ID: 1156419308

View in Genome Browser
Species Human (GRCh38)
Location 18:36933667-36933689
Sequence CCAGCTGTTCTAGGGGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 152}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156419293_1156419308 18 Left 1156419293 18:36933626-36933648 CCAGCCCACAGTTCTGTCCTCCA 0: 1
1: 0
2: 1
3: 33
4: 342
Right 1156419308 18:36933667-36933689 CCAGCTGTTCTAGGGGATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1156419295_1156419308 13 Left 1156419295 18:36933631-36933653 CCACAGTTCTGTCCTCCACACCC 0: 1
1: 0
2: 3
3: 53
4: 425
Right 1156419308 18:36933667-36933689 CCAGCTGTTCTAGGGGATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1156419302_1156419308 -7 Left 1156419302 18:36933651-36933673 CCCTCTGGGTTGGGCACCAGCTG 0: 1
1: 0
2: 2
3: 37
4: 241
Right 1156419308 18:36933667-36933689 CCAGCTGTTCTAGGGGATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1156419292_1156419308 24 Left 1156419292 18:36933620-36933642 CCAGGACCAGCCCACAGTTCTGT 0: 1
1: 0
2: 0
3: 29
4: 286
Right 1156419308 18:36933667-36933689 CCAGCTGTTCTAGGGGATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1156419300_1156419308 1 Left 1156419300 18:36933643-36933665 CCTCCACACCCTCTGGGTTGGGC 0: 1
1: 0
2: 0
3: 24
4: 245
Right 1156419308 18:36933667-36933689 CCAGCTGTTCTAGGGGATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1156419294_1156419308 14 Left 1156419294 18:36933630-36933652 CCCACAGTTCTGTCCTCCACACC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1156419308 18:36933667-36933689 CCAGCTGTTCTAGGGGATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1156419301_1156419308 -2 Left 1156419301 18:36933646-36933668 CCACACCCTCTGGGTTGGGCACC 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1156419308 18:36933667-36933689 CCAGCTGTTCTAGGGGATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 152
1156419303_1156419308 -8 Left 1156419303 18:36933652-36933674 CCTCTGGGTTGGGCACCAGCTGT 0: 1
1: 0
2: 1
3: 27
4: 215
Right 1156419308 18:36933667-36933689 CCAGCTGTTCTAGGGGATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156419308 Original CRISPR CCAGCTGTTCTAGGGGATCC AGG Intronic
900592720 1:3467172-3467194 CCAGCTCTACCAGGAGATCCAGG + Exonic
902092293 1:13913151-13913173 CAAGGTGTTCTAGGGCATACAGG + Intergenic
902370063 1:16000607-16000629 CCAGGAGTTCTAGGTGAGCCTGG - Intergenic
903036675 1:20497568-20497590 CCAGCTGATCTAGTGGATGGGGG - Intergenic
903276254 1:22223760-22223782 CCAGCATTTCTAGGGGAACCAGG + Intergenic
903606994 1:24582070-24582092 CCAGCTGGCCTAGCGGCTCCAGG + Intronic
904983837 1:34528238-34528260 CCAGCTGTTCTAGGAGGAACTGG + Intergenic
909517481 1:76528388-76528410 CCAGGTCTTCTTCGGGATCCTGG + Intronic
909996744 1:82289459-82289481 CCAGCCATTCTAGGGGTTACTGG - Intergenic
912499537 1:110112912-110112934 CCAGCTGCTCCAGGTGCTCCAGG - Exonic
913473914 1:119218241-119218263 CCAGCTGCTCCTGGGGATGCTGG + Intergenic
915449003 1:155991729-155991751 CCAGCTGTTCTAGACCAGCCCGG + Intronic
917654568 1:177113292-177113314 CCAGCTGTTCTGGGGGTTGGGGG - Intronic
920243470 1:204570725-204570747 CCTGCTGGGCTAGGGGACCCAGG + Intergenic
922779332 1:228239551-228239573 CCAGATGTTCTCAGGGACCCGGG - Intronic
924948850 1:248864398-248864420 CAAGCTGTTTTAGGTGCTCCTGG - Intergenic
1062882178 10:988055-988077 CCAGAGGGTCTAGGGGATCCGGG - Exonic
1064462691 10:15550509-15550531 CCAGCTCTGCTAGAGGATTCTGG + Intronic
1065196468 10:23270745-23270767 CCACCAGTTCTAGGGAGTCCAGG + Intronic
1072634789 10:97170908-97170930 CGGGCTGTTCTGGGGGCTCCTGG + Intronic
1073510377 10:104039094-104039116 CCAGGTGTTCCAGGGGCTCTTGG - Exonic
1074380246 10:112973473-112973495 GCATCTGGTCTAGGGGATCCTGG + Intronic
1078446610 11:11409511-11409533 CCAGGTCCTCTAGGGGACCCCGG + Intronic
1084969888 11:72765389-72765411 CCAGGGGTTCTCGGGAATCCCGG - Intronic
1089154991 11:116394959-116394981 CCAGCAGTTCCAGGGCAGCCTGG + Intergenic
1089439211 11:118500983-118501005 CCAGGTGTTCCAGGGTATACTGG + Exonic
1089852328 11:121510390-121510412 CCTGATGTTCTTGGGGATCCAGG + Intronic
1090010906 11:123045288-123045310 CCAGCTGTTTGAGTGGGTCCTGG - Intergenic
1090205312 11:124880514-124880536 CCAGCAGCTCTAGGGGCTCCCGG + Exonic
1091165522 11:133472550-133472572 AGAGCTGTTTTAGGGGATCGAGG + Intronic
1091593195 12:1857586-1857608 CCACCTCTTCCAGGGGTTCCTGG + Intronic
1093972492 12:25387670-25387692 CCAGGTGTTCTAGACGTTCCAGG - Intergenic
1100824647 12:98463144-98463166 CCAGGGGTTCTAGGGCAGCCTGG + Intergenic
1101122770 12:101600195-101600217 CTAGCTGGTCTAAGGAATCCAGG + Intronic
1101853076 12:108420210-108420232 GCAGACTTTCTAGGGGATCCAGG + Intergenic
1108598280 13:51968700-51968722 ACTGCTGTTCTAGAGGATTCTGG - Intronic
1114092097 14:19300702-19300724 CCAGCTGTTGTAGAAGCTCCTGG - Intergenic
1116734462 14:48671253-48671275 CCAGCTGTGCTGGTGGATCCAGG - Intergenic
1117267388 14:54104017-54104039 CCAGCTGTCCAGGGTGATCCTGG - Intergenic
1117441502 14:55763853-55763875 CCAGATTTTCTAGGTGCTCCTGG - Intergenic
1119294536 14:73522366-73522388 CCAGCTGTTTCAGGAGCTCCAGG + Exonic
1119664125 14:76472409-76472431 CCAGCTGCTCTGTGGGCTCCGGG - Intronic
1119713155 14:76837666-76837688 CCAGCTTTTCCAGGGCCTCCCGG - Intronic
1121664876 14:95664905-95664927 CCAGCTGCTCTAGAAGAGCCTGG + Intergenic
1124345914 15:28921483-28921505 CCAGCTGCTCTAGAGGTTCTGGG + Intronic
1125581521 15:40789184-40789206 CCAGCTGTTCTAGGTGGCACAGG - Intronic
1126685630 15:51246664-51246686 ATAGCTGTACTAGGGGATCTGGG - Intronic
1128544204 15:68556318-68556340 CCAGCTGTTCTTTGGAAGCCTGG - Intergenic
1132647393 16:1005239-1005261 CCAGCTGGGCTAGGTGAACCTGG - Intergenic
1133816886 16:9204292-9204314 CCAGCTGATGAAGGGGAGCCAGG - Intergenic
1135328434 16:21542640-21542662 CCACCAGGTCCAGGGGATCCAGG - Intergenic
1136338781 16:29628613-29628635 CCACCAGGTCCAGGGGATCCAGG - Intergenic
1136565135 16:31065292-31065314 CCAGCTGCTCCTGGGGATCATGG + Intronic
1139536452 16:67577844-67577866 CCAGCTGTTAGAGGGGATTGAGG + Intronic
1140620940 16:76731513-76731535 CCAGCTGTATTAGGGAATTCTGG + Intergenic
1141952697 16:87348855-87348877 TCAGTTGTTCTGCGGGATCCAGG - Intronic
1142041464 16:87897178-87897200 CCACCAGGTCCAGGGGATCCAGG - Intronic
1146283427 17:31559440-31559462 CCAGGAGTTCGAGGGGCTCCCGG + Intergenic
1148799169 17:50212302-50212324 CCAGCTGGTCCAAGGGACCCGGG + Intergenic
1151828058 17:76534737-76534759 ACAGCTGTGCCAGGGGATCGTGG + Intronic
1152579493 17:81159837-81159859 CCAGCTGGCCTGGGGGAGCCAGG - Intronic
1156419308 18:36933667-36933689 CCAGCTGTTCTAGGGGATCCAGG + Intronic
1157145958 18:45162774-45162796 CCAGCTGTGCTACAGGATCAGGG + Intergenic
1159043200 18:63344694-63344716 CCAGCTGTTTTCTGGGGTCCAGG - Intronic
1159964695 18:74583866-74583888 GCACCTGATCTAGGGCATCCAGG - Intronic
1161087268 19:2340894-2340916 CAGGCTGTTGTTGGGGATCCTGG - Exonic
1161478444 19:4498828-4498850 CCAGCTCCTCTAGGGCATTCAGG - Exonic
1161581240 19:5082211-5082233 CCAGCGGCTCCAGGGGCTCCAGG - Intronic
1163111247 19:15161841-15161863 CCGGCTGTGCTGGGGGAGCCTGG + Intronic
1163426733 19:17244581-17244603 GCACCCGTTCTCGGGGATCCCGG - Intronic
1163753729 19:19094088-19094110 CCAGCTGGGCTAGGTGATCCAGG - Intronic
1164581977 19:29440184-29440206 CCAACAGTGCTGGGGGATCCGGG - Intergenic
1167341647 19:48919976-48919998 CCAGCAGTTCTAGAGCAGCCTGG - Intronic
1167375701 19:49110058-49110080 CATGCTGTTCTAGGGGAGACAGG + Intergenic
1167661148 19:50796789-50796811 CCAGCTCCTCTAGGGAATGCCGG - Intergenic
927959649 2:27233177-27233199 CCAGCTGTTCTACTCGACCCTGG - Intronic
928222731 2:29418283-29418305 CCAGCACTCCTTGGGGATCCTGG + Intronic
933807891 2:86013204-86013226 TCAGCTGTTCTAGGGGACAGTGG + Intergenic
937430765 2:121836152-121836174 CCAGCTGGTTTAGGGGCTCCTGG + Intergenic
937986352 2:127639887-127639909 TCAGGGGGTCTAGGGGATCCAGG - Intronic
938601935 2:132851340-132851362 CCAACTGTTCTAGTGCAGCCAGG + Intronic
947170392 2:227305026-227305048 CCAGCTGGTCCAGGAGTTCCTGG - Exonic
1169225294 20:3852737-3852759 CCAGCTGTTCGAGGCCAGCCTGG - Intronic
1169851971 20:10061915-10061937 CCAGCTGGTTAAGGGGATCTGGG + Intergenic
1171411434 20:24950934-24950956 CCAGCTGTCCTAGCGTGTCCTGG + Intronic
1172477046 20:35246935-35246957 GCAGCAGTTTTACGGGATCCCGG + Exonic
1172762492 20:37332281-37332303 CCAGCCGATCTGGGGAATCCAGG + Intergenic
1174280110 20:49433143-49433165 CCTGCTGCCCTAGGGGCTCCTGG - Intronic
1176231621 20:64036005-64036027 CCACCTCTCCCAGGGGATCCAGG - Intronic
1180488637 22:15821862-15821884 CCAGCTGTTGTAGAAGCTCCTGG + Intergenic
1181665922 22:24396949-24396971 CCAGCTCTTCTCTGGGGTCCTGG + Intronic
1183695270 22:39418167-39418189 GCAGCTGTTCATGGGGATACTGG - Intronic
1184761588 22:46547721-46547743 CCAGCTGGCCTCGGGGATGCAGG + Intergenic
950454935 3:13087041-13087063 CCAGCTGGTTCAGGGGATCGTGG + Intergenic
950635108 3:14308679-14308701 TCAGCTGCTCCAGGGGCTCCTGG - Intergenic
950725996 3:14917409-14917431 CCAGCTGGTCTGGGTGCTCCTGG - Intronic
952509656 3:34040171-34040193 ACAGCTGTTTAAGGAGATCCTGG - Intergenic
952887717 3:38021838-38021860 CCATCTGTTGTTGGGGATCTGGG - Intronic
953775663 3:45814763-45814785 GCAGCTGTTCTGGGGGATGCTGG + Intergenic
956373718 3:68591572-68591594 TCATCTGTTTTAGGTGATCCTGG - Intergenic
956423059 3:69104564-69104586 CCTGCTGTTCTAGGGCATCCAGG - Exonic
958549640 3:95595676-95595698 CCAGCTGTGCTGGGGGACCCGGG + Intergenic
960479549 3:118171560-118171582 CCAGCAGTGCTGGGGGACCCGGG - Intergenic
961332554 3:126151400-126151422 CCATCAGTTCAAGGGGATTCTGG + Intronic
962559496 3:136590946-136590968 ACAGCTTTTCTGGGGGGTCCTGG - Intronic
965633026 3:170752619-170752641 CCGAGTGTTCTAGGGGCTCCTGG + Intronic
969262938 4:6045066-6045088 CCACCAGTTGCAGGGGATCCAGG - Intronic
969592897 4:8132027-8132049 ACAGCTGTGCTCGGGGATGCAGG - Intronic
976893923 4:90084466-90084488 CCTGCTTTTGTAGGGGTTCCTGG + Intergenic
978809094 4:112830972-112830994 CCAGCAGTGCTGGGGGACCCGGG - Intronic
980073808 4:128271753-128271775 ACAGCTGTTCCAAGGGACCCAGG + Intronic
980840621 4:138256335-138256357 CCTGCTGTTCTACGGTTTCCGGG - Intergenic
983372783 4:166883948-166883970 ACAGCTTTTCTAGGTGATCTAGG - Intronic
984162359 4:176269173-176269195 CCAGCTGTTCAGGAGCATCCCGG - Exonic
985651171 5:1108455-1108477 CCAGCTGCTGCAGGGGCTCCCGG + Intronic
989505614 5:42223928-42223950 CCAGCTGTTGTAGGTGTTGCTGG + Intergenic
989573146 5:42964152-42964174 AAAGCTGTTCTGGGGGACCCTGG - Intergenic
990540925 5:56771711-56771733 GCAGCTGATCCTGGGGATCCCGG - Intergenic
992150469 5:73897356-73897378 GCACCTGTTCTAGGGGATATTGG - Intronic
993529443 5:89005970-89005992 CCAGGTGTTCAAGGCCATCCTGG - Intergenic
997202822 5:132023040-132023062 CCAGCTGCTCAAGGGAAGCCTGG - Intergenic
998104965 5:139462628-139462650 GCAGCTGTGCTGGGTGATCCTGG - Exonic
998264264 5:140655778-140655800 ACAGCTGTTCTTGTAGATCCTGG + Intronic
1002071454 5:176680840-176680862 CCAGCTGTTCCACGGGCTTCTGG + Intergenic
1002535743 5:179874460-179874482 CCAGCTGTTCCAGCGGGCCCAGG + Intronic
1002800111 6:514645-514667 ACAGCTGCTCCAGGGGCTCCAGG + Intronic
1003118981 6:3304745-3304767 CCAGCAGTACGAGGGGATACAGG - Intronic
1003970106 6:11291065-11291087 ACAGCTGTCCTCGGGGATCTGGG - Intronic
1005875299 6:30006626-30006648 CCTGCTGCTCTCGGGGACCCTGG + Intergenic
1007710967 6:43824069-43824091 CCAGCTGTGGAAGGGGCTCCTGG + Intergenic
1007783892 6:44269627-44269649 CCTGCTGTGCCAGGGGATACAGG + Intergenic
1014045280 6:116877329-116877351 CCAACTGTCCCCGGGGATCCAGG + Exonic
1016749111 6:147613229-147613251 ACAGCTGCTCTAGGGGGTGCAGG - Intronic
1018543698 6:164912893-164912915 CCAGGTGTGCTAGGGTATACAGG - Intergenic
1019429179 7:990907-990929 CCAGCTGTTGTCAGGGCTCCCGG + Intergenic
1027640704 7:80730136-80730158 CCAGCTGTTTCAGAGAATCCTGG + Intergenic
1028784733 7:94779512-94779534 CCAGCTGTTCTAGCTTTTCCAGG + Intergenic
1029598309 7:101549194-101549216 CCAGGTGTTCCTGGGGGTCCTGG - Exonic
1031877761 7:127161348-127161370 CCAGCTGTTCCAGTAGAGCCTGG - Intronic
1033103167 7:138494326-138494348 CCAGCTGTTCAAGAGCAGCCTGG - Intronic
1033643415 7:143283932-143283954 CCAGCTGTCCCTGGGGAGCCTGG + Intronic
1034106550 7:148495473-148495495 CCAGAAGTTTTAGGGGATTCAGG - Intergenic
1034499308 7:151439825-151439847 CCCCCTGTGCTAGGGGATGCAGG - Intronic
1035296588 7:157870823-157870845 CCAGGTGCTCTGGGGGATCAAGG - Intronic
1035321238 7:158030609-158030631 CCAGGTGTTCTCGGGAATTCTGG - Intronic
1038663147 8:29514337-29514359 GCAGCTCTTGTAGGAGATCCTGG + Intergenic
1039003474 8:33007754-33007776 CCAGATGTTCTAGGCCAGCCTGG + Intergenic
1040837595 8:51748567-51748589 CCAGCTGTTCTTGCTAATCCAGG - Intronic
1041356409 8:57005519-57005541 CCAGCTGTGCTAGGGGTGCTGGG + Intergenic
1043364204 8:79513022-79513044 CCAGGGGTTCTACGGCATCCAGG - Intergenic
1045824639 8:106382607-106382629 CCAGCTCTGCTAGAGGGTCCCGG + Intronic
1048549991 8:135425270-135425292 CAGGCTGTTCTAGAGGGTCCAGG - Intergenic
1048807642 8:138255438-138255460 CCCACTGTTCTAGGGGAGACAGG - Intronic
1049230118 8:141477572-141477594 CCTGCGGTTCTCGGGGATGCTGG - Intergenic
1049408065 8:142460478-142460500 CGAGATGTTCTAGGGGATGCTGG + Intronic
1049414100 8:142487611-142487633 CCCACTGTTCTGGGGGAACCTGG - Intronic
1053348580 9:37396250-37396272 CCAGCTGCCCTAAGGGGTCCTGG - Intergenic
1059419428 9:114181729-114181751 CCAGCTGTTATCGGGGAACTTGG + Intronic
1060874982 9:127076819-127076841 CCAGCTAGTCTGGGGGAACCAGG + Intronic
1061894924 9:133642218-133642240 CCACTTGGTCTACGGGATCCTGG + Exonic
1062295453 9:135822920-135822942 CCAGCTGTCCTTGGGGAGACCGG + Exonic
1185812743 X:3125749-3125771 ACAGAGGTACTAGGGGATCCTGG + Intergenic
1187493929 X:19777971-19777993 CCAGCTGCTCCAGAGGATCTCGG - Intronic
1192257447 X:69474353-69474375 CCAGGTGTTCTAGGCCAGCCTGG - Intergenic
1195683386 X:107565006-107565028 CCAGCTGTTCCGGGAGAACCAGG + Exonic