ID: 1156419301

View in Genome Browser
Species Human (GRCh38)
Location 18:36933646-36933668
Sequence GGTGCCCAACCCAGAGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156419301_1156419306 -9 Left 1156419301 18:36933646-36933668 CCACACCCTCTGGGTTGGGCACC 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1156419306 18:36933660-36933682 TTGGGCACCAGCTGTTCTAGGGG 0: 1
1: 0
2: 4
3: 11
4: 114
1156419301_1156419310 9 Left 1156419301 18:36933646-36933668 CCACACCCTCTGGGTTGGGCACC 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1156419310 18:36933678-36933700 AGGGGATCCAGGGTGCTTCCTGG 0: 1
1: 0
2: 2
3: 28
4: 303
1156419301_1156419309 -1 Left 1156419301 18:36933646-36933668 CCACACCCTCTGGGTTGGGCACC 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 107
1156419301_1156419308 -2 Left 1156419301 18:36933646-36933668 CCACACCCTCTGGGTTGGGCACC 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1156419308 18:36933667-36933689 CCAGCTGTTCTAGGGGATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1156419301_1156419305 -10 Left 1156419301 18:36933646-36933668 CCACACCCTCTGGGTTGGGCACC 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1156419305 18:36933659-36933681 GTTGGGCACCAGCTGTTCTAGGG 0: 1
1: 0
2: 0
3: 14
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156419301 Original CRISPR GGTGCCCAACCCAGAGGGTG TGG (reversed) Intronic
900167791 1:1250795-1250817 GGTGGGTGACCCAGAGGGTGGGG - Intergenic
903703819 1:25270313-25270335 GGTCCCCAACCCCCAGGCTGTGG + Intronic
903723424 1:25423011-25423033 GGTCCCCAACCCCCAGGCTGTGG - Intronic
904993152 1:34610219-34610241 GTTGCCCCTTCCAGAGGGTGTGG - Intergenic
905306296 1:37020872-37020894 GGTGCTGAACACAGAGGTTGGGG + Intronic
907111336 1:51929066-51929088 TGTGCCCATCCCAGTGGCTGGGG - Intronic
907452092 1:54552014-54552036 GGGGTCTAACCCAGAGTGTGGGG + Intronic
908456422 1:64308951-64308973 GGTGCCCAGCCCCGAGTCTGTGG + Intergenic
909415383 1:75400618-75400640 TGAGCCCAACACAGGGGGTGAGG - Intronic
913112331 1:115667550-115667572 GGTCCCCAACCCCCAGGGTAAGG + Intronic
914826279 1:151139854-151139876 GGTGCACAAGCCACGGGGTGTGG - Intronic
915558584 1:156673860-156673882 GGTCCCCCACACAGAGGATGAGG - Intronic
918229623 1:182515804-182515826 GGTGCCCTAGCCAGAAGGGGAGG + Intronic
920085331 1:203411398-203411420 GGTCCCCAACCCCCAGGCTGTGG - Intergenic
920244498 1:204577523-204577545 GATTCCCAGACCAGAGGGTGGGG + Intergenic
921731643 1:218585902-218585924 GGTGACCCTCCCAGAGGGTAGGG - Intergenic
922725736 1:227922231-227922253 GGTGGCCACCCCAGGGGCTGAGG - Intronic
922764232 1:228149251-228149273 GGTGCCCGACCCTGTGGGTCTGG + Intergenic
922781379 1:228255793-228255815 GGTCCCCAACCCCCAGGCTGTGG + Intronic
1063067418 10:2623777-2623799 GGTGCCCAGCCCAGATGCTGTGG - Intergenic
1063956598 10:11273207-11273229 GGTACCCAGCCCAGGGGTTGGGG - Intronic
1065925832 10:30433613-30433635 TGTCCCCACCCCAGAGCGTGGGG + Intergenic
1069330391 10:67284934-67284956 GGTGCCACCCCCAGGGGGTGAGG - Intronic
1069642010 10:69962245-69962267 GGTGCCCAAGCCACACAGTGAGG - Intronic
1070747088 10:78940298-78940320 GGTGCCCACCACAGAGCATGGGG + Intergenic
1075242718 10:120792993-120793015 GATGCCCAGCCCAGTGTGTGTGG - Intergenic
1076214906 10:128685778-128685800 GGAGCACAACCCTGAGGATGAGG - Intergenic
1076351117 10:129815928-129815950 GGTGCCCACCCCAGAGGGGAGGG - Intergenic
1076707501 10:132309669-132309691 GGTGCCCATCCCAGCAGGAGTGG + Intronic
1076788488 10:132764012-132764034 GGGGCCCTTCCCAGAGGCTGTGG + Intronic
1076993986 11:289468-289490 GGTCCCGACCACAGAGGGTGGGG + Intronic
1077062909 11:625579-625601 GGTGCCCGACAGAGGGGGTGAGG + Intronic
1078099589 11:8322048-8322070 GGTCCCCAACCCCCAGGCTGCGG + Intergenic
1078369189 11:10730951-10730973 TGAGCCCAACCCAGGAGGTGGGG + Intergenic
1078537489 11:12186768-12186790 GGTGCCCAGCACAGGTGGTGGGG + Intronic
1082244985 11:49911607-49911629 GGTACACAACCCAGACGGGGTGG + Intergenic
1084325215 11:68396280-68396302 GGTGGCCAACCCAGGTGCTGAGG + Intronic
1084895742 11:72266512-72266534 TGTGCCTACTCCAGAGGGTGAGG + Intergenic
1089080986 11:115776042-115776064 GCTGACCAAGCCAGAGTGTGAGG - Intergenic
1089118713 11:116117023-116117045 CATGCCCATCCCTGAGGGTGGGG + Intergenic
1089896316 11:121933534-121933556 GGTCCCCAACCCCCAGGCTGTGG - Intergenic
1090237008 11:125156416-125156438 GCTCCCCAACCCAAAGGGTGGGG - Intergenic
1090800526 11:130168752-130168774 GGTGCCCTCCCCTGGGGGTGGGG + Intronic
1091115595 11:133009865-133009887 GGTCCACAGCCCAGAGGTTGGGG + Intronic
1091346721 11:134859281-134859303 GGTGCCCATCCATGGGGGTGGGG - Intergenic
1091391935 12:131080-131102 GGCGGCCAAGCCAGAGGGTGGGG - Intronic
1094167406 12:27456763-27456785 GGTTCCCAACCCCCAGGCTGTGG + Intergenic
1097584859 12:61503336-61503358 GGTGCCCAACCCCCAGGGTCTGG + Intergenic
1099195302 12:79608552-79608574 GGTCCCCACCCCTCAGGGTGTGG - Intronic
1100678029 12:96889060-96889082 GGTTCCCAACCCCCAGGCTGTGG - Intergenic
1101399013 12:104372331-104372353 GGTCCACAGCCCAGAGGCTGGGG + Intergenic
1101470507 12:104992593-104992615 GGTTCCCAACCCCCAGGCTGTGG + Intronic
1105913648 13:24893563-24893585 GGGCCCCACCACAGAGGGTGTGG + Intronic
1110776248 13:79411398-79411420 AGTACCCAGCCCAGAGGCTGAGG + Intergenic
1113491863 13:110698676-110698698 GAAGCCCATCCAAGAGGGTGGGG - Intronic
1113927565 13:113950197-113950219 GGTTCCCAAGGCAGGGGGTGAGG - Intergenic
1113927629 13:113950445-113950467 GGTGCCCAAGGCAGGGGGTGAGG - Intergenic
1116111525 14:40591505-40591527 GGTCCCCAACCTACAGGCTGTGG + Intergenic
1116863505 14:50013131-50013153 GGTGCCCGACCCCGGGGTTGTGG - Intergenic
1118456869 14:65952492-65952514 GGTTCCAAACCTAGTGGGTGGGG + Intergenic
1118872818 14:69757620-69757642 GGTAACTAACCCAGACGGTGAGG - Intronic
1119719158 14:76879604-76879626 AGTGCACAGCCCAGAGTGTGGGG + Intergenic
1120988591 14:90355248-90355270 GGTCCCCAACCCCCAGGCTGTGG - Intergenic
1121574535 14:94972867-94972889 GGTGCTCAAACCCGAGGATGGGG + Intergenic
1122857284 14:104565947-104565969 GGTGCCTAGAGCAGAGGGTGGGG - Intronic
1122898303 14:104771435-104771457 GGTGCCCAGCCCAGACTCTGGGG - Intronic
1124619397 15:31265289-31265311 GGGGCCCACCCCAGAGGCTTAGG + Intergenic
1125643532 15:41251468-41251490 GGTCTGCAACCCAGAGGTTGGGG - Intronic
1126412147 15:48383529-48383551 GGTGCCGACCCCACAGGTTGAGG + Intergenic
1126511003 15:49474636-49474658 GGTCCCCAGCCCAGGGGTTGGGG - Intronic
1127901044 15:63341264-63341286 GGTGCCCAGCCCCCAGGCTGTGG + Intronic
1128764825 15:70244627-70244649 AGTGACCAACCCAAAGGGGGTGG - Intergenic
1129227815 15:74180072-74180094 GGTGCCCAGCCCTGAGGGCAGGG - Exonic
1131113247 15:89778187-89778209 GGTGCCCAACTCAGAGGACCAGG + Exonic
1131272746 15:90957006-90957028 GGGGACCAACCCAGAATGTGGGG - Intronic
1132571931 16:647955-647977 GGTTCCCACCCCAGGGGATGAGG + Intronic
1133205175 16:4228885-4228907 GGTCCCAAACCCAGAGTCTGGGG - Intronic
1134061677 16:11202995-11203017 AGTGCTGAACCCAGAGGGAGGGG + Intergenic
1134619554 16:15677246-15677268 GGAGCCCCACCCAGGGAGTGTGG + Intronic
1134867418 16:17620645-17620667 GGTGCCACATCCAGAGGGTCTGG - Intergenic
1137790358 16:51169971-51169993 GGTGCCAACCCCTGAGGCTGTGG + Intergenic
1139307381 16:65998673-65998695 TGTCCCCAACCCTGAGGCTGTGG - Intergenic
1139703893 16:68727045-68727067 GGTGCCCATCCACGTGGGTGTGG - Intergenic
1143406210 17:6678573-6678595 GTTGCCAACCCCAGAGGGTCAGG - Intergenic
1143871039 17:9957449-9957471 GGTGCCCAGGCCACAGGGTGGGG - Intronic
1145902204 17:28496393-28496415 GGTCCCCAAGCCAGAGGGAGGGG - Intronic
1147807177 17:43140082-43140104 GCTCCCCACCCCAGAGGATGGGG - Intergenic
1147907679 17:43833311-43833333 GGAGCCCGGCCCGGAGGGTGCGG - Intergenic
1149314669 17:55427862-55427884 GGTCCCCAACCCCCAGGCTGTGG + Intergenic
1149606318 17:57927474-57927496 ATGCCCCAACCCAGAGGGTGTGG - Intronic
1150060968 17:62067956-62067978 GGTGCTCAAGTCAGGGGGTGGGG - Intergenic
1150239565 17:63621589-63621611 GGTACCTAGACCAGAGGGTGTGG + Intergenic
1150307245 17:64096093-64096115 GGTCCCCAACCCCCAGGTTGTGG + Intronic
1151978014 17:77493189-77493211 CTTGCCCCACCCAGAGGGAGGGG + Intronic
1152140723 17:78534856-78534878 GGTGGCCAACCCAGAGGAGTTGG - Intronic
1152210039 17:78998265-78998287 GGAGCCTAACCCAGAGGAAGTGG - Intronic
1152652349 17:81500632-81500654 TAATCCCAACCCAGAGGGTGAGG + Intergenic
1152669219 17:81591932-81591954 GATGCCCAGCCCAGTGTGTGGGG + Intronic
1152904076 17:82960954-82960976 GGGGCCGACCCCAGAGGCTGTGG - Intronic
1153646857 18:7203696-7203718 GGTACACATCCCAGACGGTGGGG + Intergenic
1153701493 18:7698950-7698972 GGTCCCCAGCCCAGGGGTTGGGG - Intronic
1154040154 18:10846988-10847010 AGTGCCCAGCCCAGAGTGGGTGG - Intronic
1156372603 18:36484925-36484947 GCTGCAGAACCCTGAGGGTGGGG - Intronic
1156372613 18:36484965-36484987 TGTGGCCCACACAGAGGGTGTGG + Intronic
1156419301 18:36933646-36933668 GGTGCCCAACCCAGAGGGTGTGG - Intronic
1157286874 18:46382986-46383008 GGTTCCAGACCCAGGGGGTGGGG - Intronic
1160155670 18:76432210-76432232 GGTGCCGAAGGCAGAGGCTGCGG - Intronic
1161280678 19:3443945-3443967 GGGGCCCTACACAGAGTGTGTGG - Intronic
1162191944 19:8953823-8953845 GGTTTCCACCCAAGAGGGTGTGG + Exonic
1162840669 19:13354308-13354330 GGAGCCGAAGCCAGTGGGTGTGG - Intronic
1164632012 19:29768198-29768220 GCTGCCCTCCCCACAGGGTGGGG - Intergenic
1166688632 19:44810156-44810178 GGATGCCAGCCCAGAGGGTGAGG + Intronic
1167112881 19:47472110-47472132 GGTGCTGAACCCGGAGGCTGGGG - Exonic
1167721361 19:51182586-51182608 GGAGCCCAGCGGAGAGGGTGAGG - Intergenic
1167763615 19:51464184-51464206 GGAGCCCAGCGGAGAGGGTGAGG + Intergenic
1168064715 19:53912593-53912615 GGAGCCCAGCCCTGAGGCTGAGG + Intronic
925384063 2:3449775-3449797 CGTGCCTGACCCAGAGGGTTTGG + Intronic
926796987 2:16627257-16627279 ATTGCCCACCCCGGAGGGTGGGG - Intronic
926853147 2:17223078-17223100 GTTGCACAACCCAGAGGCAGAGG + Intergenic
927860481 2:26557372-26557394 GCTGCCCAGCCCTGAGGGTTGGG - Intronic
930740938 2:54832044-54832066 GTTGCCCAAGCCAGGGGGAGAGG - Intronic
932699699 2:73984637-73984659 GGTGGCCAACCCGAAGGGGGCGG + Intergenic
933040870 2:77464822-77464844 ATTGCCCAACCCAGAGGTTCTGG - Intronic
939961387 2:148568981-148569003 GGTGACCCCCCCAGAGGGAGTGG + Intergenic
940769517 2:157825410-157825432 GGTCCCCAACCCCCAGGCTGTGG + Intronic
944588645 2:201196416-201196438 GCTGGCCAACCCAGAGGGCAAGG + Intronic
944852174 2:203731184-203731206 GTTGCCCAACCCTGAAGGTGGGG + Intronic
945157073 2:206850060-206850082 GGTCCCCAACCCCTAGGCTGTGG - Intergenic
946247650 2:218396658-218396680 AGTGCCAAACCCAGAGGAGGCGG - Exonic
946861780 2:224006870-224006892 GGTGCCCAGCCCATAAGGGGTGG - Intronic
948346122 2:237299758-237299780 GATGACCAACACAGAGGATGAGG + Intergenic
948444898 2:238025010-238025032 AGTCCCAAACCCAGGGGGTGTGG + Intronic
948476930 2:238226481-238226503 GATGCCCACCCCCGAGAGTGGGG + Intronic
948628969 2:239289644-239289666 CGTGCCCAACACAGTGGCTGAGG - Intronic
1170420680 20:16189874-16189896 TGAGCCCAGCCAAGAGGGTGAGG - Intergenic
1171147439 20:22797680-22797702 GTTGCCAAACATAGAGGGTGGGG - Intergenic
1171389598 20:24792881-24792903 GCTGCCCTACCCAGAGGTGGTGG - Intergenic
1171461707 20:25301713-25301735 AGAGCCCAAGCCTGAGGGTGAGG - Intronic
1172227242 20:33313338-33313360 CGTGCCCAACCTGAAGGGTGGGG - Intergenic
1172835547 20:37870776-37870798 GGGGCCATACCCAGATGGTGTGG - Intronic
1173248504 20:41352256-41352278 GGTGCTGAGCCCAGAGGATGGGG + Intronic
1174368313 20:50069653-50069675 GGCTCCTAACCCAGAGGGAGGGG + Intergenic
1174601665 20:51729911-51729933 GGTGCCCCAGCCAGACAGTGCGG + Exonic
1175211678 20:57361841-57361863 GGTCCCCAACCCCCAGGCTGTGG + Intronic
1176159240 20:63640277-63640299 GGAACTCAGCCCAGAGGGTGTGG + Exonic
1176268241 20:64221820-64221842 GGCGCCCAACCCAGTGGGCGAGG - Intronic
1176412775 21:6457895-6457917 GGTGCCAGGCCCAGAGGGGGTGG - Intergenic
1179688268 21:43066217-43066239 GGTGCCAGGCCCAGAGGGGGTGG - Intronic
1181567331 22:23747179-23747201 GGTCCCCAACCCCCAGAGTGGGG + Intronic
1181778745 22:25178225-25178247 GGAACTCAGCCCAGAGGGTGTGG + Intronic
1183360182 22:37379307-37379329 TGTGACCAGCCCAGAGGGAGAGG + Intronic
1183541952 22:38434590-38434612 GGTCCCGAAGCCAGAGGCTGGGG - Intronic
1185141155 22:49102044-49102066 GGCCCTCAGCCCAGAGGGTGTGG - Intergenic
950291367 3:11787094-11787116 GGTGCCCAAGCCACTGGGAGAGG - Intergenic
951758402 3:26117930-26117952 GGAACCCAACCCAGAGGGTGGGG + Intergenic
952816705 3:37452802-37452824 GGGTCCCAGCCCAGAGCGTGGGG + Intronic
954362297 3:50128474-50128496 GCTGCCTAAGCCAGAGGGTGAGG - Intergenic
957051499 3:75415589-75415611 GGTGCCCACCTCAGGGTGTGTGG - Intergenic
958824861 3:99017837-99017859 GGTGTCCATGCCAGAGAGTGGGG - Intergenic
960235948 3:115282319-115282341 GGAGCCCAACCCAGTGTGTTTGG - Intergenic
961121429 3:124374542-124374564 GGTGACCAAATCAGAGGGTTTGG - Intronic
961739020 3:129020901-129020923 GGTGCCCACCCCTGTGGGTTTGG - Intronic
964387787 3:156167218-156167240 GGTGGCCAAGCTTGAGGGTGTGG + Intronic
965198170 3:165625277-165625299 GGTGCCCAAGTCAGAAGGGGAGG + Intergenic
968733938 4:2285618-2285640 TGTGCTCAACCCAGGGGCTGTGG - Intronic
969321124 4:6413545-6413567 GGTGTGCATCCCAGAGGCTGGGG + Intronic
969479036 4:7437366-7437388 GGTGGCACACCCAGAGGGTGTGG - Intronic
969681387 4:8645254-8645276 GGTTCACACCCCAGAGTGTGAGG - Intergenic
972061468 4:34879062-34879084 GGTCTCCAACCCCCAGGGTGTGG + Intergenic
972338457 4:38129363-38129385 GGTGCCATACCAGGAGGGTGGGG + Intronic
976692482 4:87883668-87883690 GGAGCAGAACCCAGAGGTTGAGG + Intergenic
977036957 4:91965997-91966019 GGGGAACAACACAGAGGGTGGGG - Intergenic
981348797 4:143704522-143704544 GGTGCCCATCCCGGAGGGCATGG - Intergenic
983872603 4:172839155-172839177 GGGGCCCCTCCCAAAGGGTGTGG - Intronic
984481324 4:180306641-180306663 GGGGCCTGTCCCAGAGGGTGGGG - Intergenic
986237847 5:5928444-5928466 GCTTCCAAACCCAGGGGGTGGGG - Intergenic
986977484 5:13410396-13410418 GTTGTTCAGCCCAGAGGGTGAGG - Intergenic
988586469 5:32511767-32511789 GGTCCCAACCCCAGAGGGCGAGG + Intergenic
991950107 5:71939094-71939116 GGCGCCCAACCCAGGGGCTTTGG - Intergenic
992487266 5:77209697-77209719 ACTGCCCAGCCCAGAGTGTGAGG + Intergenic
993859974 5:93124358-93124380 GGTCCCCAACCCCGAGGCTGCGG + Intergenic
994671585 5:102767950-102767972 GGTCCCCAAGCCAGAGTCTGTGG - Intronic
997304619 5:132828377-132828399 GGTCCCCAACCCTAAGTGTGAGG - Intronic
998830449 5:146152332-146152354 GGTTCCCAACCCCAAGGATGTGG + Intronic
1001880032 5:175235357-175235379 GGTGCCCACCCCAGCAGCTGGGG + Intergenic
1006342000 6:33452253-33452275 GGTGCCACACCCCCAGGGTGGGG - Exonic
1006677632 6:35775894-35775916 TGTGAGCAGCCCAGAGGGTGGGG + Intergenic
1006831482 6:36970768-36970790 GGAGCTCAGCACAGAGGGTGGGG - Intronic
1007212898 6:40211158-40211180 AGTGCCTAACCCAGTGTGTGTGG - Intergenic
1007765896 6:44159492-44159514 GGTGCCCCAGGCTGAGGGTGAGG - Intronic
1014752281 6:125269177-125269199 GGTGCCCTACCTACAGGGTGAGG - Intronic
1016343563 6:143086990-143087012 CGCTCCCAACCCAGAGGGTTGGG + Intronic
1016764599 6:147778144-147778166 AGTAGCCAACCCAGAGGGTGTGG + Intergenic
1018054119 6:160036838-160036860 GGAACCAAACCCAGAGGGTGTGG - Intronic
1018699242 6:166413435-166413457 GGAGTCCCACCCAGAGGATGGGG + Intronic
1024348591 7:48339074-48339096 GGAGCCTAACCCAGTTGGTGGGG + Intronic
1024385708 7:48748950-48748972 GGTGCAGAGCCCAGAGGGTTTGG - Intergenic
1025943894 7:66092125-66092147 GGTGCCCCCCCCAGAGGGTGGGG + Intronic
1027425807 7:78060725-78060747 TGTGCCCAACCCTGAAGGTGGGG + Intronic
1031120125 7:117712903-117712925 GGTCCCCAAGCCACAGGCTGTGG + Intronic
1034269733 7:149797745-149797767 GGTCAGCAACCCAGAGTGTGTGG + Intergenic
1034411036 7:150942325-150942347 GGTGCCCAGCCCTGCGGGAGGGG + Intergenic
1035727200 8:1831977-1831999 GGTGCCCGAGCCTGTGGGTGTGG + Intronic
1038415757 8:27394155-27394177 TGTACCCAACCCAGAGAGTGAGG - Intronic
1038488126 8:27950649-27950671 GCTTCCCAACCCACAAGGTGAGG - Intronic
1039618819 8:38978167-38978189 GGTGCCCAACCCATGGGCTGTGG + Intronic
1042976819 8:74478712-74478734 GGTGCGGAGCCCAGAGGGTCTGG - Intronic
1044224157 8:89700929-89700951 TGTGCTGAACCCAGAGGGTGTGG - Intergenic
1045891556 8:107164140-107164162 GGTCCCCAACCCTGAGGCCGTGG + Intergenic
1047732010 8:127735970-127735992 GGTTCCCAAAGCAGAGGGCGTGG + Intronic
1049044240 8:140136844-140136866 GGTGCCCAAGTCAGAGGGACAGG + Intronic
1049670954 8:143869647-143869669 GGTGCCCGGCCCACGGGGTGAGG - Exonic
1049854769 8:144854371-144854393 GGTCCCCAACCCTCAGGCTGTGG + Intergenic
1053187022 9:36024943-36024965 GGTGCCCAAGCTAGAGGTTGTGG + Intergenic
1057444743 9:95105649-95105671 GTTTCCCAAGGCAGAGGGTGGGG - Intronic
1058730865 9:107848682-107848704 CGTGCCCAACCCAGAGGAGGAGG - Intergenic
1060089558 9:120731050-120731072 GCTTCCCAGCACAGAGGGTGGGG - Intergenic
1060379262 9:123150790-123150812 GAGGCCCAACCCAGTGTGTGGGG - Intronic
1061009172 9:127945251-127945273 GGTCCCCACCTCAGAGGGTTGGG - Intronic
1061884332 9:133584027-133584049 GATGGGCATCCCAGAGGGTGGGG - Intronic
1061918243 9:133768415-133768437 GTGGCCCCACCCTGAGGGTGTGG - Intronic
1062152696 9:135030104-135030126 GAGGCCCAACCCGCAGGGTGGGG - Intergenic
1062321420 9:135992346-135992368 GCCACCCTACCCAGAGGGTGAGG + Intergenic
1062337666 9:136079511-136079533 GGTGCCCATGCCTGCGGGTGAGG - Intronic
1185778897 X:2829109-2829131 GGGGCGCAACCCAGAGGCCGAGG + Intronic
1187091355 X:16100071-16100093 GGTGCACAACCAAAAGGGAGTGG + Intergenic
1189051956 X:37654739-37654761 GGTGCCTAACACAGAGTCTGAGG - Intronic
1190070281 X:47273737-47273759 GATGCCCAACCCACACAGTGAGG - Intergenic
1192432496 X:71121870-71121892 GGTGCCCATCCCAGAGAATAGGG + Intronic
1192564463 X:72152028-72152050 GGAGCCCATCCCAGGGGCTGAGG - Intergenic
1195597820 X:106713123-106713145 GGTGCCCAAGGCGGGGGGTGGGG - Intronic
1196323911 X:114378500-114378522 GGTTCCCAATCCAAAGTGTGGGG - Intergenic
1197708944 X:129652848-129652870 GGTGCTCCCCCCAGAGGCTGTGG - Intronic
1199389649 X:147264138-147264160 GGTCCCCAACCCCCAGGCTGTGG + Intergenic