ID: 1156419302

View in Genome Browser
Species Human (GRCh38)
Location 18:36933651-36933673
Sequence CAGCTGGTGCCCAACCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156419302_1156419308 -7 Left 1156419302 18:36933651-36933673 CCCTCTGGGTTGGGCACCAGCTG 0: 1
1: 0
2: 2
3: 37
4: 241
Right 1156419308 18:36933667-36933689 CCAGCTGTTCTAGGGGATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1156419302_1156419309 -6 Left 1156419302 18:36933651-36933673 CCCTCTGGGTTGGGCACCAGCTG 0: 1
1: 0
2: 2
3: 37
4: 241
Right 1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 107
1156419302_1156419310 4 Left 1156419302 18:36933651-36933673 CCCTCTGGGTTGGGCACCAGCTG 0: 1
1: 0
2: 2
3: 37
4: 241
Right 1156419310 18:36933678-36933700 AGGGGATCCAGGGTGCTTCCTGG 0: 1
1: 0
2: 2
3: 28
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156419302 Original CRISPR CAGCTGGTGCCCAACCCAGA GGG (reversed) Intronic
900589499 1:3453464-3453486 CAGCCTGTGCCCTGCCCAGATGG + Intergenic
901690679 1:10971236-10971258 CAGCCTGTGCCCAGACCAGAGGG + Intronic
902810275 1:18884227-18884249 GAGCTGACGCCCACCCCAGAGGG + Intronic
902822691 1:18953069-18953091 CAGAAGGAGCCTAACCCAGAAGG - Intronic
909412710 1:75373804-75373826 CAGCTGGCACTCAACCCTGAGGG + Intronic
910610356 1:89134483-89134505 CAGCAGGTGCTTAACCTAGAGGG + Intronic
913416961 1:118619312-118619334 CATCTGATGCCCAACCGTGAAGG - Intergenic
916341933 1:163745864-163745886 CAGCTGGTGCCCACCCATGGAGG - Intergenic
916657671 1:166891477-166891499 CAACTGGAGCTCAATCCAGATGG - Intergenic
917080307 1:171251406-171251428 CAGCTGGTGCCCCCTCGAGAGGG + Intronic
921802765 1:219419957-219419979 AAGCTGGTGCCAAAACCACAGGG + Intergenic
924456047 1:244219645-244219667 CCTCTGGTGCCCAGCCCAGGAGG + Intergenic
924710439 1:246526644-246526666 CAGCTGGTGGCCTAAGCAGAAGG + Intergenic
1063819538 10:9819132-9819154 CAGCTGATGCAGAGCCCAGAGGG + Intergenic
1065380370 10:25083987-25084009 CAGCTGATCCCCTCCCCAGAGGG + Intergenic
1066686821 10:37989496-37989518 CTGCTGGTGCTTAACCCAGATGG + Intergenic
1067018325 10:42773760-42773782 GAGCTGCTGTCCAAGCCAGAGGG - Intergenic
1067087642 10:43251277-43251299 GACCTGGTGCCGAACCCACAGGG - Intronic
1067348526 10:45455629-45455651 GAGCTGGTGGCCACACCAGATGG + Exonic
1068397895 10:56487772-56487794 CAGCAGGTTCCCAACCTTGAGGG - Intergenic
1070485316 10:76924900-76924922 GAGCTGGTTTCCAACACAGAGGG + Intronic
1073600127 10:104838518-104838540 CCCCTGGAGCCCAGCCCAGAAGG - Intronic
1073816516 10:107213841-107213863 CAGCTGGTGCTTAACCTCGAGGG - Intergenic
1074226824 10:111493263-111493285 CAGCTGGTGGCAAAGCCAGCTGG + Intergenic
1074687752 10:115975603-115975625 CAGCTGGTTTCCAACACAGAGGG - Intergenic
1075003488 10:118814561-118814583 CAGCTGAGGCCATACCCAGAGGG - Intergenic
1076351120 10:129815933-129815955 GAGGGGGTGCCCACCCCAGAGGG - Intergenic
1076452883 10:130568985-130569007 CAGCTGGTGCCCATCTCTGGAGG + Intergenic
1076583453 10:131530311-131530333 CATCTTGGGCCCAAGCCAGAGGG + Intergenic
1076758718 10:132589406-132589428 CACCTGGTTCCAAACCCTGAGGG + Intronic
1079419075 11:20269266-20269288 CAGGTTGTACCCAACACAGATGG - Intergenic
1081371717 11:42312614-42312636 CAACTGCTGCCCAAACAAGATGG + Intergenic
1081379246 11:42394751-42394773 CAGCCTGTGCACAGCCCAGAAGG + Intergenic
1083393486 11:62372463-62372485 CAGCTGGGACACAACTCAGATGG + Intronic
1083779044 11:64908868-64908890 CAGCTCATGCCCACCCCAGGTGG + Intronic
1084266497 11:68008029-68008051 CTCCTGGTGCCCTACCCAGAGGG + Intergenic
1086455305 11:86954873-86954895 CAGCTCGTGCCCAACCAGGTTGG + Exonic
1086557210 11:88125235-88125257 AAACTGGTGCCCAACCAATATGG + Intronic
1087094368 11:94305683-94305705 CAGCTCGTCCCCAGCCCAGGTGG - Exonic
1087107371 11:94423743-94423765 CAGCTGGTGCCTGACCCTGAGGG + Intronic
1087327241 11:96738817-96738839 CAGCCAGTGCCCAACCCCAAGGG - Intergenic
1090205184 11:124879927-124879949 CAGCGGGTGCTCCACCCAGATGG + Exonic
1091214592 11:133892997-133893019 CTGTTGGTGGCCAACCCAAAAGG - Intergenic
1091358840 11:134958394-134958416 CTGCTGCTCCCCGACCCAGAAGG + Intergenic
1091850591 12:3693868-3693890 CAGCTGATGCAGAGCCCAGAGGG - Intronic
1092771555 12:11901851-11901873 AGGCTGGTGCCCAACACAGCTGG + Intergenic
1094626050 12:32125121-32125143 CAGTGGGTGCCCAAACCAAAGGG - Intronic
1096919825 12:55072109-55072131 CTGCTGGTGCCCAAAGCAGCTGG - Intergenic
1099635434 12:85205970-85205992 CAGCAAGTTCCCAACCCTGAGGG - Intronic
1101325568 12:103712535-103712557 CAGCTGGTGCCAACCACTGATGG + Intronic
1102016950 12:109654399-109654421 GAGCGGGCGCCCACCCCAGAGGG - Intergenic
1104915420 12:132261925-132261947 CAGCTGGAGCCCAAGCCCCATGG - Intronic
1106237825 13:27879821-27879843 CAGTGGATGCCAAACCCAGAGGG + Intergenic
1106459620 13:29957508-29957530 CTGCTGGTTCCCAACACAGAAGG - Intergenic
1106619200 13:31357266-31357288 CTGCTGGTGCCCCAGCCTGACGG + Intergenic
1106797461 13:33221517-33221539 CAGCAGGAACCCAACTCAGAGGG - Intronic
1108840736 13:54611492-54611514 ATGCTGGTGCCCTACCCAGAGGG + Intergenic
1109211355 13:59538881-59538903 CAGCTGGTGCCCAAACACGGAGG - Intergenic
1109934482 13:69264037-69264059 CAGCAGGTTCCTAACCCAAAAGG - Intergenic
1109973984 13:69807342-69807364 CAGCTGCTGCCTAGCCAAGAAGG + Intronic
1111064385 13:83071910-83071932 CAGCTGGTGCTCAACCTTAAGGG + Intergenic
1111113711 13:83749450-83749472 CAGCTGATGCGGAGCCCAGAGGG + Intergenic
1112916442 13:104556418-104556440 CAGCTGGGAGCCAACACAGAGGG - Intergenic
1114327264 14:21601992-21602014 CAGCTGCTGCCCCATCCAGGGGG + Intergenic
1114549632 14:23525502-23525524 CAGCTTGTCCCCACCCCCGAGGG + Exonic
1115120280 14:29928765-29928787 CAGGTTGTGCCCAATCCTGATGG - Intronic
1115869014 14:37778989-37779011 CAGCTTGTGCAAAGCCCAGAGGG - Intronic
1116472872 14:45305985-45306007 CAGCTGGTGCTTGACCCTGAGGG - Intergenic
1116984390 14:51203920-51203942 CAACTGGTGCTCAACCCCAAGGG - Intergenic
1118350604 14:64970938-64970960 GAGCTGGTGCCCATCCCTGATGG + Intronic
1119298652 14:73553105-73553127 GGGCTGGTGCCCCACCCCGAAGG + Intronic
1120159281 14:81128694-81128716 CAACTAGTGCCCAACCCCTAAGG - Intronic
1121048239 14:90803381-90803403 CAGATGGAGCCCAACCAAGCAGG + Intronic
1122328767 14:100899118-100899140 CAGCCTGAGCCCCACCCAGAAGG - Intergenic
1122771420 14:104099588-104099610 CAGCAGGAGCACACCCCAGACGG - Intronic
1123771327 15:23532334-23532356 CAGCTGGTGCTTTTCCCAGATGG + Intergenic
1123948852 15:25251867-25251889 CAGCTGATGGCCAACCAAGGAGG - Intergenic
1124963319 15:34414375-34414397 ACGATGGTGCCCAAGCCAGAAGG - Intronic
1124979939 15:34560601-34560623 ACGATGGTGCCCAAGCCAGAAGG - Intronic
1126194551 15:45917697-45917719 CAGCTGGTCCCCAACAGTGAGGG + Intergenic
1128398631 15:67254594-67254616 CAGCTGGTGACTAACGCACAGGG + Exonic
1128979144 15:72174281-72174303 CAGCTGGGCCCTGACCCAGAGGG + Intronic
1129253039 15:74319146-74319168 CAACTGGGGCCCAAACCAGAAGG - Intronic
1130150628 15:81308874-81308896 CTGCTGCCGCCCCACCCAGATGG + Intronic
1130300606 15:82677670-82677692 CAGCTGCTGTCCAACCGTGATGG - Exonic
1132891483 16:2206974-2206996 TTGTTGGTGCCCTACCCAGATGG - Intronic
1136501291 16:30670682-30670704 AGGCTGGGGCCCAACCTAGAAGG + Exonic
1136567627 16:31079694-31079716 CAGGTTGGGCCCATCCCAGAAGG + Exonic
1137486330 16:48894495-48894517 CAGCTGCTGTGCAACCCACATGG - Intergenic
1137725276 16:50652666-50652688 AAGCTGGAGCCCAGCTCAGATGG - Intergenic
1138529264 16:57626221-57626243 CAAGTGGTACCCAACCCACAGGG + Intronic
1139962955 16:70728404-70728426 CAGCTCCTGCCCAGCCCAGTGGG + Intronic
1140027496 16:71303970-71303992 CAGAAGGAGCCCAATCCAGAAGG + Intergenic
1141072793 16:80973287-80973309 CAGCTGGGGCCCCACTCAAACGG + Exonic
1141230687 16:82164480-82164502 CAGCAGGTGCCAAAGCCAGTGGG - Intronic
1141485799 16:84339493-84339515 CAGCTGCTTCCCAGACCAGACGG - Intergenic
1141647767 16:85376644-85376666 GAGCTGGAGGCCAGCCCAGAGGG + Intergenic
1142241393 16:88948461-88948483 CATCTGGTGCCCACACCAGACGG - Intronic
1142257913 16:89024166-89024188 CAGCTGGTTGCCCACCCACAGGG + Intergenic
1143833193 17:9669159-9669181 CTTCAGGTGCCCAACGCAGAGGG + Intronic
1146358919 17:32158891-32158913 CAGCTGATGGCCACTCCAGATGG - Intronic
1148866578 17:50631851-50631873 CTGCTGCAGCCCAACCCACAAGG + Intergenic
1150227037 17:63529904-63529926 CAGCTGGTGCTCCACCCACAGGG - Intronic
1151312862 17:73304904-73304926 CAGCTGGTTCCCAGCCCACAAGG - Intronic
1151356165 17:73559879-73559901 CAGCTGGTGCCCAGCCCTGGGGG - Intronic
1151392607 17:73797753-73797775 CAGCTGGTGCCCACCCCTCTGGG - Intergenic
1152385460 17:79971701-79971723 AAGCTGGTGCCCGACCCACCAGG + Intronic
1155179903 18:23335428-23335450 CTGCTGGTGCCCCAACCAGAGGG - Intronic
1156419302 18:36933651-36933673 CAGCTGGTGCCCAACCCAGAGGG - Intronic
1157175570 18:45449028-45449050 CAGCAGGTGGCCATCCCAAAGGG + Intronic
1158279726 18:55810844-55810866 AAGCTGGTTCACAACACAGAAGG - Intergenic
1159920023 18:74219833-74219855 CAGCTGGTGCTCACCCTAGCAGG + Intergenic
1160423826 18:78767157-78767179 GAGCTGGGGCCCAGCCCAGCTGG + Intergenic
1160704332 19:522920-522942 CAGCTGGTGCCCAGTCCAGAGGG - Intergenic
1161073803 19:2275432-2275454 GAGCTGCTGCCCAACACAGGAGG + Exonic
1161276574 19:3421510-3421532 CGGCTGCTGTCCAGCCCAGATGG + Intronic
1163122851 19:15228247-15228269 TAGCTGGTGCCCAGGCCAGGAGG - Intronic
1163510466 19:17732342-17732364 CAGCTGCTGCCCAGCTCAGGGGG - Intronic
1164574807 19:29399670-29399692 CAGCATGTGCCCCAGCCAGAGGG + Intergenic
1165838836 19:38774800-38774822 CAGCTCCTGCCCCACCCAGCAGG + Intergenic
1166792012 19:45404273-45404295 CAGCTGTTTCCCACCCCATAAGG + Intronic
1167036422 19:46997751-46997773 CAGCAGGTGACGTACCCAGAGGG - Intronic
1167304098 19:48696889-48696911 CAGCTGGTGACAAAGCCGGAGGG + Intronic
1167345688 19:48944368-48944390 CTGCTGGTGCCCGACCGAGCTGG + Exonic
1168708435 19:58482840-58482862 CAGCTAGGCCCCAGCCCAGAAGG + Intronic
925164945 2:1710272-1710294 CAGGTGTTGCCCAAGCCTGAAGG + Intronic
928428934 2:31202039-31202061 CAGATGGTGATCAGCCCAGAAGG + Intronic
929441693 2:41970275-41970297 CAGCTGGTGCTGAACCGAGGAGG - Intergenic
930993238 2:57685513-57685535 CAGCCAGTGCCCAACCCCCAGGG + Intergenic
932542008 2:72664879-72664901 CAGCCAGTGCCCATCCCAGAGGG + Intronic
935744986 2:106182645-106182667 CAGCTGTGCCCCAACCCAGAGGG + Intronic
936956112 2:118023954-118023976 CAGCTGTTGGACAGCCCAGAGGG - Intergenic
937126615 2:119478743-119478765 AAGCTGAGGCCCCACCCAGAGGG + Intronic
937516712 2:122663791-122663813 CAGCTGGTGCCTAAAGCAGAGGG + Intergenic
938392304 2:130915789-130915811 CAGCTGGAGCCCAAAGCAGGCGG + Intronic
938585715 2:132688607-132688629 CTGCTGCTGCCCAACCCCGCAGG - Intronic
941858544 2:170254593-170254615 CAGCTGGTGCTTGACCCAGAGGG + Intronic
942599387 2:177625392-177625414 CAGCTGGTGGCCAAGCTAGGAGG + Exonic
942734836 2:179097512-179097534 CAGCTGATGCCCACCCTGGAGGG - Intergenic
943153125 2:184138781-184138803 CAGCTGGTGTGGAGCCCAGAGGG - Intergenic
943599340 2:189895488-189895510 CTACTGGAGCCTAACCCAGAAGG + Intronic
946612964 2:221478939-221478961 CAACTGGTTTTCAACCCAGAAGG + Intronic
947621947 2:231596429-231596451 CAGCTGGGGCCCACTGCAGAGGG + Intergenic
947629468 2:231642749-231642771 CTGCTAGTGCACAACCCAGAGGG - Intergenic
947832252 2:233149850-233149872 CAACTGGTGCCCAACCTCCAGGG + Intronic
947875168 2:233462883-233462905 CGGCTGGTGCCCACCCCTGCTGG + Intronic
948305968 2:236947039-236947061 CAGCTGGTGCTAACCCCACATGG + Intergenic
948565072 2:238879678-238879700 CAGCTGGTGCTTGACCCAGCTGG - Intronic
1170778804 20:19404847-19404869 CACCTGGTGCCCAAGCAAGATGG + Intronic
1171055785 20:21904774-21904796 CAGCTTGTGTCCCACTCAGAGGG + Intergenic
1171321610 20:24249061-24249083 CAACTGCTGCCCAGCCCAGCAGG + Intergenic
1171966608 20:31535474-31535496 GACCTGGTGCCCAATCCACATGG + Intronic
1172947518 20:38700816-38700838 CAGCTGGGTCCCACCACAGAGGG - Intergenic
1172987157 20:39000856-39000878 CAGCTGGTGCCCACTGCAGAGGG - Intronic
1173181956 20:40812546-40812568 CAGCTGCTGCCCCACTCAGGAGG - Intergenic
1174327356 20:49789954-49789976 CAGCTGGGGCTCAACCCTGCTGG - Intergenic
1175391358 20:58629410-58629432 CAGCTGCTGCCCAGCCCAGTGGG - Intergenic
1176039115 20:63055117-63055139 CAGCTGGGGCCCAACCCCAGTGG + Intergenic
1177133866 21:17290075-17290097 CAGCAGGTTCCTAACCCTGAGGG + Intergenic
1180192557 21:46173046-46173068 CAGCTGAAGCAGAACCCAGAGGG + Intronic
1181039590 22:20185564-20185586 CAGATGCTGCCCCTCCCAGAAGG + Intergenic
1183360180 22:37379302-37379324 CAGCCTGTGACCAGCCCAGAGGG + Intronic
1183862657 22:40680996-40681018 CAGATGGTGCCGAACACCGAAGG - Exonic
1185225096 22:49647700-49647722 CAGGGGGATCCCAACCCAGAGGG + Intronic
1185368059 22:50445978-50446000 CAGCTGGTGACCTGGCCAGAGGG - Exonic
949300519 3:2578378-2578400 AAGCTCATGACCAACCCAGAAGG + Intronic
951758398 3:26117925-26117947 CACCTGGAACCCAACCCAGAGGG + Intergenic
951822367 3:26827141-26827163 CAGCTGATGAGCAGCCCAGAGGG + Intergenic
952635300 3:35522152-35522174 CTGTTGGTGCCCCTCCCAGAGGG - Intergenic
953012473 3:39040044-39040066 CACCTGGTGCCCACCACAGCTGG + Intergenic
953903066 3:46854145-46854167 CAGGTGGTGCCCTACCCCGGAGG + Intergenic
954301690 3:49703804-49703826 CAGCTTGTGCTCATCCCTGAAGG - Intronic
954451261 3:50572922-50572944 GAGCTGGTGGGCAAGCCAGAGGG + Intronic
956948629 3:74253727-74253749 CAGCTGCTGGCCAATTCAGATGG + Intergenic
960950548 3:122996108-122996130 CAGCTGGCGCCCATCCAAGTTGG - Intronic
962981946 3:140498480-140498502 CAGATGGTGCCGAGCTCAGAGGG + Intronic
964499577 3:157333947-157333969 CTGATGGTGGCCAGCCCAGAAGG - Intronic
965253056 3:166368116-166368138 CAGCTGGCACCCAACCAAAAAGG + Intergenic
965545795 3:169915206-169915228 CAACTGGTGCTCAACCCTGCTGG - Intronic
965660788 3:171039932-171039954 CAGTTGGTACCCAATCCAGATGG + Intergenic
968962041 4:3750584-3750606 TAGGTTGGGCCCAACCCAGACGG + Intergenic
969501922 4:7558712-7558734 CACCTGGTGCCTACCCCAGGGGG + Intronic
970753940 4:19401043-19401065 CAGCTGGGGCTCAAGGCAGAGGG + Intergenic
973780138 4:54281139-54281161 CAGCTGATGCCCAGACCAGATGG + Intronic
976419079 4:84817474-84817496 CAGCTGGTGCTCTCCCCAAATGG - Exonic
976974301 4:91147640-91147662 CAGCTGGTGCTCCACCCTAAGGG - Intronic
977607211 4:98995527-98995549 CAGCTGGTGCCCCGCCCCGCCGG - Intergenic
978054755 4:104249504-104249526 CAGCTTGTGCAGACCCCAGAGGG - Intergenic
979076195 4:116274585-116274607 CAGCCTGGGCACAACCCAGAAGG + Intergenic
980752919 4:137115833-137115855 CAGCTGGTGCCCACCCCGAGAGG + Intergenic
981279912 4:142945774-142945796 CAGCTGGCACTCAACCCTGAGGG + Intergenic
981511800 4:145566091-145566113 CAGCTGGTGCAGAGCCCAGAGGG + Intergenic
983562643 4:169116424-169116446 CAGCTGCTGCACAGGCCAGAGGG + Exonic
985559909 5:579846-579868 AAGCTGGGGCCAAACCCGGACGG - Intergenic
985639317 5:1056214-1056236 CAGCTAGCGCCTGACCCAGAAGG + Intronic
985652958 5:1115544-1115566 CAGCAGGTTCCCAGCCCAGAAGG - Intergenic
985720582 5:1486568-1486590 CAGCTGGAGCCCAAGGCAGCAGG + Intronic
986517529 5:8579892-8579914 CAGTTGGTGCCAAACTGAGAAGG + Intergenic
986574427 5:9197364-9197386 CAGCTGCTGCCCAGTCCATAGGG - Intronic
989779452 5:45246939-45246961 CAGCAGGTGCCCAACCTCAAGGG - Intergenic
991027960 5:62051694-62051716 CAGCAGGTTCCCAACCTCGAGGG - Intergenic
994119872 5:96101841-96101863 CTGCTGGTGCCCAAAGCAGCTGG - Intergenic
994897700 5:105726281-105726303 CAGCTGGTGCCTGACCCCAAGGG - Intergenic
995462798 5:112420166-112420188 CAGCTGATACCCCGCCCAGAAGG - Intergenic
996663075 5:126027117-126027139 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
997186104 5:131883937-131883959 CAGCTGGTGCCCACCCATGGAGG + Intronic
997800318 5:136854196-136854218 CAGCAGGCTCCCCACCCAGAAGG + Intergenic
998276029 5:140753986-140754008 CAGCTGGTGCAGAGCCCAGAGGG - Intergenic
999749679 5:154618234-154618256 CTGCGGGTGCCCAATCCAGTTGG - Intergenic
1002698841 5:181108644-181108666 CACCTAGTGCTCCACCCAGACGG - Intergenic
1004506341 6:16249900-16249922 CAGCAGGTCCCCTGCCCAGAAGG - Intronic
1007789762 6:44302280-44302302 CAGCTGGAGCCCAACCCAATTGG + Intronic
1010299614 6:74244315-74244337 CAGCTGATGTCCACCACAGAGGG - Intergenic
1010408204 6:75529883-75529905 AAGCTGGTGTTCAACCTAGATGG - Intergenic
1010628986 6:78174824-78174846 CAGCTACTGCCCAGCCAAGAGGG + Intergenic
1011519830 6:88193398-88193420 CAGCTGGTCCCCAGCCCAGGTGG - Intergenic
1011914708 6:92488957-92488979 CAGCTGAAGCCCACCACAGAGGG - Intergenic
1012464883 6:99506064-99506086 CAGCTGGTGCCCAACCCTTCTGG + Intronic
1013368925 6:109454202-109454224 CAGCTGCTGCCCTCCCCAGGAGG - Exonic
1013992179 6:116265883-116265905 CATCTGATGCAGAACCCAGAGGG - Intronic
1014286298 6:119502994-119503016 AAGCTGGATCCCAACCCAGCAGG + Intergenic
1018712749 6:166508413-166508435 CGGCTGGTGACCAGCTCAGAGGG + Intronic
1021060694 7:16106574-16106596 CAGCTGGTAACAACCCCAGACGG - Intronic
1021425540 7:20495715-20495737 CAGCTAGTGCAGAGCCCAGAGGG + Intergenic
1021745975 7:23741862-23741884 CAGCTGCTGCCCAGCCAAGAAGG - Intronic
1022397860 7:30007021-30007043 CGGCTGATGCCCAGCCCAGCAGG + Intergenic
1022520837 7:31005975-31005997 CATGTGGTCCCCAAACCAGAGGG - Intergenic
1023266357 7:38410352-38410374 AACCTGGGACCCAACCCAGATGG + Intronic
1023379638 7:39594115-39594137 CAGCTACTGCCCAACATAGAGGG - Intronic
1024385709 7:48748955-48748977 CAGCAGGTGCAGAGCCCAGAGGG - Intergenic
1024940968 7:54763019-54763041 CAGCACGTGGCCAGCCCAGAGGG - Intergenic
1026846100 7:73699976-73699998 CAGCTGGTCCCCACCCCTCAGGG + Exonic
1026863667 7:73809925-73809947 CAGATGGGGCCCAGCCCAGAGGG + Intronic
1026891264 7:73984093-73984115 CAGCTGGCTCCCAGGCCAGAGGG + Intergenic
1027396073 7:77755826-77755848 AAGATGGTCCCCAACTCAGAAGG - Intronic
1027425804 7:78060720-78060742 CAGCATGTGCCCAACCCTGAAGG + Intronic
1028347341 7:89798787-89798809 CAGCTGGTACAGAGCCCAGAGGG - Intergenic
1029589064 7:101495181-101495203 CAGCTGGAACCCAACACACAGGG + Intronic
1033228279 7:139577725-139577747 CAGATGGTCCCCCACCAAGAAGG + Intronic
1035453408 7:158993757-158993779 CAGCAGGTGCGCAAAGCAGACGG - Intergenic
1039072579 8:33660116-33660138 CAGCTGGAGACCTACCCAGCTGG - Intergenic
1041085594 8:54253491-54253513 CAGCCTGAGCCCAACCCAGCAGG - Intergenic
1041205718 8:55495844-55495866 CAGCTGGTGGCCACTCCAGATGG + Intronic
1042976820 8:74478717-74478739 CAGCTGGTGCGGAGCCCAGAGGG - Intronic
1044224159 8:89700934-89700956 CAGCCTGTGCTGAACCCAGAGGG - Intergenic
1045663089 8:104458256-104458278 CAATTGTTGCCCAACCCATAAGG + Intronic
1048190125 8:132280743-132280765 CAGCTGGTGCAAAAATCAGAAGG + Intronic
1048354724 8:133643575-133643597 CTGCTGGTTCCCAAGGCAGAGGG + Intergenic
1049604092 8:143521102-143521124 CAGCCCCTGCCCAGCCCAGAGGG + Intronic
1050641675 9:7675117-7675139 CAAGTGGTTCCTAACCCAGAGGG - Intergenic
1053365969 9:37522797-37522819 GAGCTTGTTCCCAACCCAGCCGG - Intronic
1056050541 9:82763859-82763881 CAGCTGGCCCAGAACCCAGATGG + Intergenic
1057108567 9:92445089-92445111 CAGCTGGTGTGGAGCCCAGAGGG - Intronic
1058572223 9:106358972-106358994 CATCTTGTGCCAAGCCCAGAGGG - Intergenic
1058711576 9:107683706-107683728 CAGCTGGTGGCAAGGCCAGAGGG - Intergenic
1059322970 9:113483518-113483540 CAGCAAAAGCCCAACCCAGAAGG - Intronic
1060782213 9:126421126-126421148 CAGCTGGTGACCATGCCAAATGG + Intronic
1060981442 9:127794655-127794677 CACTTCGTGCCCTACCCAGAAGG + Intronic
1061430226 9:130526238-130526260 TCCCTGGTGCCCAACCCAGATGG - Intergenic
1061506950 9:131036848-131036870 CAGCCAGTGCCCCAGCCAGAAGG - Intronic
1062111230 9:134783125-134783147 CAGCTGCTGCCCAGGCCACACGG + Intronic
1062618853 9:137410663-137410685 CAGCTGGGTCCCTACCCACACGG + Intronic
1187732025 X:22264942-22264964 CAGATGGGCCCCAACCCAAATGG + Intergenic
1188492997 X:30755821-30755843 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
1188627149 X:32298791-32298813 CTGCTGGGGCCCAACAGAGAAGG + Intronic
1190902384 X:54689801-54689823 CAGATGGTCCCCAACTTAGATGG - Intergenic
1191221105 X:57989471-57989493 TAGCTGCAGCCCAACCCAGGAGG - Intergenic
1192510132 X:71716544-71716566 TAGCTGTTGCCCAACCCACCTGG - Intronic
1192516565 X:71765009-71765031 TAGCTGTTGCCCAACCCACCTGG + Intronic
1194210784 X:91066450-91066472 CAGCTAGTGCTTAACCCAAAGGG + Intergenic
1195151177 X:102071855-102071877 CAGCTTGTGCAGAGCCCAGAAGG + Intergenic
1196494456 X:116307649-116307671 CAGCTGATGCACACCACAGAGGG - Intergenic
1196609454 X:117695148-117695170 CAGCTGATGCCCAACCAGGGTGG + Intergenic
1197094025 X:122572361-122572383 CAGCAGGTTCCCAACCTTGAGGG + Intergenic
1197600017 X:128517837-128517859 CAGCTGGTGCTCAACCCTGAGGG + Intergenic
1197796139 X:130300072-130300094 CAGCTGCAGCCCTACCCAGGAGG + Intergenic
1199560920 X:149161629-149161651 CAGCTGGCGCAGAGCCCAGAGGG + Intergenic
1200059843 X:153479353-153479375 CAGCTGCTGCCCAGCCCACCAGG + Intronic
1200216167 X:154369138-154369160 CAGCTGCTTCCCAGCCCAGCAGG + Intronic
1201253945 Y:12088700-12088722 CAGCAGGTTCCTAACCCAGTGGG + Intergenic
1201293896 Y:12447516-12447538 CAGCTGGTCCCCAGGCAAGAAGG - Intergenic