ID: 1156432864

View in Genome Browser
Species Human (GRCh38)
Location 18:37094255-37094277
Sequence GTGGCTAACAGGCCAGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 484}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156432858_1156432864 -4 Left 1156432858 18:37094236-37094258 CCTCCTGCTGTGTGGCCCAGTGG 0: 2
1: 5
2: 222
3: 588
4: 1286
Right 1156432864 18:37094255-37094277 GTGGCTAACAGGCCAGAGATTGG 0: 1
1: 0
2: 2
3: 58
4: 484
1156432857_1156432864 3 Left 1156432857 18:37094229-37094251 CCACTCGCCTCCTGCTGTGTGGC 0: 7
1: 298
2: 514
3: 752
4: 922
Right 1156432864 18:37094255-37094277 GTGGCTAACAGGCCAGAGATTGG 0: 1
1: 0
2: 2
3: 58
4: 484
1156432860_1156432864 -7 Left 1156432860 18:37094239-37094261 CCTGCTGTGTGGCCCAGTGGCTA 0: 1
1: 3
2: 230
3: 537
4: 1207
Right 1156432864 18:37094255-37094277 GTGGCTAACAGGCCAGAGATTGG 0: 1
1: 0
2: 2
3: 58
4: 484
1156432855_1156432864 7 Left 1156432855 18:37094225-37094247 CCTACCACTCGCCTCCTGCTGTG 0: 2
1: 172
2: 561
3: 937
4: 1358
Right 1156432864 18:37094255-37094277 GTGGCTAACAGGCCAGAGATTGG 0: 1
1: 0
2: 2
3: 58
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156432864 Original CRISPR GTGGCTAACAGGCCAGAGAT TGG Intronic
900575523 1:3380464-3380486 GAGGCTGTCAGGCCAGAGAGGGG + Intronic
902301485 1:15505652-15505674 GTGCCTCACAGGACAGAGACAGG + Intronic
902592710 1:17486407-17486429 GTTCCTAACAGGCCACAGACAGG - Intergenic
902803830 1:18848539-18848561 GTTCCTAACAGGCCACAGACTGG - Intronic
902938817 1:19784951-19784973 GTGGCCCACAGGCCGAAGATTGG + Intronic
903060781 1:20667103-20667125 GTTCCTAACAGGCCAGGGACTGG - Intronic
903442925 1:23401791-23401813 GTTCCTAACAGGCCACAGACTGG - Intronic
903487398 1:23700760-23700782 GTGGCTAAGAGCACAGAGTTTGG + Intergenic
903701979 1:25255956-25255978 GTTCCTAACAGGCCACAAATGGG + Intronic
905763581 1:40581404-40581426 GTTCCTAACAGGCCACAGACTGG - Intergenic
906955411 1:50369962-50369984 GTCCCTGACAGGCCAGAAATTGG - Intergenic
907057455 1:51383661-51383683 GTTCCTAACAGGCCACAGACTGG + Intronic
907064535 1:51467614-51467636 GTTCCTAACAGGCCATGGATGGG - Intronic
907571064 1:55484454-55484476 GTGGCTAACAAGCTAAAAATGGG - Intergenic
907583772 1:55595995-55596017 GTGGTTACCAAGCCAGGGATGGG - Intergenic
907733622 1:57090796-57090818 GTTTCTAACAGGCCACAGATTGG - Intronic
907911176 1:58828096-58828118 GTTCCTAACAGGCCACAGATGGG - Intergenic
908172183 1:61516297-61516319 GTTCCTAACAGGCCACAGACTGG - Intergenic
908309032 1:62857145-62857167 GTTCCTAACAGGCCACAGACTGG - Intronic
909221601 1:72969310-72969332 GTTCCTAACAGGCCACAGACAGG + Intergenic
909329365 1:74393976-74393998 GTTTCTAACAGGCCACAGGTTGG + Intronic
909516029 1:76508350-76508372 GTTCCTAACAGGCCAGGGACAGG + Intronic
910953744 1:92679004-92679026 GTTCCTAACAGGCCACAGACTGG - Intronic
911894031 1:103406488-103406510 GTTCCTAACAGGCCAGGGACTGG - Intergenic
912933970 1:113986786-113986808 GTGGCCCACAGGCCAGGGGTTGG + Intergenic
914379753 1:147105507-147105529 GTGCCTAACAGACCAGGGACAGG + Intergenic
916303573 1:163303695-163303717 GTTCCTAACAGGCCACAGACCGG - Intronic
916705660 1:167346736-167346758 GTTCCTAGCAGGCCACAGATTGG + Intronic
917098947 1:171426786-171426808 GTTCCTAACAGGCCACAGACTGG + Intergenic
917146057 1:171892964-171892986 GTTCCTAACAGGCCATGGATAGG + Intronic
918287556 1:183072640-183072662 GTTCCTAACAGGCCACAGACTGG - Intronic
918460116 1:184767755-184767777 GTTCCTAACAGGCCACTGATGGG - Intergenic
920685894 1:208108825-208108847 GTGGCTCAGAGGACAGAGAGTGG + Intronic
921377739 1:214491643-214491665 GTTCCTAACAGGCCAGGGACTGG + Intronic
921384396 1:214553870-214553892 GTGGCAAAGAGGGCAGAGCTTGG + Intergenic
921768736 1:219007705-219007727 TTGGCTGACAAGCCAGAGATTGG - Intergenic
922329349 1:224560424-224560446 GTTCCTAACAGGCCACAGAGTGG - Intronic
923576942 1:235167398-235167420 GTGCCAAACAGAACAGAGATTGG + Exonic
923618421 1:235557090-235557112 GTTCCTAACAGGCCACAGACTGG + Intronic
923704427 1:236332526-236332548 GTTCCTAACAGGCCACAGACTGG - Intergenic
924030179 1:239878508-239878530 GTTCCTAACAGGCCACAGACTGG + Intronic
924072723 1:240298504-240298526 GTTCCTAACAGGCCACAGAATGG - Intronic
1064104415 10:12489249-12489271 GTTTCTAACAGGCCACAGACTGG + Intronic
1064119930 10:12609743-12609765 GTTTCTAACAGGCCACAGACTGG + Intronic
1064688577 10:17890793-17890815 GTTCCTAACAGGCCATGGATTGG - Intronic
1065666142 10:28063541-28063563 GTTCCTAACAGGCCACAGACTGG - Intronic
1065715360 10:28561681-28561703 ATTGCTAACAGGCCACAGAAAGG - Intronic
1065758642 10:28960142-28960164 GTTCCTAACAGACCAGGGATTGG + Intergenic
1067139228 10:43642435-43642457 GTTCCTAACAGGCCACAGACTGG - Intergenic
1068544294 10:58328518-58328540 GTTCCTAACAGGCCACAGACTGG + Intergenic
1068676335 10:59773404-59773426 GTTCCTAACAGGCCACAGATGGG - Intergenic
1069136470 10:64772918-64772940 GTTCCTAACAGGCCACAGACTGG - Intergenic
1070414324 10:76175514-76175536 GTTGTTAACAGGCCAGATAAGGG + Intronic
1072002532 10:91210734-91210756 GTAGCTCACAGGACAGAGAAAGG - Intronic
1073188760 10:101634998-101635020 GTTGCTAACAGGCCATGGACTGG - Intronic
1074621070 10:115123682-115123704 GTTGCTAACAGGCCATGGACTGG - Intronic
1075610084 10:123846533-123846555 GTTCCTAACCGGCCATAGATTGG + Intronic
1077946339 11:6904287-6904309 GTTCCTAACAGGCCAGGAATTGG + Intergenic
1078812660 11:14783889-14783911 GTTCCTAACAGGCCACAGACCGG - Intronic
1079000378 11:16749489-16749511 GTTTCTAACAGGCCAGGGATGGG - Intronic
1079578928 11:22037713-22037735 GTTGCTAACAGGCCAGGAACTGG + Intergenic
1079785912 11:24672849-24672871 GTTCCTAACAGGCCACGGATTGG - Intronic
1080031190 11:27662805-27662827 GTTCCTAACAGGCCAGGGACTGG + Intronic
1080299611 11:30769398-30769420 GTGGATATCAGACCAGATATTGG + Intergenic
1080412368 11:32037898-32037920 GAGGCCAAAAGGCCAGAAATGGG - Intronic
1080471499 11:32550308-32550330 GTTCCTAACAGGCCACAGATCGG - Intergenic
1080512405 11:32987961-32987983 GTTGCTAACAGGCCACAGACTGG - Intronic
1081568811 11:44276928-44276950 GTTACTAACAGGCCATGGATCGG + Intronic
1082969768 11:59007320-59007342 GTGTCTAACAGGACATAGAAAGG + Intronic
1083149701 11:60784066-60784088 GTTCCTAACAGGCCACAGACTGG - Intergenic
1083864199 11:65444846-65444868 GTGGCTGACAGATCAGAGAATGG + Intergenic
1084388182 11:68857332-68857354 GTGTCATACAGGCCAGGGATGGG - Intergenic
1084788576 11:71458693-71458715 GTGGCTTACGGGGCTGAGATAGG - Intronic
1084932402 11:72567537-72567559 GTTTCTAACAGGCCAGGGACTGG + Intergenic
1086042107 11:82492116-82492138 GTTCCTAACAGGCCAAGGATGGG - Intergenic
1086734336 11:90286976-90286998 GTTCCTAACAGGCCATGGATGGG + Intergenic
1087812485 11:102623290-102623312 GTTCCTAACAGGCCACAGACTGG - Intronic
1088075838 11:105847351-105847373 GTTGCTAACAGGCCAGGGACCGG + Intronic
1088341463 11:108772642-108772664 GTTCCTAACAGGCCACAGACCGG - Intronic
1088609624 11:111564729-111564751 GTTCCTAACAGGCCAGGGATGGG - Intergenic
1089095137 11:115913793-115913815 GTTCCTAACAGGCCACAGACTGG - Intergenic
1089101323 11:115965112-115965134 GTTCCTAACAGGCCACAGACTGG + Intergenic
1089646804 11:119886007-119886029 GTGGCCAACATGCAGGAGATAGG - Intergenic
1090901646 11:131037568-131037590 GTTCCTAACAGGCCACAGACCGG + Intergenic
1091513986 12:1159466-1159488 GTTCCTAACAGGCCACAGACCGG + Intronic
1091755243 12:3047060-3047082 GTTCCTAACAGGCCACGGATGGG - Intergenic
1091907010 12:4197184-4197206 GAGGCTAGCAGCCCAGAGGTAGG + Intergenic
1092065858 12:5589283-5589305 GTGCCTAATAGGCCTGGGATGGG + Intronic
1092194909 12:6543299-6543321 GTTCCTAACAGGCCACAGACAGG - Intronic
1092392308 12:8091679-8091701 GTTTCTAACAGGCCACAGACTGG + Intronic
1092948055 12:13475138-13475160 GTGCCTGACAGGACAGAGACAGG - Intergenic
1094066185 12:26363035-26363057 GTTCCTAACAGGCCACAGACTGG - Intronic
1094075156 12:26464510-26464532 GTTCCTAACAGGCCACAGACTGG + Intronic
1095177595 12:39111100-39111122 GTTCCTAACAGGCCACAGACTGG - Intergenic
1095184096 12:39180696-39180718 GTTCCTAACAGGCCATAGACTGG + Intergenic
1095632239 12:44391940-44391962 CTGGCTAATAGGTCAGAGTTGGG - Intergenic
1095654333 12:44650979-44651001 GTTCCTAACAGGCCACAGACTGG - Intronic
1095914830 12:47467240-47467262 GTTCCTAACAGGCCACAGACTGG + Intergenic
1096431713 12:51549748-51549770 GTTCCTAACAGGCCACAGACAGG - Intergenic
1096917602 12:55049985-55050007 GTTCCTAACAGGCCAAGGATGGG + Intergenic
1097580896 12:61455034-61455056 GTTCCTAACAGGCCACAGCTTGG + Intergenic
1098006725 12:66005117-66005139 GTGGCTGACAGGCTGGAGACAGG - Intergenic
1098205517 12:68105243-68105265 CTGGGTAACAGGACAGAGAAGGG - Intergenic
1098314402 12:69178000-69178022 GTTCCTAACAGGCCAGAGACTGG + Intergenic
1099317776 12:81106107-81106129 GTTCCTAACAGGCCACAGACTGG - Intronic
1100230824 12:92605255-92605277 GTTCCTAACAGGCCATAGACTGG - Intergenic
1100456862 12:94760126-94760148 GTTCCTAACAGGCCACAGATCGG + Intergenic
1100688431 12:97012036-97012058 GTTCCTAACAGGCCAAAGACTGG - Intergenic
1101026454 12:100611778-100611800 ATTGCTAACAGGCCACAGACCGG + Intronic
1101399005 12:104372299-104372321 GTTCCTAACAGGCCACAGAGCGG + Intergenic
1102431396 12:112886567-112886589 GTTCCTAACAGGCCACAGACTGG + Intronic
1102770555 12:115472399-115472421 GTGCCTAAGAGGGCTGAGATTGG - Intergenic
1103214292 12:119189725-119189747 GTTCCTAACAGGCCACAGATGGG + Intronic
1103338543 12:120208721-120208743 GTGGCCCACAGGCCATGGATTGG - Intergenic
1103865344 12:124047324-124047346 GTTCCTAACAGGCCAAAGACAGG - Intronic
1105418251 13:20231776-20231798 GTGTCTAAGAGGCCAGAGTGAGG - Intronic
1105447185 13:20467843-20467865 GTTCCTAACAGGCCAGGGACCGG - Intronic
1105541672 13:21321458-21321480 GTGCCAAAGTGGCCAGAGATTGG + Intergenic
1105863490 13:24438400-24438422 GTTCCTAACAGGCCAGGGACTGG + Intronic
1106457153 13:29937440-29937462 GTTCCTAACAGGCCACAGACTGG - Intergenic
1106832743 13:33602649-33602671 GTTCCTAACAGGCCACAGACCGG - Intergenic
1107340340 13:39398679-39398701 GTTCCTAACAGGCCAGGGACTGG - Intronic
1107506621 13:41040743-41040765 GTTCCTAACAGGCCACGGATGGG + Intronic
1107871613 13:44751601-44751623 GTGGCCCACAGGCCACAGGTTGG + Intergenic
1108608210 13:52061334-52061356 GTTCCTAACAGGCCACAGACTGG + Intronic
1111454632 13:88464970-88464992 GTTCCTAACAGGCCAGGGACTGG - Intergenic
1112032999 13:95474426-95474448 GTTCCTAACAGGCCACAGACTGG + Intronic
1112917125 13:104565445-104565467 GTTTCTAACAGGCCACAGACTGG + Intergenic
1113825368 13:113248408-113248430 GTGGCTCACAGACCACATATGGG - Intronic
1113973364 13:114207676-114207698 GTTCCTAACAGGCCACAGACTGG + Intergenic
1114373289 14:22113646-22113668 GTTCCTAACAGGCCACAGAATGG + Intergenic
1115202566 14:30870465-30870487 GTTGCCAACAGGCCACAGACTGG - Intergenic
1115275964 14:31608816-31608838 GTTTCTAACAGGCCACAGACTGG + Intronic
1117574969 14:57088516-57088538 GTCCCTAACAGGCCACAGACTGG - Intergenic
1117706496 14:58475139-58475161 GTTCCTAACAGGCCACAGACTGG - Intronic
1117804641 14:59479002-59479024 GTGGCTCACAGGCCACGGGTGGG + Intronic
1118513798 14:66505644-66505666 GTTCCTAATAGGCCACAGATGGG - Intergenic
1118839628 14:69500788-69500810 GTGGGTGACAGGGCAGAGCTGGG + Intronic
1119121606 14:72084355-72084377 GTTCCTAACAGGCCACAGACTGG + Intronic
1119688486 14:76652346-76652368 GTTGCTAACGAGCCAGAGAGAGG - Intergenic
1120810924 14:88802721-88802743 GTTCCTAACAGGCCACAGATGGG - Intergenic
1122684620 14:103495520-103495542 GTGGCTAAAAGGGCAGAGTCTGG - Intronic
1122804572 14:104250048-104250070 GTGACTGGCAGGACAGAGATGGG + Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1125249053 15:37678344-37678366 GTTCCTAACAGGCCACAGACTGG + Intergenic
1125375869 15:39028824-39028846 GTTCCTAACAGGCCACAGACCGG - Intergenic
1126646884 15:50883604-50883626 GTTCCTAACAGGCCAGGGACCGG - Intergenic
1126821658 15:52510488-52510510 GTTCCTAACAGGCCAGGGACTGG - Intronic
1126911512 15:53422007-53422029 GTTCCTAACAGGCCACAGACTGG - Intergenic
1127008562 15:54597236-54597258 GTTCCTAACAGGCCACAGACCGG + Intronic
1127063537 15:55213497-55213519 GTTGCTAACAGGCCATGGATTGG - Intronic
1127320110 15:57835860-57835882 GTTCCTAGCAGGCCACAGATGGG + Intergenic
1127441836 15:59016742-59016764 GTTCCTAATAGGCCACAGATGGG - Intronic
1127681469 15:61302440-61302462 GTTCCTAACAGGCCATGGATGGG - Intergenic
1127899869 15:63333202-63333224 GAGGCTAAGAGGGCAGGGATGGG + Intronic
1127901055 15:63341294-63341316 GTTCCTAACAGGCCACAGACCGG - Intronic
1131714626 15:95094849-95094871 GTTCCTAACAGGCCAGGGACTGG + Intergenic
1131736557 15:95338815-95338837 ATGGCCAACAGGGCAGAGGTGGG + Intergenic
1131810581 15:96169048-96169070 GTTCCTAACAGGCCACAGATTGG - Intergenic
1132506704 16:313641-313663 GTGGCGCACAGACCAGAGCTGGG + Intronic
1133119986 16:3600304-3600326 GTTCCTAACAGGCCACAGACCGG + Intronic
1133660343 16:7910353-7910375 GTTCCTAACAGGCCACAGCTGGG + Intergenic
1133863756 16:9621815-9621837 GTTCCTAACAGGCCACGGATTGG + Intergenic
1134689244 16:16180218-16180240 GTTCCTAACAGGCCACAGACTGG + Intronic
1136060940 16:27726011-27726033 GTTCCTAACAGGCCACAGACTGG - Intronic
1136071751 16:27791634-27791656 GTGGCTGACAGGGGAGGGATGGG - Intronic
1137306280 16:47203757-47203779 GTTCCTAACAGGCCATGGATTGG + Intronic
1138335379 16:56248909-56248931 GTGGAGAACAGCCCAGAGACAGG + Intronic
1138812780 16:60170535-60170557 TTGGCAAACAGGATAGAGATTGG + Intergenic
1139305861 16:65985929-65985951 GTTCCTAACAGGCCACAGACTGG - Intergenic
1140884621 16:79232151-79232173 GTTCCTAACAGGCCATGGATTGG + Intergenic
1141216089 16:82025176-82025198 GTTCCTAACAGGCCACAGACTGG + Intergenic
1141870662 16:86783384-86783406 GTTCCTAACAGGCTACAGATTGG + Intergenic
1143518338 17:7431095-7431117 GTGGCGAACAGGGAAGGGATGGG - Intergenic
1144570740 17:16397017-16397039 GTGGTTTACAGGACAGAGCTTGG - Intergenic
1145362875 17:22226791-22226813 GTGGTTTACAGGACAGAGCTTGG - Intergenic
1146723183 17:35137556-35137578 GTGGATCACAGGCCTGAGCTGGG - Exonic
1147332908 17:39709439-39709461 ATGGCTTACAGGCCCGAGAGCGG - Exonic
1147505871 17:41016808-41016830 GTTCCTAACAGGCCAGGGACAGG + Intronic
1148041308 17:44709367-44709389 GTGGGTAACAGGACAGAACTAGG + Intronic
1149440287 17:56668053-56668075 GTTCCTAACAGGCCACAGACTGG - Intergenic
1150517109 17:65825426-65825448 GTTCCTAACAGGCCACAGACAGG + Intronic
1151413409 17:73946133-73946155 GTTCCTAACAGGCCACAGACTGG - Intergenic
1152414518 17:80150607-80150629 GTTCCTAACAGGCCACAGACAGG - Intergenic
1153205574 18:2696290-2696312 GTTCCTAAAAGGCCACAGATGGG - Intronic
1154443706 18:14415657-14415679 GTGGCTAAAAGGCTAAATATAGG - Intergenic
1155108012 18:22686927-22686949 GTTCCTAACAGGCCATGGATTGG + Intergenic
1155307503 18:24492855-24492877 CTGTGTAACAGGCGAGAGATGGG + Intergenic
1155690701 18:28618828-28618850 GCTCCTAACAGGCCAGAGACAGG + Intergenic
1155759638 18:29549619-29549641 GTTCCTAACAGGCCACAGACTGG - Intergenic
1155908328 18:31479022-31479044 GTTCCTAACAGGCCACAGACAGG + Intergenic
1156048186 18:32900842-32900864 GTTTGTAAAAGGCCAGAGATTGG + Intergenic
1156276179 18:35584877-35584899 GTTTCTAACAGGCCACAGACTGG + Intronic
1156432864 18:37094255-37094277 GTGGCTAACAGGCCAGAGATTGG + Intronic
1157468523 18:47969298-47969320 GTTCCTAACAGGCCATGGATGGG - Intergenic
1157605642 18:48924367-48924389 GTGGCTGACAGGCCTGGCATGGG - Intronic
1157691645 18:49687291-49687313 GTTTCTAACAGGCCACAGACCGG + Intergenic
1158010397 18:52721395-52721417 GTGCCTAACAGGACAGTGAGGGG + Intronic
1158197564 18:54905743-54905765 ATGCCTAACAGGCCATAGACTGG - Intronic
1158595997 18:58816555-58816577 GTTCCTAACAGGCCACAGACCGG + Intergenic
1158862913 18:61610566-61610588 GTTTCTAACAGGCCACAGACTGG + Intergenic
1158909524 18:62046329-62046351 GTTCCTAACAGGCCACAGACTGG - Intronic
1160223236 18:76992428-76992450 GTTTCTAACAGGCCACAGAGCGG + Intronic
1160606793 18:80057696-80057718 GTTCCTAACAGGCCACAGATGGG - Intronic
1161046641 19:2138420-2138442 CTGGCAAACAGGCCAGAGGGTGG - Intronic
1161293710 19:3508865-3508887 GGGGCTCACAGTCCAGACATTGG - Intronic
1161816106 19:6501186-6501208 GGGGCCCACAGACCAGAGATGGG - Intronic
1161935360 19:7368580-7368602 GTGGGAGCCAGGCCAGAGATGGG - Intronic
1162037457 19:7949437-7949459 GTTCCTAACAGGCCACAGACAGG + Intergenic
1163595542 19:18219153-18219175 TGGGCAAACAGGCCCGAGATAGG + Intronic
1163616835 19:18334152-18334174 GTTCCTAACAGGCCACAGACTGG - Intergenic
1163704615 19:18804885-18804907 AGGGCTCCCAGGCCAGAGATGGG + Intergenic
1164160744 19:22624036-22624058 GTGGCTGCCAGGCTAGGGATGGG - Intergenic
1165450612 19:35879942-35879964 GGGGCTCAGAGGCCAGGGATAGG + Intergenic
1167502937 19:49857586-49857608 GGGGCTAACAGGCCAAGGCTCGG + Intronic
1167734264 19:51282269-51282291 GGGGCTGAAAGGCCAGAGGTAGG + Intergenic
1167986771 19:53325027-53325049 GTTCCTAACAGGCCATAGACTGG - Intergenic
1168384640 19:55953000-55953022 GTTCCTAACAGGCCACAGACTGG - Intronic
1168568722 19:57446132-57446154 GTTCCTAACAGGCCACAGACTGG - Intronic
925103829 2:1272434-1272456 GTTCCTAACAGGCCACAGACTGG + Intronic
925221896 2:2148473-2148495 GTTCCTAACAGGCCACGGATAGG + Intronic
925715083 2:6776634-6776656 GTTTCTAACAGGTCAGAGGTTGG - Intergenic
926562206 2:14430151-14430173 GTTCCTAACAGGCCAAAGACTGG - Intergenic
927204461 2:20598511-20598533 GTTCCTAACAGGCCAGGGACCGG + Intronic
927926624 2:27018220-27018242 GTGGCTGACAGGCCTCAGAGGGG - Intronic
928711990 2:34017655-34017677 GTTCCTAACAGGCCACAGACTGG + Intergenic
929344549 2:40865121-40865143 CTGGTTAACAGGCCAGGGAAAGG - Intergenic
931550997 2:63446204-63446226 GTTGCTAACAGGCCACAGATGGG - Intronic
932054344 2:68429607-68429629 GTTCCTAACAGGCCATAGACTGG - Intergenic
933888218 2:86740030-86740052 GTTCCTAACAGGCCACAGAGGGG - Intronic
933921960 2:87056676-87056698 GTTCCTAACAGGCCACAGAGGGG + Intergenic
934876097 2:97922296-97922318 GTTCCTAACAGGCCACAGACCGG + Intronic
935228198 2:101072779-101072801 GTTCCTAACAGGCCACAAATTGG + Intronic
935633821 2:105234404-105234426 GTTCCTAACAGGCCAGGGAAAGG + Intergenic
935725672 2:106021819-106021841 GTTCCTAACAGGCCACAGATTGG - Intergenic
935870999 2:107449679-107449701 GTTTCTAACAGGCCACAGAAGGG + Intergenic
936034506 2:109100201-109100223 GTTCCTAACAGGCCACAGACTGG - Intergenic
937455292 2:122036095-122036117 GTTCCTAACAGGACACAGATTGG - Intergenic
937832835 2:126442675-126442697 GTGTCTCACAGGCCAAATATGGG - Intergenic
938889234 2:135686044-135686066 ATGGCAAACAGGCCAGAGAAAGG + Intronic
939100432 2:137889380-137889402 GTGGCTAAAAGGCCAAATATAGG + Intergenic
940293786 2:152101683-152101705 GTTCCTAACAGGCCACAGACTGG - Intergenic
940940045 2:159549694-159549716 GTGGCCCACAGGCCACAGGTTGG + Intronic
941002731 2:160218729-160218751 GTTGCTAACAGGCCACAGACTGG - Intronic
941500134 2:166263807-166263829 GTGAGTACCGGGCCAGAGATTGG + Intronic
942338816 2:174921147-174921169 GTTCCTAACAGGCCACAGAGTGG + Intronic
943742987 2:191431275-191431297 GTTCCTAACAGGCCATAGACCGG - Intergenic
944311606 2:198239912-198239934 GTTCCTAACAGGCCACAGACTGG - Intronic
944612521 2:201426100-201426122 GTTCCTGACAGGCCACAGATGGG - Intronic
944896195 2:204167782-204167804 GTTCCTAACAGGCCACAGACTGG - Intergenic
945027310 2:205631416-205631438 GTTCCTAACAGGCCACAGACCGG + Intergenic
945526592 2:210895383-210895405 GTTCCTAACAGGCCACAGACTGG + Intergenic
946064247 2:216973137-216973159 GTGCATGACAGGCCAGAGAGTGG + Intergenic
946779309 2:223176567-223176589 GTTCCTAACAGGCCACAGACCGG - Intronic
947287197 2:228530041-228530063 GTTCCTAAAAGGCCAGGGATTGG - Intergenic
948165358 2:235857107-235857129 GTTCCTAACAGGCCACAGACTGG - Intronic
948330189 2:237158423-237158445 GTTCCTAACAGGCCACAGACTGG + Intergenic
948535741 2:238645243-238645265 GTTCCTAACAGGCCACAGACAGG - Intergenic
948654740 2:239469619-239469641 GTTCCTAACAGGCCACAGACTGG + Intergenic
1168811549 20:707945-707967 GTGGCTTCCAGGCCAGAGCTGGG - Intergenic
1169322014 20:4640763-4640785 GTTCCTAACAGGCCACAGACTGG - Intergenic
1169482891 20:6001344-6001366 GTTCCTAACAGGCCATGGATTGG + Intergenic
1169946675 20:10996489-10996511 GTTCCTAACAGGCCACAGACTGG - Intergenic
1170135538 20:13069645-13069667 GTTCCTAACAGGCCACAGACTGG + Intronic
1170195875 20:13689010-13689032 GTTCCTAACAGGCCAGGGACTGG - Intergenic
1170789739 20:19497899-19497921 GTTCCTAACAGGCCAGGGATTGG - Intronic
1172622004 20:36323931-36323953 GTTCCTAACAGGCCACAGACTGG + Intronic
1174300118 20:49575714-49575736 TTGGCTAAGAGCCCAGAGGTGGG + Intergenic
1174744480 20:53048023-53048045 GGGGCAGACAGGCCTGAGATGGG - Intronic
1175805866 20:61829104-61829126 GTTCCTAACAGGCCACAGACCGG + Intronic
1176452381 21:6875566-6875588 GTGGCTAAAAGGCTAAATATAGG + Intergenic
1176830554 21:13740615-13740637 GTGGCTAAAAGGCTAAATATAGG + Intergenic
1177417161 21:20808760-20808782 GTTCCTAACAGGCCACAGACCGG - Intergenic
1178319723 21:31596157-31596179 GTTCCTAACAGGCCACAGAACGG - Intergenic
1179057086 21:37946181-37946203 GTTCCTAACAGGCCACAGAGCGG - Intergenic
1179074452 21:38106935-38106957 GTTCCTAACAGGCCAGGGACTGG - Intronic
1179176329 21:39010706-39010728 GAGGCCAGCAGGCCAGAGCTGGG - Intergenic
1180100778 21:45584005-45584027 GTTCCTAACAGGCCACAGACTGG + Intergenic
1180749436 22:18114007-18114029 GTGGATAGCGGGCCAGTGATGGG + Intronic
1180900452 22:19368131-19368153 GGGGCTAACAGGCCAGAGGCTGG - Intronic
1181020160 22:20096095-20096117 GTTCCTAACAGGCCATGGATTGG + Intronic
1181567343 22:23747210-23747232 GTTCCTAACAGGCCACAGACTGG - Intronic
1182722574 22:32415267-32415289 GTTCCTAACAGGCCACAGACCGG + Intronic
1183076015 22:35427328-35427350 GTTGCTTACAGGCAAGAGAATGG - Intergenic
1183377210 22:37472320-37472342 GTGGCTGACAGCACAGAGCTAGG - Intronic
1183461323 22:37952736-37952758 GTTCCTAACAGGCCAGGGACTGG - Intronic
1183808944 22:40237804-40237826 GTGTCTAAGAGGGAAGAGATGGG - Intronic
1184040504 22:41940287-41940309 GTGGTAAACAGGCAAGAGTTAGG - Intronic
1184276060 22:43410498-43410520 GGGGCCCTCAGGCCAGAGATGGG - Intergenic
1184475657 22:44719975-44719997 GGGGCTAGCAGGCCACAGAGGGG - Intronic
1184901256 22:47447940-47447962 GTGGGTTGGAGGCCAGAGATGGG + Intergenic
1185230188 22:49675782-49675804 TTGGCTTACAGGCCAGGGTTAGG - Intergenic
949293665 3:2495524-2495546 GTTCCTAACAGGCCACAGACAGG - Intronic
950073852 3:10173247-10173269 GTGGTTCAGAGGCCAGATATTGG - Intronic
950474504 3:13207027-13207049 CTGGCTAATATGCTAGAGATGGG - Intergenic
950966674 3:17151601-17151623 GTGGCAGACAGGTGAGAGATGGG - Intergenic
951628149 3:24689472-24689494 GTTCCTAACAGGCCACAGACTGG - Intergenic
953227451 3:41033672-41033694 GTTCCTAACAGGCCACAGATTGG + Intergenic
954290642 3:49648233-49648255 GGGGTTCGCAGGCCAGAGATGGG + Intronic
954476351 3:50749980-50750002 GTTCCTAACAGGCCACAGATTGG - Intronic
955617581 3:60825504-60825526 GTCCCTAACAGGCCACAGACTGG - Intronic
955623901 3:60895960-60895982 GTTCCTAACAGGCCACAGACTGG - Intronic
955718973 3:61862031-61862053 GTTCCTAACAGGCCAGGGACCGG - Intronic
956213831 3:66827921-66827943 GTTCCTAACAGGCCACAGACCGG + Intergenic
956247980 3:67205273-67205295 GTTCCTAACAGGCCAGGGACTGG - Intergenic
956877514 3:73478193-73478215 GTTACTAACAGGCCACAGACTGG - Intronic
957724249 3:84044458-84044480 GTTCCTAACAGGCCACGGATGGG + Intergenic
958920228 3:100097007-100097029 GTTCCTAACAGGCCACAGAGTGG - Intronic
959987867 3:112597320-112597342 CCGGCTAAGAGGCCAAAGATGGG - Intergenic
960537556 3:118830158-118830180 GTTTCTAACAGGCCACAGACTGG - Intergenic
960766448 3:121135745-121135767 GTTCCTAACAGGCCACAGACTGG + Intronic
960984144 3:123261835-123261857 GTGACTACCAGGCTATAGATAGG + Intronic
961029120 3:123586407-123586429 GTTCCTAACAGGCCAGGGATTGG + Intergenic
961034395 3:123632292-123632314 GTGGCTGACAGGCAAGAGACAGG - Intronic
961727287 3:128939935-128939957 GTTCCTAACAGGCCAGAGACCGG + Intronic
962053215 3:131841398-131841420 GTTCCTAACAGGCCACAGACTGG - Intronic
962197620 3:133377735-133377757 GTTCCTAACAGGCCACAGACTGG - Intronic
962883135 3:139598137-139598159 GAGCCTACCAGGCCAGAGAATGG - Intronic
962970913 3:140401046-140401068 GCGGCTTACAGGCCAGCGCTGGG + Intronic
963118390 3:141753641-141753663 GTTCCTAACAGGCCAGGGACTGG + Intergenic
963356629 3:144216086-144216108 GTTCCTAACAGGCCAGGGACTGG + Intergenic
963536789 3:146539410-146539432 GTTCCTAACAGGCCACAGACTGG + Intronic
964876825 3:161376885-161376907 GTTCCTAACAGGCCACAGATAGG - Intergenic
965305588 3:167059550-167059572 TAGGCTTCCAGGCCAGAGATGGG + Intergenic
965639274 3:170815520-170815542 GTTCCTAACAGGCCACAGACTGG - Intronic
966363394 3:179154238-179154260 GTTCCTAACAGGCCAGGGACAGG - Intronic
966823579 3:183944633-183944655 GTGGCTCAAGGGCCACAGATTGG - Intronic
967009868 3:185422803-185422825 GTTCCTAACAGGCCACAGACTGG - Intronic
967226645 3:187298369-187298391 GTGTCTCACAGGCCAGAGCGGGG + Intergenic
967455147 3:189676739-189676761 GTTCCTAACAGGCCACAGATGGG - Intronic
968331485 3:197874173-197874195 GTTCCTAACAGGCCACAGACTGG - Intronic
968675260 4:1874559-1874581 GAGGCAAACAGGCCAGATATCGG - Intronic
969120866 4:4910109-4910131 GTTCCTAACAGGCCAAGGATCGG - Intergenic
970170021 4:13280171-13280193 GTTCCTAACAGGCCACAGACTGG - Intergenic
970388896 4:15587315-15587337 GTTCCTAACAGGCCACAGACTGG + Intronic
970620829 4:17816369-17816391 GTTCCTAACAGGCCACAGACTGG + Intronic
970924422 4:21434517-21434539 GTTCCTAACAGGCCACAGAGTGG - Intronic
972622569 4:40762668-40762690 GTTCCTAACAGGCCACAGACAGG - Intronic
972663389 4:41140605-41140627 GTTCCTAACAGGCCACAGACTGG - Intronic
973789348 4:54364065-54364087 GAGTGTGACAGGCCAGAGATGGG + Intergenic
974347832 4:60704357-60704379 GTTCCTAACAGGCCACAGAGTGG - Intergenic
975039739 4:69731142-69731164 GTTCCTAACAGGCCACTGATTGG - Intronic
977173345 4:93789849-93789871 GTTCCTAACAGGCCATGGATTGG - Intergenic
977189037 4:93977096-93977118 CTGGGTAACAGGGCAGAGGTTGG + Intergenic
977420606 4:96795202-96795224 GTTTCTAACAGGCCACAGACTGG + Intergenic
977655516 4:99516741-99516763 GTGGATAAGAGGCCAGATTTAGG + Intronic
978623192 4:110655111-110655133 GTTCCTAACAGGCCACAGACTGG + Intergenic
978989026 4:115054927-115054949 GTTGCTAACAGGCCACAGACTGG - Intronic
979489510 4:121309019-121309041 GTTCCTAACAGGCCACAGACAGG - Intergenic
979790977 4:124780881-124780903 GTTCCTAACAGGCCAGGGACAGG - Intergenic
980987613 4:139710955-139710977 GGGGGTAACAGGACAGAGAAGGG + Intronic
981591311 4:146365853-146365875 GTTCCTAACAGGCCACAGACTGG - Intronic
982023896 4:151232953-151232975 GTTCCTAACAGGCCATAGACTGG - Intronic
982049469 4:151486197-151486219 GTTCCTAACAGGCCAGAGACTGG + Intronic
982146833 4:152403792-152403814 GTTCCTAACAGGCCACAGACTGG + Intronic
982679215 4:158408958-158408980 GTGCCTAACAGGCCATGGATTGG + Intronic
983317845 4:166154836-166154858 GTGGCTAAGAGGAGAGAGAAGGG + Intergenic
983869034 4:172803219-172803241 GTTCCTAACAGGCCACACATGGG - Intronic
984385295 4:179048035-179048057 GTTCCTAACAGGCCACAGACTGG + Intergenic
984772943 4:183454120-183454142 GTTCCTAACAGGCCACAGACTGG + Intergenic
984861770 4:184246693-184246715 GTTCCTAACAGGCCATGGATGGG + Intergenic
985002545 4:185500309-185500331 GTTGCTAAAAGGCCACAGACTGG + Intergenic
985432771 4:189897396-189897418 GTGGCCCACAGGCCACAGGTTGG + Intergenic
985488753 5:166657-166679 GTTCCTAATAGGCCACAGATGGG + Intronic
987018829 5:13848875-13848897 GTTCCTAACAGGCCACAGACTGG + Intronic
987060428 5:14237997-14238019 GTGGATAACAGGCAGGATATGGG - Intronic
987184939 5:15407696-15407718 GTTCCTAACAGGCCACAGACCGG + Intergenic
988135917 5:27171738-27171760 GCGCCTAACAGGCCAGGGACTGG - Intergenic
989120138 5:37996973-37996995 CTGGCTAACAGTCAGGAGATGGG + Intergenic
989547709 5:42693750-42693772 GTGGCTCACAGGCCAGACTGTGG - Intronic
990957558 5:61358892-61358914 GCTGCTAACAGGCTAGTGATTGG + Intronic
991036848 5:62135925-62135947 GTTCCTAACAGGCCATAGACCGG + Intergenic
991279871 5:64900897-64900919 GTGGCCCACTGGCCACAGATTGG - Intronic
992589477 5:78278711-78278733 GTTTCTAACAAGCCACAGATGGG - Intronic
992613520 5:78528268-78528290 GTTCCTAACAGGCCACAGACCGG - Intronic
992652736 5:78876765-78876787 GTTCCTAATAGGCCACAGATGGG - Intronic
993855208 5:93065956-93065978 GTTCCTAACAGGCCACAGAGTGG - Intergenic
994166740 5:96616693-96616715 GTGTCTAAGAGGCCACACATTGG - Intronic
994198028 5:96941329-96941351 ATTCCTAACAGGCCAGAGACTGG + Intronic
995627816 5:114098367-114098389 GTTCCTAACAGGCCACAGACTGG - Intergenic
996075383 5:119186706-119186728 ATGGCTAACAGGCTACACATAGG - Intronic
996228366 5:121030403-121030425 GTTCCTAACAGGCCACAGACTGG + Intergenic
996238750 5:121168840-121168862 GTTGCTAACAGGCCAAAGACTGG + Intergenic
997221945 5:132176531-132176553 GTTGCTAACAGGCCACTGACCGG - Intergenic
997424371 5:133793232-133793254 GTCACTAACAGGGCAGAGACTGG - Intergenic
997461260 5:134053941-134053963 GTGGGTTACAGGCCAGAGGAGGG + Intergenic
997924330 5:138014320-138014342 GTTCCTAACAGGCCACAGACTGG - Intronic
998008145 5:138671225-138671247 GTTCCTAACAGGCCAGGGACTGG + Intronic
999512661 5:152268936-152268958 GTTCCTAACAGGCCATAGACTGG + Intergenic
999635391 5:153616563-153616585 GTGGCTCACAGGCCACAGGTTGG + Intronic
999762076 5:154710164-154710186 GTTTCTAACAGGCCACAGACTGG + Intergenic
999871733 5:155758510-155758532 GTTGCTAACAGGCCATGGACCGG - Intergenic
1001271673 5:170317228-170317250 GTGTCTAACGGGCAAGTGATGGG + Intergenic
1002183290 5:177442380-177442402 GTGCCAAAGTGGCCAGAGATTGG + Exonic
1003037908 6:2661367-2661389 GGGGCTAAAAGGCCAGAGAGCGG + Intergenic
1003129412 6:3382533-3382555 GTTGCTACTAGGTCAGAGATGGG - Intronic
1003231945 6:4262177-4262199 GTTCCCAACAGGCCAGAGATCGG - Intergenic
1004795629 6:19080167-19080189 GTTCCTAACAGGCCACAGACCGG - Intergenic
1005086784 6:22015161-22015183 GTTCCTAACAGGCCACAGACTGG - Intergenic
1005387973 6:25304651-25304673 GTTCCTAACAGGCCACAGACTGG + Intronic
1006720169 6:36145076-36145098 GTTCCTAACAGGCCACAGACAGG + Intergenic
1007152647 6:39709515-39709537 GTTCCTAACAGGCCACAGACTGG + Intronic
1008523813 6:52387727-52387749 GTTCCTAACAGGCCACAGACAGG - Intronic
1008620398 6:53265805-53265827 GTGGATAAGAGGCGAGAGAGAGG - Intergenic
1008955662 6:57213266-57213288 GTTCCTAACAGGCCACAGAACGG + Intronic
1009513418 6:64582207-64582229 GTTCCTAACAGGCCACAGACAGG - Intronic
1011637646 6:89389078-89389100 GTTCCTAACAGGCCACAGACTGG + Intronic
1012211995 6:96530927-96530949 GTTCCTAACAGGCCACAGACTGG - Intronic
1012753208 6:103189839-103189861 GTTCCTAACAGGCTAGAGACTGG - Intergenic
1012828676 6:104179626-104179648 GTTCCTAACAGGCCAGAGATGGG + Intergenic
1012973391 6:105754914-105754936 GTTCCTAACAGGCCACAGAATGG - Intergenic
1013739885 6:113270100-113270122 GTGGCCCACAGGCCATGGATTGG - Intergenic
1014136795 6:117898689-117898711 GTTCCTAACAGGCCATGGATTGG - Intergenic
1014460446 6:121688322-121688344 GTTCCTAACAGGCCACAGACAGG + Intergenic
1014541012 6:122676392-122676414 GTTCCTAACAGGCCATGGATTGG + Intronic
1014895900 6:126898658-126898680 GTTCCTAACAGGCCACAGACTGG + Intergenic
1015305044 6:131697798-131697820 GTTCCTAACAGGCCACAGACAGG + Intronic
1015553851 6:134440677-134440699 GTTTCTAACAGGCCACAGACTGG - Intergenic
1015942760 6:138468396-138468418 GTTCCTAACAGGCCACAGATGGG - Intronic
1015985663 6:138881875-138881897 GTTCCTAACAGGCCACAGACTGG + Intronic
1016634265 6:146269554-146269576 GTTCCTAACAGCCCACAGATTGG - Intronic
1016666908 6:146652928-146652950 GTTCCTAACAGGCCACAGATTGG - Intronic
1016757012 6:147698185-147698207 GTTCCTAACAGGCCACAGACCGG + Intronic
1017326202 6:153143865-153143887 ATGGATAACAGGGCAGAGAGTGG - Intergenic
1017722989 6:157257129-157257151 GTTTCTAACAGGCCAGGGGTGGG + Intergenic
1017735597 6:157360088-157360110 GTTCCTAACAGGCCATAGACAGG + Intergenic
1018489301 6:164275414-164275436 GTTCCTAACAGGCCACAGACTGG - Intergenic
1019096392 6:169584070-169584092 GTGGTTAACAGGGTAGACATAGG - Intronic
1019466321 7:1191362-1191384 GTTCCTAACAGGCCATGGATGGG - Intergenic
1021139525 7:17006914-17006936 GTGGCCCACAGGCCATAGGTTGG - Intergenic
1021448675 7:20760565-20760587 GTTCCTAACAGGCCATGGATTGG - Intronic
1022229917 7:28404787-28404809 GTTGAGAACAAGCCAGAGATTGG - Intronic
1023327030 7:39071420-39071442 GTTCCTAACAGGCCACAGACTGG + Intronic
1023383922 7:39635849-39635871 GTTCCTAACAGGCCACAGACTGG + Intronic
1023396522 7:39756928-39756950 GTGGCTTCCAGGTCACAGATAGG + Intergenic
1023591005 7:41780509-41780531 GTTCCTAACAGGCCACAGACTGG - Intergenic
1024410408 7:49034235-49034257 GTTTCTAACAGGCCACAGACTGG + Intergenic
1024493723 7:50017451-50017473 GTTCCTAACAGGCCATGGATTGG + Intronic
1024690424 7:51795490-51795512 GTTCCTAACAGGCCACAGACAGG + Intergenic
1026149607 7:67776833-67776855 GTTCCTAACAGGCCAGAAACAGG + Intergenic
1026310101 7:69175852-69175874 GTTGCTAACAGGCCACAGACCGG - Intergenic
1026313781 7:69210866-69210888 GTTCCTAACAGGCCACAGACTGG - Intergenic
1026620446 7:71945480-71945502 GTTCCTAACAGGCCACAGACTGG - Intronic
1027452767 7:78351640-78351662 GTTGGTAACAGTGCAGAGATGGG - Intronic
1028649621 7:93137193-93137215 GTTTCTAACAGGCTAGAGACTGG - Intronic
1028798889 7:94938087-94938109 GTATCTAACAGGCCACAGACTGG - Intronic
1029431793 7:100535999-100536021 GTTCCTAACAGGCCACAGACAGG + Intergenic
1030661551 7:112224382-112224404 GTGGCCCACGGGCCAGGGATTGG + Intronic
1031758123 7:125673335-125673357 GTGACTCACAGGCCACAGGTTGG - Intergenic
1032198564 7:129803922-129803944 ATGGAAAACAGGCCAGAGATCGG + Intergenic
1032423638 7:131802872-131802894 GTGGCTCACAAGCAAGAGATAGG + Intergenic
1032446093 7:131984874-131984896 GTTCCTAACAGGCCACAGAGTGG - Intergenic
1033335240 7:140446717-140446739 GTTCCTAACAGGCCACGGATTGG + Intergenic
1033479826 7:141728705-141728727 GTTCCTAACAGGCCACAGACTGG - Intronic
1033655013 7:143367282-143367304 GTGTCCAACAGATCAGAGATTGG - Intergenic
1034046178 7:147930048-147930070 GTTCCTAACAGGCCACAGACTGG + Intronic
1034468555 7:151243900-151243922 GGGGCTCCCAGGCCAGAGAATGG - Intronic
1035015061 7:155758582-155758604 GTTCCTAACAGGCCACAGACTGG + Intronic
1035286092 7:157808137-157808159 GTTCCTAACAGGCCACAGACTGG - Intronic
1036005089 8:4653013-4653035 GTTCCTAACAGGCCACAGATAGG + Intronic
1037530334 8:19766614-19766636 GTTCCTAACAGGCCAGAGACTGG - Intergenic
1037690392 8:21176907-21176929 GTTCCTAACAGGCCACAGACTGG + Intergenic
1037697214 8:21234294-21234316 GTGGCTAACAGCACAGAGCATGG + Intergenic
1037755806 8:21709510-21709532 GTGGCTAACAGACAAAAGATGGG + Intronic
1038191088 8:25321731-25321753 GTTCCTAACAGGCCACAGACTGG + Intronic
1038243761 8:25834620-25834642 GTTCCTAACAGGCCATGGATTGG - Intergenic
1038351569 8:26780655-26780677 GTTTCTAACAGGCCACAGACTGG - Intronic
1038651522 8:29407932-29407954 GTGGCCCACAGGCCACAGGTTGG - Intergenic
1038706586 8:29899570-29899592 GTTCCTAACAGGCCACAGACTGG - Intergenic
1039114241 8:34074493-34074515 GTTCCTAACAGGCCACAGATGGG + Intergenic
1039295188 8:36143352-36143374 AGGGCAAACAGGCCAGAGACTGG + Intergenic
1040031094 8:42824428-42824450 GTTCCTAACAGGCCACAGACTGG + Intergenic
1040858975 8:51979393-51979415 GTTCCTAACAGGCCACAGAGCGG + Intergenic
1041048835 8:53913643-53913665 GTGGCAAAGAAGACAGAGATTGG + Intronic
1041928266 8:63260278-63260300 GTTCCTAACAGGCCACAGACTGG - Intergenic
1042033059 8:64498833-64498855 TTGACTAACATGCCAGAGTTAGG + Intergenic
1042905453 8:73767545-73767567 GTGGCTACAAAGGCAGAGATTGG + Intronic
1043007149 8:74833877-74833899 GTTTCTAACAGGCCACAGATGGG - Intronic
1043417920 8:80070639-80070661 GTTCCTAACAGGCCACAGATGGG + Intronic
1044067143 8:87712833-87712855 GTTCCTAACAGGCCAAGGATGGG - Intergenic
1044136711 8:88594761-88594783 GTTCCTAACAGGCCACAGACTGG + Intergenic
1044367417 8:91365401-91365423 GTGGCTCACAGGCCATGGGTTGG + Intronic
1044866393 8:96575101-96575123 GTTCCTAACAGGCCACGGATCGG + Intronic
1045283746 8:100772342-100772364 GTTCCTAACAGGCCACAGAAGGG + Intergenic
1045885949 8:107097978-107098000 GTTCCTAACAGGCCACAGAATGG + Intergenic
1046534950 8:115497417-115497439 GTTCCTAACAGGCCACAGACTGG + Intronic
1046760943 8:118019824-118019846 GTGGCTAAGAGGGCAGAGTCTGG - Intronic
1046764589 8:118056164-118056186 GTGGCCCACAGGCCACAGGTTGG + Intronic
1047188551 8:122657412-122657434 GTTCCTAACAGGCCATAGACTGG + Intergenic
1047512692 8:125527883-125527905 ATGGGTAACAGCCCAGAGATGGG - Intergenic
1047514035 8:125538035-125538057 GTTCCTAACAAGCCACAGATTGG + Intergenic
1048044823 8:130763734-130763756 GTTCCTAACAGGCCACAGACAGG + Intergenic
1048723760 8:137358434-137358456 GTTCCTAACAGGCCACAGATTGG - Intergenic
1049063216 8:140292417-140292439 GTGGCTAACAGGGCAGTGGAGGG + Intronic
1049309805 8:141927848-141927870 GCCGCTGACAGCCCAGAGATGGG + Intergenic
1049626056 8:143621990-143622012 GTTCCTAACAGGCCACAGACCGG + Intergenic
1050062938 9:1729446-1729468 GTAGCTAATAGGGCAGAAATTGG - Intergenic
1050127668 9:2376063-2376085 GTTCCTAACAGGCCACGGATTGG + Intergenic
1050424094 9:5496230-5496252 GTTCCTAACAGGCCATGGATGGG - Intergenic
1051554335 9:18365757-18365779 GTTCCTAACAGGCCACAGATAGG - Intergenic
1052293128 9:26866933-26866955 GTTCCTAACAGGCCACAGATTGG - Intronic
1053307429 9:36994449-36994471 CAGGCTTACAGGCCAGAGGTGGG - Intronic
1054809768 9:69425539-69425561 GTTCCTAACAGGCCACAGACTGG - Intergenic
1055909324 9:81329314-81329336 GTTCCTAACAGGCCACAGACTGG - Intergenic
1056144088 9:83712017-83712039 GTTCCTAACAGGCCACAGACTGG - Intergenic
1056189175 9:84167828-84167850 GTTCCTAACAGGCCACAGACTGG - Intergenic
1056885055 9:90433752-90433774 GTTCCTAACAGGCCACAGACAGG - Intergenic
1057007164 9:91570380-91570402 GTTCCTAACAGGCCACAGACTGG + Intronic
1058023211 9:100112763-100112785 GTGGCCCACAGGCCACAGGTTGG + Intronic
1059164346 9:112064205-112064227 GTTCCTAACAGGCCACAGACTGG - Intronic
1059338138 9:113581872-113581894 ATGGCTCACAGGCCAAAGACAGG - Intronic
1059795734 9:117694451-117694473 GTTCCTAACAGGCCACAGACTGG - Intergenic
1060188193 9:121576592-121576614 GCAGCTCACAGCCCAGAGATGGG - Intronic
1060333921 9:122703918-122703940 GTTCCTAACAGACCACAGATTGG - Intergenic
1060406742 9:123376591-123376613 CTGGCTAGAAGGACAGAGATGGG - Intronic
1062523240 9:136968273-136968295 GTGGCAAAGAGGTCACAGATGGG - Intergenic
1203516800 Un_GL000213v1:8949-8971 GTGGCTAAAAGGCTAAATATAGG - Intergenic
1185742375 X:2544139-2544161 GTTCCTAACAGGCCACAGACTGG - Intergenic
1185861617 X:3584701-3584723 GTTTCTAACAGGCCAGGGACTGG - Intergenic
1185981513 X:4785120-4785142 GTTCCTAACAGGCCACAGACCGG - Intergenic
1188065935 X:25659290-25659312 GTTCCTAACAGGCCACAGACTGG + Intergenic
1188232865 X:27687042-27687064 GTTCCTAACAGGCCACAGACAGG + Intronic
1188692645 X:33149464-33149486 GTTCCTCACAGGCCACAGATGGG + Intronic
1189503314 X:41584710-41584732 GTTCCTAACAGGCCACGGATGGG + Intronic
1190027191 X:46935440-46935462 GTTCCTAACAGGCCACAGACTGG - Intronic
1190402182 X:50048320-50048342 GTTCCTAACAGGCCACAGACTGG + Intronic
1192295354 X:69842032-69842054 GTTCCTAACAGGCCACAGATTGG - Intronic
1192407555 X:70901709-70901731 GTTCCTAACAGGCCAGAGACAGG + Intronic
1192496690 X:71620950-71620972 GTTCCTAACAGGCCACAGACCGG + Intergenic
1194282259 X:91967293-91967315 GTTCCTAACAGGCCATGGATAGG - Intronic
1194977256 X:100408350-100408372 GTGACCAGCAGGCCAGAGCTGGG + Exonic
1195768833 X:108327079-108327101 GTTCCTAACAGGCCACAGACAGG - Intronic
1195922379 X:109996399-109996421 GTTCCTAACAGGCCACAGACTGG + Intergenic
1195928430 X:110049593-110049615 GTTCCTAACAGGCCATAGATTGG + Intronic
1197982142 X:132228283-132228305 GTTCCTAACAGGCCACAGACCGG - Intergenic
1198617680 X:138477545-138477567 GTTCCTAACAGGCCACAGACTGG + Intergenic
1199023073 X:142904963-142904985 GTTCCTAACAGGCCAAAGATAGG + Intergenic
1199271120 X:145883602-145883624 GTTGCTACCAGGCCACAGACTGG + Intergenic
1199686794 X:150272270-150272292 TTGGGTAACAGGCCAGATAAGGG + Intergenic
1199840495 X:151642325-151642347 TTGGCTCACAGGCCATAGTTTGG + Intronic
1200368507 X:155694929-155694951 GTTCCTAACAGGCCACAGACTGG + Intergenic
1200599848 Y:5191944-5191966 GTTCCTAACAGGCCATGGATAGG - Intronic
1200802912 Y:7402558-7402580 GTTTCTAACAGGCCAGGGACTGG + Intergenic
1201589816 Y:15602820-15602842 GTTCCTAACAGGCCACAGACTGG - Intergenic
1202136438 Y:21669881-21669903 GTTCCTAACAGGACAGAGATGGG + Intergenic