ID: 1156419300

View in Genome Browser
Species Human (GRCh38)
Location 18:36933643-36933665
Sequence GCCCAACCCAGAGGGTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 245}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156419300_1156419305 -7 Left 1156419300 18:36933643-36933665 CCTCCACACCCTCTGGGTTGGGC 0: 1
1: 0
2: 0
3: 24
4: 245
Right 1156419305 18:36933659-36933681 GTTGGGCACCAGCTGTTCTAGGG 0: 1
1: 0
2: 0
3: 14
4: 114
1156419300_1156419308 1 Left 1156419300 18:36933643-36933665 CCTCCACACCCTCTGGGTTGGGC 0: 1
1: 0
2: 0
3: 24
4: 245
Right 1156419308 18:36933667-36933689 CCAGCTGTTCTAGGGGATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1156419300_1156419306 -6 Left 1156419300 18:36933643-36933665 CCTCCACACCCTCTGGGTTGGGC 0: 1
1: 0
2: 0
3: 24
4: 245
Right 1156419306 18:36933660-36933682 TTGGGCACCAGCTGTTCTAGGGG 0: 1
1: 0
2: 4
3: 11
4: 114
1156419300_1156419309 2 Left 1156419300 18:36933643-36933665 CCTCCACACCCTCTGGGTTGGGC 0: 1
1: 0
2: 0
3: 24
4: 245
Right 1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 107
1156419300_1156419310 12 Left 1156419300 18:36933643-36933665 CCTCCACACCCTCTGGGTTGGGC 0: 1
1: 0
2: 0
3: 24
4: 245
Right 1156419310 18:36933678-36933700 AGGGGATCCAGGGTGCTTCCTGG 0: 1
1: 0
2: 2
3: 28
4: 303
1156419300_1156419304 -8 Left 1156419300 18:36933643-36933665 CCTCCACACCCTCTGGGTTGGGC 0: 1
1: 0
2: 0
3: 24
4: 245
Right 1156419304 18:36933658-36933680 GGTTGGGCACCAGCTGTTCTAGG 0: 1
1: 1
2: 5
3: 18
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156419300 Original CRISPR GCCCAACCCAGAGGGTGTGG AGG (reversed) Intronic
900612303 1:3549300-3549322 GCCCAAGCCTGAGGGGTTGGGGG - Intronic
900620501 1:3584847-3584869 GCCCCATCCAGGGGGTGTGCAGG - Intronic
900640825 1:3687360-3687382 GCTCTTCCCAGACGGTGTGGGGG - Intronic
900801739 1:4741302-4741324 GCCCAAATCAGAGTGTGTGCAGG + Intronic
900989170 1:6090199-6090221 GCACATCCCACAGGGAGTGGGGG - Intronic
901225917 1:7612939-7612961 GACCAACCCACAGGGTGATGGGG - Intronic
902362126 1:15947640-15947662 GGCCAAATAAGAGGGTGTGGAGG - Intronic
902707019 1:18212666-18212688 GCCCAACCCAGGGGGGGTCCTGG + Intronic
902747641 1:18483870-18483892 GCCCTGGCCAGAGGGAGTGGTGG + Exonic
902761094 1:18581267-18581289 GACCAAGCCAGAAGGTGTAGTGG - Intergenic
903231919 1:21927301-21927323 GCCCAAAGCATAGGGTGGGGTGG + Intronic
903290837 1:22313344-22313366 GCTCAGCTGAGAGGGTGTGGAGG - Intergenic
903328803 1:22586471-22586493 GCCCAGCTCACAGGCTGTGGAGG - Exonic
904774423 1:32898036-32898058 TCCCCACCCAGAGCCTGTGGTGG - Intronic
905484370 1:38285063-38285085 TCCCAGCCCAGAGGATGAGGAGG - Intergenic
907425762 1:54378514-54378536 GCCCCAGCCAGAGGGATTGGGGG - Intronic
907452093 1:54552017-54552039 GTCTAACCCAGAGTGTGGGGAGG + Intronic
907505983 1:54918586-54918608 TCCCAACCCAGAAGGGTTGGGGG + Intergenic
907602866 1:55787975-55787997 TCCCAACCCAGAAGGGTTGGGGG + Intergenic
908456423 1:64308954-64308976 GCCCAGCCCCGAGTCTGTGGAGG + Intergenic
908570542 1:65405894-65405916 ACCCAATCCAGTTGGTGTGGTGG - Exonic
909021554 1:70436915-70436937 GCCTAAACCAGAGTGTCTGGGGG - Intronic
909445465 1:75743792-75743814 GGCCACCCCACAGGGTCTGGTGG - Intronic
911187210 1:94915980-94916002 GCCCAAAACAGATGGTGTGTGGG - Intronic
913068520 1:115279442-115279464 GCCTACACCAGAGGGTGTTGGGG + Intergenic
913504985 1:119508694-119508716 CCCCAACCCAGGGGATTTGGGGG + Intronic
915117945 1:153612195-153612217 GCCCAGCCCAGTGGGGATGGTGG - Intronic
917974456 1:180230055-180230077 GCCGACCCCGGAGGGAGTGGGGG - Intergenic
919583852 1:199410809-199410831 GCCCAAGCTAGACGGGGTGGTGG - Intergenic
920211296 1:204330750-204330772 GCCCCACCATGAGGTTGTGGAGG + Intronic
920307615 1:205029280-205029302 GCCCCACACATAGTGTGTGGGGG + Intergenic
920380475 1:205531999-205532021 GTTCAAGCCAGAGGGTGTCGGGG - Intronic
920425994 1:205875597-205875619 TCCCAACCCAGAAGGGTTGGGGG + Intergenic
920434361 1:205938558-205938580 GACCAGCCCAGATGGTGTGGAGG - Intronic
920507422 1:206526339-206526361 GCCCAGCCCGGAGGGCCTGGAGG - Intronic
921093880 1:211870106-211870128 GCCCAACCCAGATTGTGGTGGGG - Intergenic
923016996 1:230134555-230134577 GCCCAACCCAGAATGAGGGGAGG - Intronic
1062935445 10:1382790-1382812 GCATTACCCAGAGGGTGGGGAGG - Intronic
1063103536 10:2972894-2972916 GCCCAGCACAGAGGGTTTGCAGG + Intergenic
1064752736 10:18548204-18548226 GCTGAAGCCAGAGGGTGTGCTGG - Exonic
1066432173 10:35362765-35362787 TCACATCCCAGAGGGTGTGGGGG + Intronic
1067053661 10:43039210-43039232 GCCCCACCCGGAGAGAGTGGGGG - Intergenic
1067227356 10:44384823-44384845 GCCCGACACAGTGGGGGTGGAGG - Intronic
1068060791 10:52064735-52064757 TCCCAACTCAGAAGGGGTGGGGG + Intronic
1068083287 10:52346586-52346608 GCCCAGCCATGAGGGTGTGGGGG - Intergenic
1069569488 10:69485759-69485781 GCCCAACTGGGAGGCTGTGGGGG + Intronic
1070431032 10:76337754-76337776 GCTCCACCAAGAGGGTGTGAGGG + Intronic
1071230513 10:83580289-83580311 GCCCACGCCAGAGAGTATGGGGG + Intergenic
1071327317 10:84530096-84530118 TCCCAACCCAGAAGGGTTGGGGG + Intergenic
1073152282 10:101320314-101320336 GGCCTACCCAGCTGGTGTGGAGG - Intergenic
1075242715 10:120792990-120793012 GCCCAGCCCAGTGTGTGTGGGGG - Intergenic
1075242772 10:120793231-120793253 GTCCAGCCCAGTGTGTGTGGGGG - Intergenic
1075787038 10:125057035-125057057 GCCCAACCCAGAGGGCAGAGAGG - Intronic
1076214903 10:128685775-128685797 GCACAACCCTGAGGATGAGGGGG - Intergenic
1076554496 10:131312424-131312446 GCCCCACCCAGGGGGTGTCGTGG - Intergenic
1076898486 10:133325658-133325680 CCCCAACCCCGAGGTTCTGGCGG + Intronic
1076921954 10:133458925-133458947 GCCCATCCCACTGGGTGTGAAGG + Intergenic
1077008830 11:371104-371126 GCCCAACCAGGAGGGGGCGGAGG + Intronic
1077154708 11:1086098-1086120 GCCCAGGCCAGGGGGAGTGGTGG + Intergenic
1077395096 11:2316685-2316707 GACCCTTCCAGAGGGTGTGGGGG - Intronic
1077419751 11:2444770-2444792 GGCCAAGCCAGGGGGTGAGGCGG + Intronic
1077461451 11:2712791-2712813 TCCCAACCCAGAGGCTGTGAGGG - Intronic
1077462155 11:2715960-2715982 GGCCAGCCCAAAGGGTTTGGAGG - Intronic
1078369190 11:10730954-10730976 GCCCAACCCAGGAGGTGGGGAGG + Intergenic
1079292400 11:19200098-19200120 GCCAAACCCAGTGGGTTTTGGGG - Intronic
1079731754 11:23942501-23942523 ACCCAGGCCAGAGGCTGTGGAGG - Intergenic
1082091610 11:48094934-48094956 GCCCAGCCCTGAGGGGGTGAGGG + Intronic
1082244986 11:49911610-49911632 ACACAACCCAGACGGGGTGGTGG + Intergenic
1083153783 11:60810247-60810269 ACCCCACCCTGAGGGTGTGAGGG - Intergenic
1084096687 11:66915973-66915995 GACCAAAGCAGAGGGAGTGGAGG - Intronic
1084751874 11:71209419-71209441 GCCCAGCCAAGCAGGTGTGGAGG + Intronic
1085053036 11:73389458-73389480 GCCCAGCCCAGAGGGTATGCTGG + Intronic
1085390344 11:76179026-76179048 GCCCATACCAGAGGGGCTGGTGG - Intergenic
1085528846 11:77179866-77179888 GCACAGCCCAGAGGCGGTGGCGG - Exonic
1085572521 11:77571767-77571789 GTCCGACCCAGAGGGACTGGGGG + Intronic
1087170667 11:95046808-95046830 GCTGAACCCAGAGGATATGGAGG + Intergenic
1090413683 11:126526508-126526530 GCCCACCCCAGGAGGTCTGGAGG + Intronic
1202813679 11_KI270721v1_random:37878-37900 GCCCCACCCAGCCTGTGTGGAGG - Intergenic
1091391934 12:131077-131099 GGCCAAGCCAGAGGGTGGGGAGG - Intronic
1095048122 12:37532908-37532930 GGCCTGCCTAGAGGGTGTGGAGG + Intergenic
1095138663 12:38637202-38637224 TCCCAACCCAGAAGGGTTGGGGG - Intergenic
1095283555 12:40384598-40384620 TCCCAACCCAGAAGGGTTGGGGG - Intergenic
1097166117 12:57087565-57087587 GCCAAACACAGTGGGGGTGGTGG - Intronic
1101589916 12:106116377-106116399 GCCCACTCCAGAGGGGTTGGGGG + Intronic
1102153091 12:110702236-110702258 GCCCAGACCAGAAGGGGTGGGGG - Intronic
1102490475 12:113287248-113287270 CCCCACCCCTGAGGGTGTGCAGG + Intronic
1102825411 12:115944286-115944308 ACCCAAACCAGTGGGCGTGGTGG + Intergenic
1104851874 12:131879992-131880014 TCCCAACCCAGAAGGGTTGGGGG + Intergenic
1106143836 13:27034739-27034761 GCCCTCCCCAGTGGGTGTGTGGG - Intergenic
1108022195 13:46138931-46138953 GCTCAAGCCAGCGGGTGCGGTGG - Intronic
1110776249 13:79411401-79411423 ACCCAGCCCAGAGGCTGAGGTGG + Intergenic
1112362042 13:98727277-98727299 GCCCAAGCCATAGGAGGTGGCGG - Intronic
1113458618 13:110466372-110466394 GCCCAGCCCAGACGGTGGCGAGG + Intronic
1113811595 13:113146064-113146086 CCCCACCCCAGACCGTGTGGCGG + Intronic
1113918492 13:113889432-113889454 CCACAGACCAGAGGGTGTGGGGG - Intergenic
1113961240 13:114127428-114127450 GCCCAAGACACAGGGTGTGCTGG - Intronic
1114383948 14:22237328-22237350 CCCCAACCCAGAAGGGTTGGGGG - Intergenic
1115931964 14:38507654-38507676 GCCTAGCAGAGAGGGTGTGGGGG - Intergenic
1116863504 14:50013128-50013150 GCCCGACCCCGGGGTTGTGGTGG - Intergenic
1118650304 14:67884557-67884579 GCCAAATCCTGAGGGTTTGGGGG - Intronic
1122149531 14:99717488-99717510 GCCCAGCTCCTAGGGTGTGGAGG - Intronic
1123123436 14:105928647-105928669 GCCCAGCCCAGAGGCTCTGCAGG - Intronic
1123843265 15:24270167-24270189 GCCCCACACAGAGGGAGCGGAGG - Intergenic
1126110759 15:45173510-45173532 ACCCAACCCACAGGGCCTGGAGG + Intronic
1127273734 15:57424071-57424093 GCCAAACCCACAGGGTGTCGTGG - Intronic
1127304932 15:57696336-57696358 GCCCATCCCAGAGGGCTTGAGGG - Intronic
1128363004 15:66975907-66975929 ACCCAACCCAGAAGGGTTGGGGG + Intergenic
1128565469 15:68698042-68698064 GCCCATCCCAGAGTGGGTAGAGG - Intronic
1128576368 15:68778020-68778042 GTACCACCCAGAGGGTGAGGTGG + Intergenic
1128668045 15:69552957-69552979 GCCCAACCAAGAGTATGTGTGGG + Intergenic
1132553651 16:563712-563734 GCCCTAGCCACAGGGGGTGGTGG - Exonic
1132887732 16:2189863-2189885 GCCCAACCCTGTGGGTTTGGGGG + Intronic
1133256407 16:4519160-4519182 ACAGAACCCAGAGGGTGTGGAGG - Intronic
1133324793 16:4936287-4936309 TCAGAACCCAGAGGGTGGGGAGG + Intronic
1134619555 16:15677249-15677271 GCCCCACCCAGGGAGTGTGGTGG + Intronic
1135166420 16:20143039-20143061 ACCCATTCCAGAGGGAGTGGGGG + Intergenic
1135252175 16:20910015-20910037 CCCCAACCCAATGGGTGTGAGGG + Intronic
1136225570 16:28858093-28858115 GCCCAACCCCCAGGGAGGGGAGG - Intronic
1136579561 16:31143245-31143267 CCCCTCCCCAGGGGGTGTGGGGG - Intronic
1137277837 16:46948635-46948657 GCCCAACCATGAGGCTGAGGTGG - Intergenic
1137604180 16:49776303-49776325 GGCCAGCCCAGCGGGTGGGGAGG + Intronic
1140802877 16:78505376-78505398 GCCCCACTCAGAGGGCCTGGTGG - Intronic
1142291584 16:89195779-89195801 GCCACACCCAGTAGGTGTGGAGG - Exonic
1142954662 17:3513418-3513440 TCCCATCCCAGAGTGTGCGGGGG - Exonic
1143179139 17:4973479-4973501 GCCCTACCAAGAGGGAGTTGGGG - Intronic
1143886314 17:10067575-10067597 CCCCTAGCCAGAGGGGGTGGGGG - Intronic
1146616349 17:34360059-34360081 GCCCTGCCCAGAGGGCTTGGGGG - Intergenic
1146890552 17:36503852-36503874 GCCCAACCCAGAGTGAGATGTGG - Intronic
1146994075 17:37302541-37302563 CCCAAACCCAGAGGCTGAGGCGG - Intronic
1147907678 17:43833308-43833330 GCCCGGCCCGGAGGGTGCGGCGG - Intergenic
1148667836 17:49388055-49388077 GCCCAATGCTGAGGGTCTGGTGG + Intronic
1148750818 17:49944854-49944876 CCCCACCCCAGGGGGTGTAGAGG - Intergenic
1151553797 17:74836591-74836613 AGCCCACCCAGAAGGTGTGGCGG - Exonic
1151681764 17:75626198-75626220 GCTCAAACCAGATGGTCTGGGGG - Intergenic
1151763312 17:76119677-76119699 GCCCGACCCAGAGGGTGTTCAGG + Intronic
1152357183 17:79813062-79813084 TCCAACGCCAGAGGGTGTGGGGG + Intergenic
1156419300 18:36933643-36933665 GCCCAACCCAGAGGGTGTGGAGG - Intronic
1157251479 18:46099705-46099727 GCCCAGCGCAGAGGCTGAGGAGG - Intronic
1158546962 18:58405078-58405100 GCATAACCCAGAGGGCATGGTGG - Intergenic
1160942683 19:1627730-1627752 GCCCTGCCCAGGGGGTGGGGCGG + Intronic
1161107076 19:2449299-2449321 GCCCAAGCCTGGGTGTGTGGTGG + Intronic
1162790211 19:13058881-13058903 CCCCAATCCCCAGGGTGTGGGGG + Intronic
1163952507 19:20603023-20603045 GCCCAAACTAGTGGGTGTGAAGG - Intronic
1164056980 19:21630077-21630099 TCCCAACCCAGAAGGGTTGGGGG - Intergenic
1164148186 19:22525680-22525702 GTCCGACCCAGAGGGGCTGGGGG + Intronic
1164428052 19:28161264-28161286 GCTCAACTCACTGGGTGTGGTGG + Intergenic
1166857887 19:45792397-45792419 GCCCAGCCCCGCGGGCGTGGCGG + Exonic
1167520792 19:49953358-49953380 GTCCGACCCAGAGGGGTTGGGGG + Intronic
927510871 2:23642963-23642985 CCCCAACCCAGAGGCTGCAGTGG + Intronic
927613737 2:24567788-24567810 GCCCAGGCTAGAGTGTGTGGTGG + Intronic
928940451 2:36721819-36721841 GCCCAACCTAAAGGGGGTGGAGG - Intronic
929917404 2:46147723-46147745 GCCCAGCCCACAGGGAGTGCTGG + Intronic
934945381 2:98537522-98537544 CCCCTGCCCAGAGGGTGAGGGGG - Intronic
935678756 2:105618287-105618309 GCCCATCCCACAGGGAGTGCTGG - Intergenic
939961388 2:148568984-148569006 GACCCCCCCAGAGGGAGTGGAGG + Intergenic
939962486 2:148577673-148577695 GCATAACCCAATGGGTGTGGTGG - Intergenic
942580604 2:177412443-177412465 TCCCAACCCAGAAGGTTTGGGGG + Intronic
942710546 2:178830327-178830349 GTCTAGCCCAGAGGGTCTGGAGG + Exonic
943895354 2:193350663-193350685 GCTCAAACGCGAGGGTGTGGTGG + Intergenic
946225304 2:218261283-218261305 GCACACCCCCGAGGGTCTGGTGG - Intronic
946247828 2:218397466-218397488 GCCCAACCCAGGGGGAGGCGGGG - Intergenic
948476931 2:238226484-238226506 GCCCACCCCCGAGAGTGGGGAGG + Intronic
948484378 2:238271229-238271251 GCCCAACCCAGATGTGGTGCAGG - Intronic
948699322 2:239750462-239750484 GACCAGCCCAGCGGGTGTCGAGG - Intergenic
948835761 2:240625331-240625353 GCCCCAGCTAGAGGGCGTGGGGG - Intronic
1170570095 20:17627720-17627742 GCAAACCCCAGGGGGTGTGGAGG + Intronic
1173148218 20:40543777-40543799 GATTTACCCAGAGGGTGTGGTGG + Intergenic
1174572040 20:51508861-51508883 GCCCAGGCCAGAGGGGATGGTGG - Intronic
1175971350 20:62688220-62688242 GCCCATCCCAGAGGGCAAGGAGG + Intergenic
1177263881 21:18759592-18759614 CCCCAACCCAGAAGGGTTGGGGG + Intergenic
1177895828 21:26855376-26855398 CCCCAACCCAGAAGGGTTGGGGG - Intergenic
1178304345 21:31478805-31478827 GCCCAACACAAATGGGGTGGAGG + Intronic
1180067566 21:45420289-45420311 GCCCAGCCCCGAGGGTCTCGTGG + Intronic
1180211443 21:46297439-46297461 GCCCCTCCCACAGGGTTTGGGGG - Intronic
1181019848 22:20093981-20094003 GCTCAACAAAGGGGGTGTGGTGG + Intronic
1181559616 22:23692515-23692537 GGCCAAGCCAGATGGTGAGGGGG + Exonic
1181991825 22:26842656-26842678 GCCCAACCCTGAGGCTGGGAAGG - Intergenic
1182423338 22:30259133-30259155 GCCCCACCCAGAGGGGCTTGTGG - Intergenic
1183343823 22:37296083-37296105 GCCCGGGCCACAGGGTGTGGGGG + Intronic
1183757702 22:39785438-39785460 GCTGAGCTCAGAGGGTGTGGGGG - Intronic
1183988935 22:41585102-41585124 GCACAGCCCAGAGGCTGTTGCGG + Intronic
1185083005 22:48720138-48720160 GCGAAACCCAGTGGGTGTGGCGG + Intronic
1185331465 22:50253934-50253956 GCCCCACCCAGCCAGTGTGGAGG + Intronic
950632369 3:14291018-14291040 GGCCTCCCCAGAGGGTGGGGTGG - Intergenic
952922601 3:38296331-38296353 TCCCAACCCAGAAGGGTTGGGGG + Intronic
953094549 3:39762042-39762064 GTCCAACCCAGAGGGGATGCAGG + Intergenic
954383550 3:50232607-50232629 GTCCAAACCAGTGTGTGTGGGGG + Intronic
954435055 3:50491522-50491544 GCACAGCCCAGGGGGTGAGGTGG + Intronic
957646557 3:82938897-82938919 GCCCTACCGAGTGGGTGTGGTGG + Intergenic
958016641 3:87945647-87945669 TCCCAACCCAGAAGGGCTGGGGG + Intergenic
959582256 3:107993581-107993603 GCCCAAGGCACAGGGTGAGGGGG - Intergenic
961645915 3:128392743-128392765 GCCCACCTGAGAGAGTGTGGGGG + Intronic
968380962 4:95470-95492 CCCCAACCCAGAGGGTGCAGGGG - Intergenic
968391520 4:196747-196769 TCCCAACCCAGAAGGGTTGGGGG + Intergenic
968480332 4:830359-830381 GACAAACCCAGAGGCTGTGGAGG + Intergenic
976189383 4:82474223-82474245 CCCCAACCCAGAAGGGTTGGGGG - Intergenic
976692483 4:87883671-87883693 GCAGAACCCAGAGGTTGAGGCGG + Intergenic
977938096 4:102828221-102828243 GCCCAATCAGGAGCGTGTGGTGG + Intronic
978909125 4:114045095-114045117 CCCCAACCCAGAAGGATTGGGGG - Intergenic
983667340 4:170196376-170196398 TCCCAACCCAGAAGGGTTGGGGG + Intergenic
984097276 4:175448469-175448491 GCCCATCACAGGGGGTGTGACGG - Intergenic
986977483 5:13410393-13410415 GTTCAGCCCAGAGGGTGAGGTGG - Intergenic
987046730 5:14115854-14115876 GACCAACCCAGAGGGTGGAATGG - Intergenic
987545436 5:19306126-19306148 GCCATACCCTGAGGGAGTGGAGG + Intergenic
988705218 5:33719367-33719389 ACCCAACCCAGAGTGTATGAGGG - Intronic
988792908 5:34624903-34624925 GCCCAACTCAGAGGGAGTGCTGG + Intergenic
990504407 5:56430426-56430448 GACACACCCAGAGGGTGTAGAGG + Intergenic
992105207 5:73444463-73444485 CCCAAACGCAGAGGGTGGGGAGG + Intergenic
995465263 5:112444649-112444671 CCCCAACCCAGAAGGGTTGGGGG - Intergenic
997454033 5:134004641-134004663 GCCTACCTCAGAGGATGTGGCGG + Intronic
997821216 5:137067769-137067791 GCCCATCACAGAGGGTGGCGAGG + Exonic
998152449 5:139765077-139765099 GCACAACTGAGAGGGTGAGGGGG - Intergenic
1001904194 5:175457595-175457617 GCTCCACCAAGAGGGTGTGAGGG + Intergenic
1004236451 6:13879032-13879054 TCCCAACCCAGAAGGGTTGGGGG - Intergenic
1004503807 6:16231323-16231345 GTCCAACTCAGAGGGGCTGGGGG - Intergenic
1005098930 6:22148131-22148153 GCTCAACCCTGGGGGTGAGGAGG + Intergenic
1005324037 6:24682080-24682102 CCCCAACCCAGAAGGGTTGGGGG + Intronic
1006638960 6:35479270-35479292 GCCCTCCCCAGTGGGAGTGGGGG - Intronic
1007125488 6:39422588-39422610 GCCCAACCCTGAGTGTGTAGAGG + Intronic
1008270493 6:49483638-49483660 ACCCAAGCCAGCGGCTGTGGAGG - Intronic
1011190233 6:84720199-84720221 TCCCAACCCAGAAGGGTTGGGGG + Intronic
1011608633 6:89129070-89129092 GGCAAAGCTAGAGGGTGTGGTGG + Intergenic
1013543175 6:111131669-111131691 TCCCAACCCAGAAGGGTTGGGGG - Intronic
1017964678 6:159253903-159253925 GCCCACCCCAGAGGGGACGGAGG - Intronic
1018760662 6:166891855-166891877 CCCCAACCCAGAAGGGTTGGGGG - Intronic
1022554329 7:31276833-31276855 CCCCAACCCATAGGGTCTGTGGG + Intergenic
1024302638 7:47899486-47899508 GCCCAAAGTAGGGGGTGTGGAGG - Intronic
1026889557 7:73974073-73974095 TCCCAAACCACAGGGTCTGGGGG + Intergenic
1027934946 7:84589862-84589884 GCTCAGCTCTGAGGGTGTGGGGG - Intergenic
1028588988 7:92477200-92477222 CCCCAACCCAGAAGGGTTGGGGG + Intronic
1029525626 7:101092203-101092225 GCACTTCCCAGAGGGGGTGGCGG - Intergenic
1030336920 7:108338027-108338049 TCCCAACCCAGAAGGGTTGGGGG - Intronic
1033356112 7:140601698-140601720 GCCCACCCCTGAGCTTGTGGAGG - Exonic
1034532940 7:151707946-151707968 GCCCAACCCAGACGGGGCAGGGG + Intronic
1034550939 7:151820339-151820361 GCCCACGGCAGTGGGTGTGGAGG - Intronic
1034786969 7:153935085-153935107 GCCCATCCCAGTGGGTGCTGAGG + Intronic
1034939507 7:155221143-155221165 GCGCAGCCTACAGGGTGTGGGGG - Intergenic
1036752823 8:11454166-11454188 GGGCAACCCAGACGGTGTCGGGG - Intronic
1037810083 8:22081745-22081767 CCTCACCCCAGAGGGTGAGGAGG + Exonic
1037821025 8:22134567-22134589 GGCCAGGCCAGAGGGGGTGGAGG + Intergenic
1038627800 8:29210969-29210991 ACCTGACCCAGAGGGAGTGGGGG + Intronic
1039947666 8:42143886-42143908 ACCCAGCCCAGAGGCTGAGGTGG + Intergenic
1041255430 8:55976455-55976477 GCCACACCAAGAGGGTGAGGGGG - Intronic
1042934756 8:74047338-74047360 GCACAGCCAAGAAGGTGTGGTGG + Intergenic
1043385528 8:79744136-79744158 GCCCACCCCAGAGACTGTGCTGG + Intergenic
1045548427 8:103149172-103149194 GCCCAAGGCAGATGGGGTGGGGG - Intronic
1047444309 8:124905930-124905952 TCCCAACCCAGAAGGGCTGGAGG + Intergenic
1047630031 8:126696662-126696684 GCCCAACCCAGGGTGTCAGGAGG - Intergenic
1047732013 8:127735973-127735995 TCCCAAAGCAGAGGGCGTGGGGG + Intronic
1049610247 8:143551804-143551826 CCCCAGCCCAGAGGGTGTGAGGG - Intergenic
1051071621 9:13175208-13175230 GCCCAATTCAGAGGGTTTTGTGG + Intronic
1054162378 9:61682816-61682838 GGCCTGCCTAGAGGGTGTGGGGG - Intergenic
1061430221 9:130526230-130526252 GCCCAACCCAGATGGGCTGAGGG - Intergenic
1061807526 9:133144658-133144680 CCCCCAGCCAGGGGGTGTGGGGG - Intronic
1061840041 9:133353379-133353401 GCCCTACCTTGAGGGAGTGGAGG - Intronic
1062152693 9:135030101-135030123 GCCCAACCCGCAGGGTGGGGGGG - Intergenic
1188756997 X:33974753-33974775 TGCCACCCCAGTGGGTGTGGTGG + Intergenic
1190058579 X:47196403-47196425 TCCCAAACCAGAGGGTTTGAGGG - Intronic
1190070280 X:47273734-47273756 GCCCAACCCACACAGTGAGGAGG - Intergenic
1190537370 X:51442290-51442312 CCCCAACCCAGTGGGCCTGGAGG + Intergenic
1193172286 X:78349796-78349818 TCCCAACCCAGAAGGGTTGGGGG + Intergenic
1193306343 X:79956632-79956654 CCCCAACCCAGAAGGGTTGGGGG - Intergenic
1193740080 X:85206395-85206417 GAAAAACCCAGAGAGTGTGGTGG + Intergenic
1193882108 X:86936223-86936245 GCACACACCAGTGGGTGTGGTGG + Intergenic
1200142460 X:153908903-153908925 GCCCAAGGCAGAGCCTGTGGAGG - Intronic
1200776032 Y:7171130-7171152 GCCCAACCCTGAGGGAGAGAAGG - Intergenic
1201724255 Y:17136141-17136163 TCCCAACCCAGAAGGGCTGGAGG + Intergenic
1201771442 Y:17620542-17620564 GCCTAACGCACAGTGTGTGGGGG - Intergenic
1201830113 Y:18285444-18285466 GCCTAACGCACAGTGTGTGGGGG + Intergenic
1202070828 Y:20990104-20990126 GGCCAACCCAGAGTGACTGGGGG + Intergenic