050 AGGTGGGGTGGTCAGAACTGTGG - Intergenic
1163768942 19:19179168-19179190 GGGTGTGGGGGATGGGACTGGGG + Intronic
1163846588 19:19641781-19641803 GGGTCTGGAGGCCAGGACAGTGG - Intronic
1164157783 19:22607024-22607046 GGGGCTGGACCACAGAACTGGGG + Intergenic
1164840415 19:31388817-31388839 GGGTGTGGAAGCCAGGCCTGGGG + Intergenic
1165076280 19:33281548-33281570 GGGCGTGGAGGCCAGCTCTGTGG + Intergenic
1165358027 19:35315978-35316000 GGGTGTGCAGTATAGCACTGGGG - Intergenic
1165906939 19:39200029-39200051 AGGAGTTGGGGACAGAACTGGGG - Intronic
1165924240 19:39317337-39317359 GGGAGTGAAGGACAGATTTGGGG - Intergenic
1166302455 19:41919666-41919688 GGGTGTGAAGGACGCAGCTGAGG - Intronic
1166323797 19:42036820-42036842 GGGTGTGGAGGCCACAGGTGAGG + Intronic
1166534688 19:43565236-43565258 AAGTGTGGTGGACAGAACAGTGG - Intronic
1167196976 19:48036144-48036166 GGGTGTGCAGGGCAGAGCTTTGG + Intronic
1167197657 19:48041769-48041791 GGGTGGGGAGCCAAGAACTGTGG - Intronic
1167903235 19:52637807-52637829 GACTGTGGAGGAGAGACCTGTGG + Intronic
1168344919 19:55645553-55645575 GGGGGTGGAAGGCAGGACTGGGG - Exonic
925157486 2:1658735-1658757 GGGTGGGGAGCACAGGGCTGGGG - Intronic
925201530 2:1970737-1970759 GGGTGGTGAGAACTGAACTGTGG + Intronic
925413997 2:3656815-3656837 GGGTGTGGAGGGCAGAGGTCAGG + Intergenic
925945901 2:8863462-8863484 AGGTGCGAAGGACAGAGCTGGGG - Intronic
925971766 2:9111170-9111192 GGGTGAGGAGGCCACAGCTGAGG + Intergenic
926782630 2:16488268-16488290 TGGTGTGGAGGTCCGCACTGAGG + Intergenic
926976187 2:18519246-18519268 GGGTACGGAAGACAGAACTTGGG - Intergenic
927195170 2:20541903-20541925 GGGAGTGGTGGGAAGAACTGAGG + Intergenic
927225476 2:20760929-20760951 GGGTGTGGCGGACAGACTTTAGG - Intronic
927513156 2:23657074-23657096 GGGAGTAGAGGCCAGAAGTGGGG + Intronic
927639485 2:24837771-24837793 GGGGTTGGTGGACAGACCTGGGG + Intronic
928069769 2:28202943-28202965 GGGGGTGGAGGACACAGGTGAGG - Intronic
929204627 2:39276839-39276861 GGGAGAGGAGGAGAGAAATGGGG + Intronic
929484214 2:42340168-42340190 GGGAGTGGAGTACAGAACCTGGG - Intronic
930847787 2:55923857-55923879 GGGGGCGGAGGAGAGAGCTGAGG + Exonic
934138226 2:89018514-89018536 TGGTGTGGAGGAAAGGACTATGG - Intergenic
934231021 2:90182112-90182134 TGGTGTGGAGGAAAGGACTATGG + Intergenic
934311666 2:91872442-91872464 GGGGGAGGAGGGTAGAACTGGGG + Intergenic
935022263 2:99243113-99243135 GAGTGTGGAGGACATAACATTGG + Intronic
936039579 2:109140057-109140079 GGGTGAAGAGGACAGGTCTGCGG + Intronic
936092442 2:109510180-109510202 AGGTGTGGAGGAGAGGGCTGAGG + Intergenic
936913808 2:117618820-117618842 TGGTGTGGAGGAAAGAGCTCAGG - Intergenic
937569241 2:123335173-123335195 GGAGGTGGGGGACAGAAATGTGG - Intergenic
938077427 2:128347112-128347134 GGGTGGGGAGGACAGCCATGTGG + Intergenic
938094735 2:128454088-128454110 GGGTGCGGAGGAGAGAAGAGGGG + Intergenic
938420343 2:131140856-131140878 GGGTGGGGAGGGCAGAGCTGTGG + Intronic
938677874 2:133657220-133657242 GGGTGAGGGGAAGAGAACTGGGG - Intergenic
942338984 2:174923002-174923024 GTGGGTGGAGAACAGACCTGAGG + Intronic
946326260 2:218985976-218985998 GGGCGGGGAGGACAGAAGAGGGG - Intergenic
946879249 2:224160948-224160970 GGGTGAGGAGGAGAGGACTGTGG + Intergenic
948127696 2:235576827-235576849 GGGTGTGAAGGGCAGAAAGGTGG + Intronic
948568941 2:238905223-238905245 TGGTGTGGAAGACACAACTGAGG + Intronic
1169220261 20:3818502-3818524 GTGTGTGGAGGAGACAGCTGTGG - Intergenic
1169500691 20:6157912-6157934 GGGGCTGGAGGATAGAGCTGCGG - Intergenic
1170707088 20:18754087-18754109 TGATGTGGAGAACAGATCTGTGG + Intronic
1171102692 20:22400409-22400431 GGGGGTGGAGGGCAGGAATGGGG - Intergenic
1171133830 20:22678726-22678748 GGGTATGGAAAACAGAACAGTGG - Intergenic
1171493557 20:25538661-25538683 GGCTGGCGAGCACAGAACTGGGG + Intronic
1171493573 20:25538743-25538765 GGGTGGGTAGCACAGAACTGAGG + Intronic
1172035825 20:32010289-32010311 GGGTGTGGAGGACACAGCCTTGG - Intergenic
1174053560 20:47783931-47783953 GGGTAGGGAGGACAGAACGAAGG - Intronic
1174122446 20:48276384-48276406 TGGGGTGGAGGACAGAAGGGTGG + Intergenic
1174181233 20:48676303-48676325 GGGCGGGGAGGACAGAGGTGGGG + Intronic
1174348236 20:49947739-49947761 GGGAGAGGAAGACAGAACAGAGG - Intronic
1174418908 20:50386397-50386419 GGCTGTTGAGGACAGTGCTGGGG + Intergenic
1175008530 20:55711040-55711062 GGGTCTGGAGGACAGCATGGTGG - Intergenic
1175155938 20:56971655-56971677 GGGTGTGGGTGACAGACTTGAGG - Intergenic
1175571581 20:60026767-60026789 GGGTCTGTAGGTCAGAAGTGTGG - Intronic
1175585494 20:60136040-60136062 GGGTGAGGAGGACGGACATGGGG + Intergenic
1176054939 20:63140233-63140255 GTGTGTGGAGGAAAACACTGTGG + Intergenic
1177821610 21:26036271-26036293 GGGGGTGGGGGGTAGAACTGGGG + Intronic
1178640014 21:34338028-34338050 GGGTGTGGGGCACAGATGTGAGG + Intergenic
1178903440 21:36616079-36616101 TGGTGGGGAGGAGAGCACTGTGG + Intergenic
1178922866 21:36750423-36750445 GGGTGTGGAGGGCAGCGCGGAGG + Intergenic
1179189918 21:39115142-39115164 GGGAGGGGAGGAGAGACCTGTGG - Intergenic
1179713735 21:43277152-43277174 GGGTGGGGAGGACACAGCCGAGG - Intergenic
1180062317 21:45391861-45391883 GGCTGTGGAGGACAGGACAGAGG - Intergenic
1180538413 22:16418256-16418278 GGGGGAGGAGGGTAGAACTGGGG + Intergenic
1180634978 22:17257077-17257099 TGGAGTGGTGGAAAGAACTGGGG - Intergenic
1181108755 22:20589591-20589613 GGGTGGGGTGGGCAGGACTGGGG - Intergenic
1181265123 22:21626629-21626651 GGGTGGGCAGGAGAGACCTGGGG - Intergenic
1181527199 22:23496701-23496723 GGGTGAGGAGGCCAGAGGTGTGG + Intergenic
1182522346 22:30891632-30891654 GGGTGTGGTGGCCAGACCTGGGG + Intronic
1183068232 22:35378322-35378344 GAGTGTGGTGGTCAGGACTGTGG + Intergenic
1183210787 22:36449956-36449978 GGTTGTGGAGGAAAGAAGGGTGG - Intergenic
1183382644 22:37498071-37498093 AGGTGTGGAGGACAGAACACAGG + Intronic
1184105823 22:42367068-42367090 GGGTGTGGAGCCCAGGACTCGGG + Intergenic
1185096103 22:48806909-48806931 TGGAGTGGAGGAAAGAATTGTGG - Intronic
950375088 3:12564774-12564796 GGGTTGGGAGGAGAGAAGTGAGG - Intronic
950710934 3:14812207-14812229 GAGTGTGGGTCACAGAACTGGGG + Intergenic
950723256 3:14899418-14899440 GGGTCTGGAGCTCAGAACAGAGG - Intronic
952263461 3:31762871-31762893 AGGTGAGGAGCACAGAAATGTGG - Intronic
954029656 3:47809696-47809718 GGGAGTGGAGGGCTGACCTGGGG - Intronic
954093330 3:48302098-48302120 GGGTGAGGAGATGAGAACTGGGG + Intergenic
954427942 3:50453492-50453514 GGGTGTGAAGGACAGGGCTGGGG - Intronic
954966642 3:54617381-54617403 GGGTGTGGTGGGGAGAAATGGGG - Intronic
959826171 3:110798702-110798724 CAGTGTGGAGGACAACACTGTGG - Intergenic
960673723 3:120175417-120175439 GGGTGTGGCAGACTGAACAGTGG + Intronic
961110282 3:124277690-124277712 GGGTGTGGAGAACAGAATGGAGG + Intronic
961820533 3:129573526-129573548 GAGTGAGGAGGACAGAGCAGAGG + Intronic
962240668 3:133748298-133748320 GTGAGAGGAGGACAGGACTGAGG + Intronic
962264282 3:133934496-133934518 GGCTGTGTGGGCCAGAACTGGGG - Exonic
962728656 3:138259126-138259148 GGCTGTGGAGCACGGTACTGGGG + Intronic
962755685 3:138464114-138464136 GAGTGTGGAGGCCAGGGCTGTGG + Intronic
963248227 3:143082642-143082664 GGTTGGGGAGGTCAGAGCTGGGG + Intergenic
964374011 3:156031751-156031773 TGGTGTTGATGACAGAAATGAGG + Intergenic
965821462 3:172688662-172688684 GGGTGAGGAGGACAGCATTTAGG - Intronic
967852623 3:194093608-194093630 GGGTGTGGATGGCAGAACCAGGG - Intergenic
967858923 3:194137424-194137446 GGGTGGGGGTGACAGATCTGGGG + Intronic
968064132 3:195748860-195748882 GGAGGTGGAGGACAGTGCTGGGG - Intronic
968577989 4:1376820-1376842 GGGTGTGGAGAACCGTCCTGCGG - Intronic
968739903 4:2322192-2322214 GGGTGTGGGGGCCAGAGGTGGGG + Intronic
968952648 4:3702752-3702774 GGGTGGGGAGTGCAGAGCTGAGG + Intergenic
969577629 4:8045940-8045962 GGGCATGGAGGACAGAGCCGGGG - Intronic
969703477 4:8780228-8780250 AGGTGTGGAGCACAGGGCTGGGG - Intergenic
969940273 4:10725012-10725034 GGGTGAGGAGGAGAGGCCTGTGG + Intergenic
973196219 4:47445054-47445076 GGGGGTGGAGGAGAGAATTGCGG + Intergenic
974432743 4:61818474-61818496 TGGTCTGGAGGACAACACTGTGG + Intronic
974715793 4:65668710-65668732 GGGTCTGGAGCACAGGATTGGGG + Intronic
975621927 4:76305225-76305247 GGGTCTTGAGCAGAGAACTGGGG + Intronic
976407110 4:84672692-84672714 GGGTGTAGAGTACAGGAATGGGG - Exonic
976687840 4:87835673-87835695 GGGTGTGCAGTACAGTACTGTGG + Intronic
978539734 4:109803993-109804015 GGCTGCTGAGGACAGAGCTGAGG - Intergenic
979675761 4:123408905-123408927 GGGTGTGAATGAGAGAACTATGG + Intergenic
979689866 4:123548475-123548497 CGTTGTTGAGGACAGAACAGAGG - Intergenic
980349124 4:131665089-131665111 AGGGGTGGAGGACAGGACTAAGG - Intergenic
980903064 4:138923414-138923436 GGGTGAGGAGGAAAGAAATGAGG + Intergenic
982326311 4:154132563-154132585 GGCTGTGGAGGAGAGAGTTGGGG + Intergenic
984222206 4:176992465-176992487 GGGCGTGGAGGACAGAATGGGGG + Intergenic
985205560 4:187531487-187531509 GTGTTTGAAGGACAGACCTGTGG + Intergenic
985606029 5:858477-858499 GGATGAAGAGGACAGACCTGTGG - Intronic
985672668 5:1214348-1214370 GGGTGTGGAGCAGGGAACTGGGG - Intronic
985685502 5:1279672-1279694 GGGTGAGGTGGACAGAGGTGTGG - Intronic
985936392 5:3101161-3101183 GGAGGTGGAGGACAGAGCCGAGG - Intergenic
985950813 5:3220275-3220297 GGGGGCGGAGGACAGAACCTGGG - Intergenic
986767422 5:10940366-10940388 GGGTGTGGAGGTCAGTACTGTGG - Intergenic
988486904 5:31674914-31674936 GGGGGTGGAGGACTCAAGTGTGG + Intronic
990877309 5:60500162-60500184 GGGTGTGGTGGCCATACCTGTGG + Intronic
990883317 5:60564155-60564177 GAGTGTGGAGCAATGAACTGAGG + Intergenic
991139536 5:63224235-63224257 GGATCTGGAGGATTGAACTGTGG - Intergenic
991492745 5:67199014-67199036 GGGTGTGTAGGAGAGAATTCAGG - Intergenic
992173524 5:74127287-74127309 GAGTGTGGAGAGGAGAACTGAGG - Intergenic
992758387 5:79930515-79930537 GGGTGCCCAGGTCAGAACTGAGG + Intergenic
997259371 5:132454321-132454343 GGGTGTGGAGGTGAGACCTGGGG + Intronic
997662432 5:135599820-135599842 GAGTGCGAAGGCCAGAACTGAGG - Intergenic
997734309 5:136202214-136202236 GGGTGTGGGACTCAGAACTGTGG + Intergenic
998398680 5:141836167-141836189 GGGGCTGGAAGAGAGAACTGAGG + Intergenic
998496022 5:142590122-142590144 GGGGGTGGAGGACAGCTTTGGGG + Intergenic
1000043246 5:157500874-157500896 GGCTGTGGTGGAGAGATCTGTGG - Intronic
1000596950 5:163226313-163226335 GGGTATGGAGACCAAAACTGTGG + Intergenic
1001084638 5:168691759-168691781 GGGTGTAGAAGGCAGCACTGGGG + Intronic
1001150843 5:169226074-169226096 GGGTATGGAGGGCAGAGATGGGG - Intronic
1001774994 5:174321834-174321856 AGGTGTGGAAGTCAGAGCTGAGG + Intergenic
1001957724 5:175859655-175859677 GGGTGTGGAGATATGAACTGTGG + Intronic
1002329104 5:178429290-178429312 GGGTGTGGAGGGGAGGCCTGTGG - Intronic
1002423564 5:179163071-179163093 TAGTGTGTAGGACAGAGCTGCGG + Intronic
1002592378 5:180299637-180299659 GGGCCTGGAGGACAGAAGTCAGG + Intergenic
1002766967 6:249610-249632 GGGTGGGGAGGACAGAAGGATGG - Intergenic
1004922467 6:20388820-20388842 GGGTGGGGAGGAATGACCTGAGG + Intergenic
1005447944 6:25944580-25944602 GGATTTAGAGAACAGAACTGTGG - Intergenic
1005517226 6:26566250-26566272 TTGTGTGGAGAACAGAACCGAGG + Intergenic
1006152012 6:31994743-31994765 GAGGGTGGAGGACAAAGCTGGGG - Intronic
1006158314 6:32027481-32027503 GAGGGTGGAGGACAAAGCTGGGG - Intronic
1007181452 6:39932086-39932108 GGGTGTGAGGGAGAGAAGTGAGG - Intronic
1007227786 6:40327099-40327121 GGGTGGGGAAGCCAGAACTGGGG + Intergenic
1008382031 6:50846819-50846841 GGGTGTGGAGGCCAGAAGGAAGG - Exonic
1010115250 6:72298683-72298705 TGGTGTGGAGCACAGAACATGGG - Intronic
1010793296 6:80089886-80089908 TGGTGGGGAGGCCAGAAATGGGG + Intergenic
1013164465 6:107577338-107577360 GGGTGTTGTGGACAGAGCAGAGG + Intronic
1013485530 6:110592769-110592791 GGGTTTGGAGGGCAGAAGAGAGG + Intergenic
1014236300 6:118959238-118959260 GGGGGTTGAGGATAGAACTTTGG - Intergenic
1017252416 6:152295423-152295445 GGGTGTGGAGGACTGAAGTGGGG - Intronic
1017255212 6:152325311-152325333 GGGGGTGGAGGACGGAAGAGAGG + Intronic
1017339992 6:153309913-153309935 GGATGTGGAGGCAAGAGCTGGGG + Intergenic
1017437058 6:154425581-154425603 AGGGGTGGAGGACAGAAGTATGG + Intronic
1018107296 6:160501313-160501335 GGGTGTCGAGGGCAGAGGTGGGG + Intergenic
1018574502 6:165245086-165245108 AGGTGTGAAGGAAAGAACTTTGG + Intergenic
1018961030 6:168448554-168448576 TGGGGAGGAGGACAGAACTGGGG + Intronic
1019370011 7:657561-657583 GGGGGTGGTGGACAGGAATGAGG + Intronic
1020065198 7:5183044-5183066 TGGTGTGGAGGAGGGAACTAAGG - Intergenic
1020233658 7:6339326-6339348 GGGTGTGGTGCACACACCTGTGG + Intronic
1024465282 7:49705775-49705797 TGGTGTGGAGGTCACATCTGTGG - Intergenic
1024526356 7:50353299-50353321 GAGTGTGGCTGGCAGAACTGAGG - Intronic
1025252104 7:57358599-57358621 GGCTGTTGAGGACAGTGCTGGGG - Intergenic
1026023734 7:66729450-66729472 GGAAGGGGAGGACAGAAGTGAGG - Intronic
1026403195 7:70037232-70037254 GGGTTTGGAGGAAGGAAATGTGG + Intronic
1026873165 7:73865446-73865468 GGGTGTGGAGGGCAAACCTGGGG + Intronic
1027056483 7:75053147-75053169 GGGGGTGGTGGACAGGGCTGGGG + Intronic
1027056500 7:75053192-75053214 GGGGGTGGTGGACAGGGCTGGGG + Intronic
1027056515 7:75053237-75053259 GGGGGTGGTGGACAGGTCTGGGG + Intronic
1029420542 7:100469662-100469684 GGGGCTGGAGGGCAGGACTGGGG - Intronic
1029437898 7:100573017-100573039 GGGTGAGGAGGACAGAGCACTGG + Intronic
1029444117 7:100603411-100603433 GGGTCTGGAGAACAGAAAAGGGG - Exonic
1032452314 7:132043594-132043616 GGGTGTGGTGGACGTACCTGTGG - Intergenic
1034453639 7:151151807-151151829 GAGTGTGGAGGACAGAAGCTGGG - Intronic
1034474753 7:151275902-151275924 GGGTGTGGGTGACAGAGGTGGGG + Intronic
1034867666 7:154656071-154656093 GGGTGTGGAGGAGAGGAGCGGGG + Intronic
1035050698 7:155997645-155997667 GTGTGTGGAGGACAGCATGGAGG - Intergenic
1035104878 7:156434141-156434163 GAGTGTGGAGGAGGCAACTGAGG + Intergenic
1035190060 7:157159214-157159236 GATTGTGGAGGAAAGAATTGTGG + Intronic
1035565218 8:636581-636603 GGGTTTGGTGGACAGGGCTGAGG - Intronic
1036372269 8:8171764-8171786 GGTTGTGGAGGGAGGAACTGAGG - Intergenic
1036639643 8:10574470-10574492 GGTTGTGGAGGGAGGAACTGAGG - Intergenic
1036659093 8:10696238-10696260 GGGAGAGGAGGAGAGAAGTGGGG + Intronic
1036878633 8:12493877-12493899 GGTTGTGGAGGGAGGAACTGAGG + Intergenic
1037205677 8:16316900-16316922 GGGTGTGGAGGAGAAAAACGTGG + Intronic
1037579377 8:20235716-20235738 GGGGGTGGAGGAGGGAAATGGGG - Intergenic
1037787402 8:21911138-21911160 GGGTGGGGAAGACAAGACTGTGG - Intronic
1038613808 8:29075369-29075391 GGGTCGAGAGGACAGAACAGGGG + Intronic
1039419231 8:37421595-37421617 AGATGTTGAGGACAGAAATGTGG - Intergenic
1040101720 8:43512038-43512060 GGGTGGGGAGGACAGAGATTGGG + Intergenic
1041010928 8:53542641-53542663 GGCTGGGGAGGAGAGAGCTGTGG - Intergenic
1043647596 8:82540331-82540353 GGGTGTGGTGGACAGACAGGTGG - Intergenic
1044015973 8:87049191-87049213 GGGTGTGGATGACATAACTGAGG - Intronic
1044188079 8:89280619-89280641 GGGTGTGGAGGACTCACCTGGGG - Intergenic
1044296366 8:90532075-90532097 GGCTGTTGAGGCCAGACCTGGGG - Intergenic
1044316687 8:90757329-90757351 TGGTGTGGAGTACAGGACTGTGG + Intronic
1044634070 8:94304979-94305001 GGGTGTGGAGCAGAGCATTGTGG - Intergenic
1045470541 8:102508615-102508637 GGGTGTGAAAGACAGAAAAGGGG - Intergenic
1047109020 8:121767870-121767892 GAGGGTGGAGTTCAGAACTGGGG - Intergenic
1047176685 8:122548035-122548057 GGCTGTTGAGGACACACCTGAGG - Intergenic
1047964477 8:130035830-130035852 TGGTCTGGAGGACAGAAAGGAGG + Intergenic
1048475489 8:134738854-134738876 GGCTGTGGAGCAGAGAACAGTGG + Intergenic
1048580179 8:135724138-135724160 GGGTGTGGAGGGAGGAAGTGGGG - Intergenic
1048974413 8:139662880-139662902 GGGGCTGGAGGACAGATCTCAGG + Intronic
1049154667 8:141059413-141059435 GGGGGTGGAGGGCAGCTCTGTGG + Intergenic
1049312134 8:141938840-141938862 GGTTTTGCAGGACAGCACTGAGG + Intergenic
1049318269 8:141981219-141981241 GCGTGTGCAGGAAAGACCTGGGG + Intergenic
1049717349 8:144099210-144099232 GGGGGTGGAGCTCAGGACTGTGG + Intronic
1049750366 8:144280265-144280287 GGGTGTGGACCACAGAGCTGGGG - Intronic
1050739493 9:8803945-8803967 GGGGGTGGAGGGAAGAAGTGAGG - Intronic
1050916520 9:11142277-11142299 GGGTGTGGAGGGCATCTCTGAGG - Intergenic
1053409606 9:37907049-37907071 GGGTGGGGCTGACAGCACTGAGG - Intronic
1053506983 9:38651484-38651506 GGGAGTGGCTGACAGCACTGGGG + Intergenic
1053786977 9:41658991-41659013 GGGCATGGAGGACAGAATGGTGG - Intergenic
1053788273 9:41667792-41667814 GGGTTTGGAGAAGAGAACAGAGG - Intergenic
1053931770 9:43118686-43118708 GGCTGTGGAAGACAGAATCGGGG - Intergenic
1054156867 9:61646976-61646998 GGGTTTGGAGAAGAGAACAGAGG + Intergenic
1054176555 9:61879131-61879153 GGGTTTGGAGAAGAGAACAGAGG - Intergenic
1054476639 9:65577984-65578006 GGGTTTGGAGAAGAGAACAGAGG + Intergenic
1054660980 9:67701675-67701697 GGGTTTGGAGAAGAGAACAGAGG + Intergenic
1054823070 9:69543287-69543309 GGCTGTGGAGGACAGGCCGGGGG - Intronic
1054866628 9:70009181-70009203 TGGTGAAGAGGACAGAATTGAGG - Intergenic
1057065227 9:92043509-92043531 GAGTGAGAGGGACAGAACTGTGG - Intronic
1057783694 9:98071278-98071300 GGGTGTGTACCACAGAGCTGGGG - Intronic
1058475559 9:105329070-105329092 GTGGGTGGAGTACAGATCTGCGG + Intronic
1060057123 9:120424374-120424396 GATTGTAGAGGACAGAAATGTGG - Intronic
1060268910 9:122127758-122127780 GGGGCTGGTGAACAGAACTGTGG + Intergenic
1060403228 9:123360436-123360458 GGGTGTGGAGGGCAGCAGGGCGG - Intronic
1061888783 9:133606718-133606740 CGGAGTGGAGGACAGAACAAGGG + Intergenic
1062033290 9:134371678-134371700 GGGTATGGAGGACGGGCCTGGGG + Intronic
1062146852 9:134994356-134994378 GGGGCTGGAGGAGAGAACTTAGG + Intergenic
1062386042 9:136311896-136311918 GGCTGTGGGGGACAGAGCAGGGG + Intergenic
1062513907 9:136922677-136922699 GCGTGTGGAGGACAGGGATGGGG + Intronic
1186323058 X:8451585-8451607 AGGTTTGGAGGAAAGAGCTGAGG + Intergenic
1188629287 X:32332237-32332259 GGGTGTTGAGGACACAGCAGTGG + Intronic
1189261576 X:39682722-39682744 GGGTGAGGAGGACAGCACAGTGG - Intergenic
1189712579 X:43828609-43828631 GGGTGCTGAGGACTGAATTGCGG - Intronic
1190215363 X:48476407-48476429 GGGCGCGGAGGACAGGAATGCGG + Intronic
1192148353 X:68696577-68696599 TGGTGTGGAGCAAAGAACAGGGG + Intronic
1192233952 X:69284553-69284575 ATGTGTGCATGACAGAACTGGGG - Intergenic
1192342621 X:70276815-70276837 GGCTGTGGAGGTTAGAAGTGGGG - Intronic
1192909067 X:75583985-75584007 GGGTGTGGCAGACAAACCTGTGG - Intergenic
1195992775 X:110699116-110699138 GGGTTTGGAGAACAGTACTCTGG - Intronic
1196400485 X:115311564-115311586 GGGCCTGGAGCACAGGACTGGGG - Intergenic
1196920485 X:120580480-120580502 GGATGAGGAGGAGAGAACTGGGG + Intergenic
1198469016 X:136928902-136928924 GGTTGAGGAGGAAAGAACTCAGG - Intergenic
1198741872 X:139851156-139851178 GGTTCTGGAGGACAGACCTGGGG + Intronic
1198801890 X:140456705-140456727 GGGTTTTGAGCACAGAACTAGGG + Intergenic
1199600469 X:149538707-149538729 GAATGTGGACGACAGACCTGAGG + Intergenic
1199650119 X:149941234-149941256 GAATGTGGACGACAGACCTGAGG - Intergenic
1199743654 X:150758252-150758274 GGGTGTGGAGGGGAGACCTGAGG - Intronic
1200003348 X:153072957-153072979 GGGTGTGGGGGGATGAACTGGGG - Exonic
1200004375 X:153077052-153077074 GGGTGTGGGGGGATGAACTGGGG + Intergenic
1200090840 X:153635234-153635256 GGGTGTGGAGGGAAGAACTTTGG + Intergenic