ID: 1156428989

View in Genome Browser
Species Human (GRCh38)
Location 18:37050112-37050134
Sequence CTCCAGTAACAATCAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156428989_1156428992 -10 Left 1156428989 18:37050112-37050134 CCTGAGCCTGATTGTTACTGGAG 0: 1
1: 0
2: 0
3: 18
4: 118
Right 1156428992 18:37050125-37050147 GTTACTGGAGGACATAAAAGAGG 0: 1
1: 0
2: 0
3: 17
4: 231
1156428989_1156428994 8 Left 1156428989 18:37050112-37050134 CCTGAGCCTGATTGTTACTGGAG 0: 1
1: 0
2: 0
3: 18
4: 118
Right 1156428994 18:37050143-37050165 AGAGGTCAGTGAATGGTCCCTGG 0: 1
1: 0
2: 2
3: 18
4: 216
1156428989_1156428996 21 Left 1156428989 18:37050112-37050134 CCTGAGCCTGATTGTTACTGGAG 0: 1
1: 0
2: 0
3: 18
4: 118
Right 1156428996 18:37050156-37050178 TGGTCCCTGGGAGTGCTGCTTGG 0: 1
1: 0
2: 1
3: 25
4: 246
1156428989_1156428993 1 Left 1156428989 18:37050112-37050134 CCTGAGCCTGATTGTTACTGGAG 0: 1
1: 0
2: 0
3: 18
4: 118
Right 1156428993 18:37050136-37050158 ACATAAAAGAGGTCAGTGAATGG 0: 1
1: 0
2: 1
3: 26
4: 311
1156428989_1156428995 9 Left 1156428989 18:37050112-37050134 CCTGAGCCTGATTGTTACTGGAG 0: 1
1: 0
2: 0
3: 18
4: 118
Right 1156428995 18:37050144-37050166 GAGGTCAGTGAATGGTCCCTGGG 0: 1
1: 0
2: 0
3: 18
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156428989 Original CRISPR CTCCAGTAACAATCAGGCTC AGG (reversed) Intronic
901023131 1:6265075-6265097 GTCCAGTAGCAAACAGGCCCTGG - Intronic
906074331 1:43041085-43041107 CACCAATAACAATGAGGCTATGG + Intergenic
907940855 1:59085603-59085625 CTCCTGTATCAATCAGTCACTGG + Intergenic
911038766 1:93575839-93575861 CTCCAGGAATTCTCAGGCTCAGG + Intronic
916574745 1:166057337-166057359 CCCCAGGAACAAGCAAGCTCTGG - Intergenic
919835165 1:201568347-201568369 CTCCATTAACAAATAGGCTTTGG - Intergenic
921957514 1:220999725-220999747 CTCCAGGCCCAATCAGGATCTGG + Intergenic
1066218744 10:33314722-33314744 CTCCAGAAACAAGCAGGCCTGGG + Intronic
1067234672 10:44437596-44437618 CTCCAGTACCAGCCAGGCCCTGG - Intergenic
1067438826 10:46296854-46296876 CTCCTGTAACAGACAGGCTCAGG - Intronic
1068071374 10:52200214-52200236 CTCCACTATCAAACAGGCCCTGG + Intronic
1068736187 10:60415704-60415726 CTCCTATAACAAACAGCCTCTGG - Intronic
1069598314 10:69686967-69686989 CTCCGGTAACACTCAGGCCCTGG + Intronic
1072920595 10:99573803-99573825 CACCGGCACCAATCAGGCTCTGG - Intergenic
1074111489 10:110425770-110425792 CTTCAGAAACATTCAGGGTCGGG - Intergenic
1074551226 10:114444267-114444289 CTTCAGGAACTACCAGGCTCTGG - Intronic
1076268351 10:129129066-129129088 CTCCAGAAAGAGCCAGGCTCTGG - Intergenic
1076268360 10:129129109-129129131 CTCCAGAAAGAGCCAGGCTCTGG - Intergenic
1076268369 10:129129152-129129174 CTCCAGAAAGAGCCAGGCTCTGG - Intergenic
1076268378 10:129129195-129129217 CTCCAGAAAGAGCCAGGCTCTGG - Intergenic
1076268387 10:129129238-129129260 CTCCAGAAAGAGCCAGGCTCTGG - Intergenic
1078499252 11:11853516-11853538 TACCAGTAAAAACCAGGCTCAGG - Intronic
1089673482 11:120073244-120073266 CTCCAGGGACAATCAGGCCCCGG - Intergenic
1090353981 11:126126989-126127011 CTTCAGTAATCATCATGCTCTGG - Intergenic
1091220982 11:133929949-133929971 CCCCACTAACAAGCAGGGTCAGG - Intronic
1096693800 12:53336268-53336290 CTCCTGTTCCACTCAGGCTCCGG + Exonic
1097495620 12:60328434-60328456 CTCCAGTATCAATCAAAATCTGG + Intergenic
1098176938 12:67802767-67802789 CACCAGTAACAATCAGCTGCGGG + Intergenic
1103840316 12:123858431-123858453 CTCCAGAGAAAATCAGGGTCAGG - Intronic
1105793830 13:23831282-23831304 CTCCATTAGGAATCAGGATCTGG + Intronic
1108343706 13:49523061-49523083 CTACAGTAAAAATCATGCCCTGG - Intronic
1108461936 13:50675625-50675647 CTCTAGTAACTATCAGTGTCAGG + Intronic
1114130059 14:19780995-19781017 CTCAAGAAACATTCAGGCTCAGG + Exonic
1114775957 14:25481773-25481795 CTATAGTAACATGCAGGCTCTGG - Intergenic
1114881353 14:26789930-26789952 CTCCAGTAACAACTAGGCTAGGG - Intergenic
1115316797 14:32033392-32033414 CCCCATTAACTACCAGGCTCTGG - Intergenic
1116713814 14:48402929-48402951 CTCCAAGAACATTCAGGCACAGG + Intergenic
1119015223 14:71044387-71044409 CTCCAGTATGAATCAGGATATGG + Intronic
1119081132 14:71695028-71695050 TTCCAATAACGATCAGCCTCAGG + Intronic
1122160797 14:99782379-99782401 CCCCAGTCACCATCAGGCGCTGG - Intronic
1122790667 14:104182954-104182976 CCCCAGCAAGAAGCAGGCTCTGG - Intergenic
1123481634 15:20638017-20638039 CTGCAAGATCAATCAGGCTCAGG + Intergenic
1123573330 15:21638679-21638701 CTCAAGAAACTTTCAGGCTCAGG + Exonic
1123636379 15:22362348-22362370 CTGCAAGATCAATCAGGCTCAGG - Intergenic
1123992828 15:25696070-25696092 CTCCAGGAACAAACACGCTCCGG + Intronic
1124463173 15:29911831-29911853 CTCAACTAAGACTCAGGCTCTGG + Intronic
1126892170 15:53218307-53218329 CTCCAGTACCAATCAGTCATTGG + Intergenic
1128911290 15:71517903-71517925 CTCCAGTAACCTTATGGCTCTGG - Intronic
1130828417 15:87573345-87573367 GTACAGTATCAATGAGGCTCCGG + Intergenic
1131906396 15:97147646-97147668 GTCGAGGAACAATCAGGCTCAGG + Intergenic
1202982198 15_KI270727v1_random:373092-373114 CTCAAGAAACTTTCAGGCTCAGG + Intergenic
1138081205 16:54093070-54093092 CTCCAGGAACACTCTTGCTCTGG - Intronic
1141410158 16:83827737-83827759 CTCCAGGAACCATCAGGAGCTGG + Intergenic
1143620272 17:8076455-8076477 CTCCAGGAACAATCCTGCTCTGG + Intronic
1148966327 17:51438912-51438934 ACCCAGTGACATTCAGGCTCTGG + Intergenic
1151653694 17:75485710-75485732 CTCCTGCAGCAAGCAGGCTCAGG - Intronic
1152944122 17:83189817-83189839 CTCCAGCAGCAGGCAGGCTCCGG - Intergenic
1153046250 18:857882-857904 CTCAAGTCACAGTCACGCTCAGG + Intergenic
1156428989 18:37050112-37050134 CTCCAGTAACAATCAGGCTCAGG - Intronic
1158187950 18:54792699-54792721 CTCCAGTACCTAACAGTCTCTGG + Intronic
1163334730 19:16663441-16663463 CTTCAGGAACCTTCAGGCTCTGG - Intronic
1168028305 19:53660038-53660060 CTCCAGTAAAAAGCAGGGTTTGG - Intergenic
925851552 2:8086903-8086925 CTCCAGTCACTATCAGCCCCAGG + Intergenic
926487178 2:13476188-13476210 CTCCAGTAACCATCAGGAGATGG + Intergenic
927015303 2:18953160-18953182 CTCCAGTAACAATAACTGTCGGG - Intergenic
934646086 2:96060112-96060134 CTCCAGTAGCAGCCAGGTTCCGG + Intergenic
934839489 2:97616195-97616217 CTCCAGTAGCAGCCAGGTTCCGG + Intergenic
936156361 2:110049846-110049868 CTCCAGTAAGGATCAGGTCCAGG - Intergenic
936188328 2:110321596-110321618 CTCCAGTAAGGATCAGGTCCAGG + Intergenic
936819036 2:116496613-116496635 ATCCAGAAAAAAACAGGCTCAGG - Intergenic
938288534 2:130137462-130137484 CTTCACTGACAATGAGGCTCTGG + Intergenic
938467998 2:131535472-131535494 CTTCACTGACAATGAGGCTCTGG - Intergenic
941687137 2:168458127-168458149 CTCCAAAAACAAGCAGACTCAGG + Intronic
945982219 2:216321853-216321875 CTCCAGGAAGAATCAGCCTTGGG + Intronic
947060857 2:226163471-226163493 CTTAAGTAACATTCATGCTCTGG + Intergenic
947532809 2:230923570-230923592 CTCCAGCAACATTCAGGCATTGG - Intronic
1171424610 20:25041816-25041838 CTGCTGTAACTAACAGGCTCTGG - Intronic
1173455515 20:43198358-43198380 ATCCAGGAACAAACGGGCTCTGG - Intergenic
1179561224 21:42217392-42217414 CTCCAGGAACAGACAGGCCCTGG - Intronic
1181057961 22:20268670-20268692 TTTCAGTAAGAAACAGGCTCAGG + Intronic
1183267550 22:36838596-36838618 CTCCAGTCACACACAGGCTCAGG - Intergenic
951428763 3:22581905-22581927 CTCCACTAAGAATGAGGGTCAGG - Intergenic
953235565 3:41103394-41103416 CTCCAGTACAACTCAGACTCAGG + Intergenic
956141516 3:66151268-66151290 CTCCAATAACAAGCGGGCTGTGG + Intronic
962083389 3:132164748-132164770 CTCCAGCCACACTCAGGCACAGG + Intronic
962929816 3:140026002-140026024 CTCCAGAAACTAGCAGGGTCTGG - Intronic
964581291 3:158241415-158241437 CTCCAGTAGCACTCTGGCTGGGG + Intronic
968971643 4:3798748-3798770 CTCCAGTCACCGCCAGGCTCTGG - Intergenic
969900102 4:10341231-10341253 CTCCTGAAACACTCAGGGTCAGG + Intergenic
972619953 4:40737681-40737703 CTCCAAAAACAATCAAGCTTAGG + Intergenic
976207571 4:82637484-82637506 CATCAGTAACACTCAGGGTCTGG - Intronic
977507532 4:97921249-97921271 CTCCACTACCAATCCTGCTCCGG + Intronic
978609842 4:110525510-110525532 CTTCAGTGACAATCAGGCAGTGG - Intronic
982863578 4:160483032-160483054 CACCAATAACAATCTGGTTCAGG - Intergenic
983606167 4:169587597-169587619 CTCCAGTGACATTTGGGCTCTGG - Exonic
991180992 5:63750969-63750991 GCCCAGTAACATTCAGACTCTGG + Intergenic
995031469 5:107486786-107486808 CTGCAGTAACAAACAGCCCCAGG - Intronic
998502882 5:142648764-142648786 CTCCAGTGACAAACATTCTCAGG - Intronic
999262959 5:150248875-150248897 CTCCATCAACAAGCAGGCTGGGG + Intronic
999761123 5:154701979-154702001 CTCCTGTCACAAAAAGGCTCAGG - Intergenic
1000289417 5:159856181-159856203 CTCCACTAACAATGAGGCCCTGG - Intergenic
1008859429 6:56131496-56131518 GTCCAGTAAAACTCAGCCTCTGG + Intronic
1011662287 6:89604886-89604908 CTCCAATTACATCCAGGCTCTGG - Intronic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1018380748 6:163255930-163255952 TTCCAGTAAGAATCAGGGGCTGG - Intronic
1018496370 6:164349746-164349768 CTCTAATGACAATCTGGCTCTGG - Intergenic
1018648692 6:165972619-165972641 CTCCAGTGGCACTGAGGCTCGGG + Intronic
1018678716 6:166245235-166245257 ATCCAGTAACACTCTGGCCCAGG - Intergenic
1019429771 7:993289-993311 CTCCAGTCACAGTCAGGCCCTGG - Intergenic
1022197183 7:28080646-28080668 CTCCAGGAATAGGCAGGCTCAGG + Intronic
1022279539 7:28892597-28892619 CTCTGGTAACAATCAGAATCTGG - Intergenic
1023335445 7:39164516-39164538 CCCCATTAGCAATAAGGCTCTGG + Intronic
1025142305 7:56476308-56476330 CTCCAGGTACCATCAGGCTTTGG - Intergenic
1029677407 7:102079907-102079929 TCCCAGTTACACTCAGGCTCCGG + Intronic
1032657169 7:133943639-133943661 CTCCCGGCACCATCAGGCTCAGG + Intronic
1036551415 8:9818017-9818039 CTCCATCAACAAAAAGGCTCTGG + Intergenic
1037345031 8:17889661-17889683 CTCCAGGACCATTCAGCCTCTGG + Intronic
1038124900 8:24662624-24662646 CTCCATTAACATTTAGGATCTGG + Intergenic
1038509534 8:28118593-28118615 ATCGTGTAACAATCAGGCTCTGG + Intronic
1041235008 8:55792057-55792079 CTCCAGTAACTAGCAGGAACTGG - Intronic
1048593051 8:135839158-135839180 CTGCTCTGACAATCAGGCTCTGG - Intergenic
1048717967 8:137288803-137288825 CTCCATTAACCATTAGGCTCTGG + Intergenic
1052233941 9:26188302-26188324 CTCCAGGGCCAGTCAGGCTCTGG + Intergenic
1055987043 9:82062937-82062959 CTCCAGGAACACCCAGGCTCAGG + Intergenic
1056583858 9:87915217-87915239 CTCCAGGAACACCCAGGCTCAGG - Intergenic
1056584350 9:87918686-87918708 CTCCAGGAACACCCAGGCTCAGG - Intergenic
1056612519 9:88134236-88134258 CTCCAGGAACACCCAGGCTCAGG + Intergenic
1056613011 9:88137704-88137726 CTCCAGGAACACCCAGGCTCAGG + Intergenic
1057160138 9:92883301-92883323 CTCCTGGAACACCCAGGCTCAGG - Intergenic
1061543493 9:131290588-131290610 CCCCAGAAACAGGCAGGCTCCGG + Intronic
1190275721 X:48897927-48897949 GTCCAGTTACTTTCAGGCTCGGG + Intronic
1193420877 X:81280511-81280533 CGCCAGTACCAACCAGGATCTGG + Intronic
1195347655 X:103966584-103966606 CTCCAGATACAATCATGCTAGGG - Intronic
1195359787 X:104072257-104072279 CTCCAGATACAATCATGCTAGGG + Intergenic
1196194455 X:112825164-112825186 CTCCCCTAACACTCAGGTTCAGG + Intronic
1199700837 X:150374435-150374457 GTCCTGTAAATATCAGGCTCAGG + Intronic
1200927189 Y:8665171-8665193 CTCCAGAAACACGCAGCCTCAGG + Intergenic