ID: 1156419309

View in Genome Browser
Species Human (GRCh38)
Location 18:36933668-36933690
Sequence CAGCTGTTCTAGGGGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 107}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156419301_1156419309 -1 Left 1156419301 18:36933646-36933668 CCACACCCTCTGGGTTGGGCACC 0: 1
1: 0
2: 2
3: 22
4: 209
Right 1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 107
1156419303_1156419309 -7 Left 1156419303 18:36933652-36933674 CCTCTGGGTTGGGCACCAGCTGT 0: 1
1: 0
2: 1
3: 27
4: 215
Right 1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 107
1156419293_1156419309 19 Left 1156419293 18:36933626-36933648 CCAGCCCACAGTTCTGTCCTCCA 0: 1
1: 0
2: 1
3: 33
4: 342
Right 1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 107
1156419294_1156419309 15 Left 1156419294 18:36933630-36933652 CCCACAGTTCTGTCCTCCACACC 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 107
1156419302_1156419309 -6 Left 1156419302 18:36933651-36933673 CCCTCTGGGTTGGGCACCAGCTG 0: 1
1: 0
2: 2
3: 37
4: 241
Right 1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 107
1156419300_1156419309 2 Left 1156419300 18:36933643-36933665 CCTCCACACCCTCTGGGTTGGGC 0: 1
1: 0
2: 0
3: 24
4: 245
Right 1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 107
1156419295_1156419309 14 Left 1156419295 18:36933631-36933653 CCACAGTTCTGTCCTCCACACCC 0: 1
1: 0
2: 3
3: 53
4: 425
Right 1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 107
1156419292_1156419309 25 Left 1156419292 18:36933620-36933642 CCAGGACCAGCCCACAGTTCTGT 0: 1
1: 0
2: 0
3: 29
4: 286
Right 1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156419309 Original CRISPR CAGCTGTTCTAGGGGATCCA GGG Intronic
904094842 1:27968515-27968537 TTGCTGTTCTAGGAGGTCCATGG + Intergenic
905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG + Exonic
905241329 1:36583377-36583399 CAGCTAAGCTAGGGAATCCAGGG - Intergenic
906326460 1:44849186-44849208 CAGGGGTTCTAAGGGCTCCATGG + Intergenic
911104208 1:94117404-94117426 CAGCTGTCCCAGGTGCTCCAGGG + Intronic
912556345 1:110518781-110518803 CATCCATTCTAGGGGAGCCAGGG + Exonic
913529578 1:119724260-119724282 CCGCTGGTTTAGGGAATCCATGG - Intronic
920573542 1:207037109-207037131 GAGCTGTTTTAGGGGAGTCAAGG - Intronic
921997022 1:221431509-221431531 CTGCTGTTTTAGAGGACCCATGG - Intergenic
923084948 1:230696100-230696122 GAGATGTTCTGGGGGAACCATGG - Intergenic
923187574 1:231588877-231588899 CAGATGTTGTAGGGGACACAGGG - Intronic
923370059 1:233300910-233300932 CAGCTGTTCATGGGGGCCCATGG - Intergenic
923398321 1:233589817-233589839 CAGCTTTTCCAGGCCATCCATGG + Intergenic
1067471561 10:46541854-46541876 CAGCTGTCCTACGGTATCCCAGG + Intergenic
1069610493 10:69769431-69769453 CAGCTGTTTTGGGGGCTCCGCGG - Intergenic
1072370899 10:94765647-94765669 GAGCTGCTGCAGGGGATCCAGGG + Intronic
1073370965 10:102988606-102988628 CAGCTGCCCTAGAGCATCCAGGG + Intronic
1074759310 10:116654548-116654570 CAGCTGCTTTAAGGGAACCAAGG + Intergenic
1076686418 10:132200287-132200309 CAGCAGTTCTCGGGGCCCCAGGG + Intronic
1088201462 11:107339779-107339801 CAGCTGTTGTGGGGGGGCCAAGG - Intronic
1090091733 11:123703985-123704007 CCCCTGTTCTAGGGGCTCAAAGG - Intergenic
1090205313 11:124880515-124880537 CAGCAGCTCTAGGGGCTCCCGGG + Exonic
1091098363 11:132845554-132845576 CAGATGTTCTCTGGGATCCCAGG + Intronic
1095953276 12:47793216-47793238 CAGCTGTTCCATGTGCTCCATGG + Intronic
1099033964 12:77562448-77562470 AAGCTGTTCTAGCAGACCCAGGG - Intergenic
1101879685 12:108617732-108617754 GAGCTGTTTGAGGGGATTCACGG + Intergenic
1102192475 12:110999112-110999134 CAGCTGGTCTGGGAGATCCCAGG - Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1108598279 13:51968699-51968721 CTGCTGTTCTAGAGGATTCTGGG - Intronic
1108640900 13:52381412-52381434 CAGGTGTTTTAGGGGACCCATGG - Intronic
1112397958 13:99050769-99050791 CAGCTGCTCTAGGGGATAGATGG - Intronic
1113248694 13:108427617-108427639 CAACTGCTGCAGGGGATCCAAGG + Intergenic
1120758064 14:88262709-88262731 CAGCTGTTATAGTGGATTTATGG - Intronic
1121409487 14:93739655-93739677 CAGCTGGATTAGGAGATCCAGGG + Intronic
1123439649 15:20281259-20281281 CAGCTGTTCGAGGGGCTGCCTGG + Intergenic
1129040066 15:72678266-72678288 AAGCTGTTCTAGTGGATCCCAGG - Intronic
1135328433 16:21542639-21542661 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1135631995 16:24043126-24043148 CAGCTGCTGTTGAGGATCCAAGG + Intronic
1136104354 16:28018860-28018882 CAGCTGGGCTTGGGGATCAAAGG - Intronic
1136338780 16:29628612-29628634 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1138206736 16:55130918-55130940 CAGCTCTTACTGGGGATCCATGG + Intergenic
1140227907 16:73093443-73093465 CAGCTCTTTTGGGGGTTCCAGGG + Intergenic
1141952696 16:87348854-87348876 CAGTTGTTCTGCGGGATCCAGGG - Intronic
1142041463 16:87897177-87897199 CACCAGGTCCAGGGGATCCAGGG - Intronic
1145728215 17:27153419-27153441 CATCTTCTCTGGGGGATCCATGG - Intergenic
1147664704 17:42139161-42139183 AAGCTGTGCTAGCAGATCCATGG - Intronic
1150246960 17:63683387-63683409 CAGCTGTTCTAGGGGTGACTTGG + Intronic
1153897483 18:9579905-9579927 CAGCTGTTCCTTGGTATCCATGG - Intronic
1154365146 18:13701185-13701207 CAGCTGCTCTGAGGGATCAAAGG - Intronic
1155673521 18:28401288-28401310 AAGCTGTGCTAGGGGATTTAAGG + Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1156758590 18:40558880-40558902 GATCTGTTCTAGAGGCTCCAGGG - Intergenic
1156864061 18:41869092-41869114 CAGTTCTTCCAGGGGATTCAGGG - Intergenic
1161581239 19:5082210-5082232 CAGCGGCTCCAGGGGCTCCAGGG - Intronic
1161805570 19:6441346-6441368 CAGCTGAGCTTGGAGATCCAGGG + Exonic
1165707612 19:37987662-37987684 CAGCTGGCCTAGGGGGTCCCAGG - Intronic
1167156940 19:47744316-47744338 CAGCCATTCAAAGGGATCCATGG - Intergenic
925467842 2:4125618-4125640 CAGCAGCTCTAGGGGAACCAAGG - Intergenic
926261762 2:11270492-11270514 CACCTTTTCTAGTGGTTCCATGG + Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
937986351 2:127639886-127639908 CAGGGGGTCTAGGGGATCCAGGG - Intronic
942216147 2:173720730-173720752 CAGAGACTCTAGGGGATCCATGG + Intergenic
948924810 2:241088686-241088708 CAGCTGATCTAGGGGTTTCTTGG - Exonic
1169252883 20:4073599-4073621 GAGCTGTTCTTGGGGATGGAGGG + Intronic
1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG + Intergenic
1176020157 20:62958653-62958675 CAGAGGTTCTAGGGGAGCCATGG - Intronic
1176231620 20:64036004-64036026 CACCTCTCCCAGGGGATCCAGGG - Intronic
1179907978 21:44434032-44434054 CAGCTGTCCTGGGGCAGCCACGG + Intronic
1181491352 22:23262643-23262665 CAGCTGCTCTTGGGCAGCCAGGG + Intronic
1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG + Intronic
950573712 3:13817988-13818010 CAGCTGTGCAAGGGGCCCCATGG + Exonic
950635107 3:14308678-14308700 CAGCTGCTCCAGGGGCTCCTGGG - Intergenic
955432164 3:58857629-58857651 TAGCAGTTCTAGGGCAGCCAAGG - Intronic
961044257 3:123698117-123698139 CAGCTGTTCTTGGGCTTGCATGG - Intronic
962505769 3:136045265-136045287 CAGCTGTGCTGGGTGAGCCAAGG - Intronic
965786989 3:172345801-172345823 CACCTATTCAAGGGTATCCACGG - Intronic
967842162 3:194014926-194014948 CAGCTGTTCTAGGGAATGCCAGG + Intergenic
974540657 4:63229698-63229720 CAGATATACTAGGGTATCCAAGG - Intergenic
975811972 4:78178950-78178972 CAGATGTTCGAGGGGAGCGAAGG + Intronic
976337790 4:83910894-83910916 CAGCTGTTCTTGTGCATACAGGG + Intergenic
980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG + Intronic
983298977 4:165901767-165901789 GTGCTGTTCTGGGAGATCCATGG + Intronic
986199711 5:5569982-5570004 CAGCTGTGCTTGGGGCCCCAGGG - Intergenic
990364261 5:55053766-55053788 CAGCTGTTCTGGGGGATGGTCGG - Intergenic
990540924 5:56771710-56771732 CAGCTGATCCTGGGGATCCCGGG - Intergenic
992150468 5:73897355-73897377 CACCTGTTCTAGGGGATATTGGG - Intronic
994794994 5:104286076-104286098 CAACTGTTCCAGGGGTTCCCAGG - Intergenic
998104964 5:139462627-139462649 CAGCTGTGCTGGGTGATCCTGGG - Exonic
998147043 5:139734850-139734872 CCGCTGGTCTAGTGGTTCCAGGG - Intergenic
1001383240 5:171317658-171317680 GAACTGTTTTAGGGGATCAATGG - Intergenic
1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG + Intronic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1003118980 6:3304744-3304766 CAGCAGTACGAGGGGATACAGGG - Intronic
1005527585 6:26666410-26666432 CTGCTGTTTTAGGGTATACAGGG - Intergenic
1007213555 6:40217971-40217993 AAGGTGTTCTGGGTGATCCAAGG - Intergenic
1007783893 6:44269628-44269650 CTGCTGTGCCAGGGGATACAGGG + Intergenic
1008341043 6:50364563-50364585 GAGCTGTTCTTGGGGATAGAAGG + Intergenic
1009820823 6:68798853-68798875 CAGCTTTTCTGGGAGATCCACGG - Intronic
1013883536 6:114933942-114933964 CAGGTGTGCTGGGGGACCCAAGG + Intergenic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1015989940 6:138929273-138929295 CAGGTGTTTTAGGGGAGGCAGGG + Intronic
1017499795 6:155013172-155013194 CAGCTGTACTACAGGAGCCATGG - Intronic
1017958300 6:159198562-159198584 CAGCTGGACTTGGGGAGCCAAGG - Intronic
1018279471 6:162170086-162170108 CAGCTGTTATAGGAAACCCAGGG - Intronic
1020477028 7:8608252-8608274 CAGCTGTTCTCAGGGATAAATGG + Intronic
1023513218 7:40975334-40975356 CAGCTGTGATATGGGACCCAAGG - Intergenic
1028784734 7:94779513-94779535 CAGCTGTTCTAGCTTTTCCAGGG + Intergenic
1034844413 7:154431149-154431171 CAGCTGTTCTCAGGGCACCACGG - Intronic
1040798998 8:51320835-51320857 CAGATGTTAGAGGGGTTCCAAGG - Exonic
1040977826 8:53214182-53214204 CTGCTGTGCTAGAGGCTCCACGG + Intergenic
1043364203 8:79513021-79513043 CAGGGGTTCTACGGCATCCAGGG - Intergenic
1044680749 8:94775141-94775163 CAGCTGATCTAGGGGCACAATGG - Intronic
1047795053 8:128246917-128246939 AAGCTGTTCTAAGGAAGCCAAGG - Intergenic
1048807640 8:138255437-138255459 CCACTGTTCTAGGGGAGACAGGG - Intronic
1049408066 8:142460479-142460501 GAGATGTTCTAGGGGATGCTGGG + Intronic
1049497335 8:142942422-142942444 CAGCTGGTCGAGGGGAGCCATGG - Intergenic
1055797572 9:79992034-79992056 CAGCTGGGCTTGAGGATCCAAGG + Intergenic
1191837223 X:65477215-65477237 TGACTGGTCTAGGGGATCCAAGG + Intronic
1194403615 X:93467818-93467840 CAGGGGTTCTCAGGGATCCAAGG - Intergenic
1195683387 X:107565007-107565029 CAGCTGTTCCGGGAGAACCAGGG + Exonic
1200395285 X:155982794-155982816 CCCCTGCTCTAAGGGATCCATGG + Intergenic