ID: 1156437599

View in Genome Browser
Species Human (GRCh38)
Location 18:37149620-37149642
Sequence TGTGTACCTGAATATAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1305
Summary {0: 1, 1: 1, 2: 55, 3: 475, 4: 773}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156437599 Original CRISPR TGTGTACCTGAATATAGAAA AGG Intronic
901257400 1:7842066-7842088 TGTGTATCTAAACATAGAAAAGG + Intronic
901559719 1:10060390-10060412 TGTGTATCTAAACATAGAAAAGG + Intronic
901697434 1:11019404-11019426 TGTGTATCTAAACATAGAAAGGG - Intronic
901864955 1:12099844-12099866 TGTGTATCTAAACATAGAAAAGG + Intronic
902313726 1:15601778-15601800 TTTGTATCTAAACATAGAAAGGG - Intergenic
902647732 1:17814182-17814204 GGTGTATCTTAACATAGAAAAGG - Intronic
903076796 1:20775692-20775714 TGTGTATTTAAACATAGAAAAGG - Intronic
903292374 1:22322552-22322574 TGTGTATCTAAATATGGAAAAGG + Intergenic
905549765 1:38827719-38827741 TGCGTATCTAAACATAGAAAAGG - Intergenic
905842410 1:41193621-41193643 TGTGGAATTGAACATAGAAATGG + Intronic
905989653 1:42324718-42324740 TGTGTATCTAAACACAGAAAAGG + Intronic
906831959 1:49042148-49042170 TGTGTACTTGTATATATACAAGG - Intronic
906968197 1:50481410-50481432 TGTATATCTAAATGTAGAAAAGG - Intronic
907222741 1:52919342-52919364 TGTGTATCTGAACATAGAAAAGG - Intronic
907353814 1:53855590-53855612 TGTGTACCTAAACATAGAAAAGG - Intronic
907496404 1:54847903-54847925 TGTATATCTAAACATAGAAAAGG - Intergenic
907560599 1:55384026-55384048 TCTGTATCTAAATACAGAAAAGG + Intergenic
907698572 1:56759503-56759525 TGTGTATCTAAACATAGAAAAGG + Intronic
908428821 1:64035985-64036007 TGTGTATTTGATTATAGAGATGG + Intronic
908604094 1:65775323-65775345 TGTGTATCTAAACATAGAAAAGG + Intergenic
908703068 1:66923101-66923123 TGTGTATGTAAACATAGAAAAGG - Intronic
908790868 1:67779942-67779964 TGTGTATCTAAACATAGAAAAGG + Intronic
908894778 1:68886219-68886241 AGTTTTCCTGAATATAGTAAGGG + Intergenic
908984478 1:70000287-70000309 TGTGTATCTAAACATAGAAAAGG - Intronic
909109119 1:71451825-71451847 TATGTACTTGAATATACAATAGG - Intronic
909423114 1:75488400-75488422 TGTGTATCTAAACATAGAAAAGG + Intronic
909545018 1:76836841-76836863 TGTGTATCTAAACATAGAAAAGG + Intergenic
909687750 1:78369923-78369945 TGTGCATCTAAACATAGAAAAGG + Intronic
909835657 1:80251088-80251110 TGTGTATCTAAACATAGAAAAGG + Intergenic
909864658 1:80652866-80652888 TGTGAACTTGAAAAAAGAAATGG + Intergenic
910133438 1:83937137-83937159 TGTATATCTAAACATAGAAAAGG - Intronic
910858770 1:91722836-91722858 TGTGCATCTAAACATAGAAAAGG + Intronic
910917075 1:92300066-92300088 TGTATATCTAAACATAGAAAAGG + Intronic
910943902 1:92567502-92567524 TGTGTATCTAAACATAGAAGAGG - Intronic
911211115 1:95138846-95138868 TGTGTATCTAAACATAGAAAAGG + Intronic
911565371 1:99457418-99457440 TGTTTTCCTGAATGTAGTAATGG - Intergenic
911627722 1:100145052-100145074 TGTGTATCTAAATACAAAAAAGG - Intronic
911879320 1:103214612-103214634 TTTGTACCTAAACATAGAAAAGG + Intergenic
911986454 1:104631187-104631209 TGTGTTCCTTAATATAGACCTGG - Intergenic
912327175 1:108777721-108777743 GGTGTCCCTGAATAAAGGAAAGG - Intronic
912647244 1:111405043-111405065 TGTGTATCTAAACATAGAAAAGG + Intergenic
912705988 1:111913136-111913158 TGTGTATCTAAACATAGAAAAGG - Intronic
912739055 1:112176551-112176573 TGTGTATCTAAACATAGAAAAGG - Intergenic
912740923 1:112196698-112196720 TGTGCATCTAAACATAGAAAAGG - Intergenic
912848509 1:113100364-113100386 TATGTAACTTGATATAGAAATGG + Intronic
913097214 1:115529957-115529979 TGTGTATCTAAACATAGAAAAGG + Intergenic
915029403 1:152864087-152864109 TTTGTATCTAAACATAGAAAAGG - Intergenic
915286325 1:154855495-154855517 TATGTATCTAAACATAGAAAAGG - Intronic
915369865 1:155339846-155339868 TGTGTATCTAAACATAGAAAAGG + Intronic
915437382 1:155918661-155918683 TGTGTATCTAAATGTAGAAAAGG + Intronic
915453939 1:156026599-156026621 TGTGTATCTAAACATAGAAAAGG - Intergenic
916284494 1:163090616-163090638 TGTGTATCTAAACATAGAAAAGG + Intergenic
916705779 1:167348243-167348265 TGTGTATCTAAACATAGAAAAGG + Intronic
917052733 1:170941887-170941909 TGTATAGCTTAATGTAGAAAAGG - Intronic
917369426 1:174274386-174274408 TGTGTACCTAAACACAGAAAAGG - Intronic
917898339 1:179515909-179515931 TGTGTATCTTAACATAGAAAAGG - Intronic
917907253 1:179598175-179598197 TGTGTATCTAAACATAGAAAAGG + Intronic
917954639 1:180081739-180081761 TGTATATCTAAACATAGAAAAGG + Intronic
917998692 1:180469084-180469106 TGTGTATCTGTTTATGGAAAAGG - Intronic
918029737 1:180794277-180794299 TATGTATCTAAATATAGAAAAGG + Intronic
918259231 1:182779841-182779863 TGTTTATCTAAACATAGAAAAGG + Intergenic
918657233 1:187043301-187043323 TGAGAGCCTGAATATATAAATGG + Intergenic
918720733 1:187849591-187849613 TATATACCTGTATATAGATATGG - Intergenic
918819230 1:189229566-189229588 TGTGTATCAAAACATAGAAAAGG - Intergenic
919014217 1:192009368-192009390 TGTGTATCTAAACATAGAAAAGG + Intergenic
919036425 1:192315519-192315541 TGTATATCTAAACATAGAAAAGG + Intergenic
919202538 1:194374611-194374633 TGTGTATCTAAATACAGAAAAGG - Intergenic
919390571 1:196979507-196979529 TGTTTACCTAAACATATAAAAGG + Intronic
919904188 1:202066597-202066619 TGTGTAAAAGAATAAAGAAATGG - Intergenic
919966884 1:202536374-202536396 TGTGTGTCTAAACATAGAAAAGG + Intronic
920037244 1:203074363-203074385 TGTATATCTAAACATAGAAAAGG + Intronic
920502647 1:206495109-206495131 TGTGTACATGTATATAAACAGGG - Intronic
920568685 1:206999203-206999225 TGTATATCTAAACATAGAAAAGG + Intergenic
920680331 1:208067604-208067626 TGTGTATCTAAACATAAAAATGG - Intronic
921028684 1:211316704-211316726 TGTGTATCTAAACATAGAAAAGG + Intergenic
921084090 1:211771142-211771164 TGTGTATCTAAACATAGAAAAGG - Intronic
921108897 1:212013712-212013734 TGTATATCTAAACATAGAAAAGG - Intronic
921111275 1:212039777-212039799 TGTGTATTTAAACATAGAAAAGG + Intronic
921479420 1:215646858-215646880 TGTGTATCTAAACATAGAAAAGG - Intronic
921500440 1:215895963-215895985 TGTGTATCTCAACACAGAAAAGG + Intronic
921674095 1:217958392-217958414 TGTGTATCTAAACATAGAAAAGG - Intergenic
921773325 1:219069354-219069376 TGTGTATCTAAACATAGAAAGGG + Intergenic
922058269 1:222062971-222062993 TGAGTCCCTGCATATGGAAATGG - Intergenic
922282743 1:224141705-224141727 TGTATATCTAAACATAGAAAAGG + Intronic
922555368 1:226528369-226528391 TTTGTACTTAAACATAGAAAAGG + Intergenic
922617464 1:226970467-226970489 TGTGTACCTAAACATAGAAAAGG + Intronic
922671972 1:227516699-227516721 TGTGTATATAAACATAGAAAAGG + Intergenic
923032124 1:230257443-230257465 TGTGTATCTAAACAAAGAAAAGG - Intronic
923286014 1:232496212-232496234 TTTGTATCTAAACATAGAAAAGG - Intronic
923389214 1:233497392-233497414 TGTGTATCTAAACATAGAAAAGG + Intergenic
923827211 1:237513637-237513659 TGGGTATCTAAATATAGAAAAGG - Intronic
923856938 1:237855299-237855321 TGTATATCTAAACATAGAAAAGG + Intergenic
923925640 1:238624102-238624124 TGTCTATCTAAACATAGAAAAGG - Intergenic
923941881 1:238836626-238836648 TGTGTATCTAAACATAGAAAAGG - Intergenic
923992680 1:239456357-239456379 TGTGTATCTAAACATAGAAAAGG - Intronic
924167034 1:241294730-241294752 TGTGTATCCAAACATAGAAAAGG - Intronic
924208771 1:241743349-241743371 CGTGTCCCTGATTATAGACAGGG - Intronic
924417082 1:243867559-243867581 TGTGTATCTAAACATAGAAAAGG - Intergenic
924663122 1:246041047-246041069 TGTGTATCTAAACATAGAAAAGG - Intronic
924821935 1:247501325-247501347 TGTGTATATAAACATAGAAAAGG + Intergenic
924857169 1:247885087-247885109 TGTGTATCTAAATATAGAAAAGG + Intergenic
1062790684 10:302740-302762 TGTGTATCTAAACATAGAAAAGG + Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062889330 10:1046341-1046363 TGTGTATCTAAACATAGAAAAGG - Intronic
1063341464 10:5268460-5268482 TGTGTACATAAACATATAAAAGG + Intergenic
1063982578 10:11466854-11466876 TGTGAATCTAAAGATAGAAATGG + Intronic
1064032550 10:11892182-11892204 TGTGTATCTAGACATAGAAAAGG - Intergenic
1064361825 10:14672530-14672552 TGTGTTTCTAAACATAGAAAAGG + Intronic
1064368766 10:14731716-14731738 TGTGTATCTAAACATAGAAAAGG - Intronic
1064424966 10:15222468-15222490 TGTGTATCTAAACATAGAAAAGG + Intronic
1064929142 10:20604511-20604533 TGTGTATCTAAACATAGAAAAGG + Intergenic
1065063927 10:21939538-21939560 TATGTATCTAAACATAGAAATGG - Intronic
1065377921 10:25061484-25061506 TTTTTTCCTGAAAATAGAAATGG - Intronic
1066077898 10:31898656-31898678 TGTGTATCTAAACATAGAAAAGG - Intronic
1066347311 10:34600522-34600544 TCTGTACATGAATATTGAAAGGG + Intronic
1066410131 10:35160225-35160247 TGTGTATCTAAACATAGGAAAGG + Intronic
1066433735 10:35377361-35377383 TGTGTATCTAAATATAGAAAAGG - Intronic
1066583442 10:36905925-36905947 TGTGAATCTAAACATAGAAAAGG - Intergenic
1066618557 10:37321038-37321060 TGTTTACCGGAACATAGAAATGG + Intronic
1066678039 10:37909254-37909276 TGTGTAACTAAACATAGAAAAGG + Intergenic
1066757861 10:38728988-38729010 TGTGTACCTGAACATAGAGAAGG - Intergenic
1067024635 10:42833582-42833604 TGTGTATCGAAACATAGAAAAGG + Exonic
1067124424 10:43503940-43503962 TGTGTGTCTAAACATAGAAAAGG - Intergenic
1067213971 10:44285099-44285121 TGTGTATCTAAACATAGAAAAGG - Intergenic
1067913347 10:50369998-50370020 TGTGTATCTAAATGCAGAAAAGG + Intronic
1068686641 10:59877044-59877066 TATGTATCTAAACATAGAAAAGG + Intronic
1068784492 10:60956219-60956241 TGTGTATCTAAACACAGAAAAGG + Intronic
1069008415 10:63344250-63344272 TGTGTATCTAAACATAGAAAAGG - Intronic
1069144725 10:64876593-64876615 TGAGCAACTGAATATACAAATGG + Intergenic
1069185359 10:65415608-65415630 TGTGTACCTAAACATAGAAAAGG + Intergenic
1069389956 10:67924507-67924529 TGTGTATCTAAACATAGAAAAGG + Intronic
1069404262 10:68081428-68081450 TGTGTATCTAAACATAGAAAAGG + Intergenic
1069418684 10:68226150-68226172 TGTGTTTCTAAACATAGAAAAGG - Intergenic
1069998524 10:72358535-72358557 TGTGTATCTAAACATAGAAAAGG + Intergenic
1070091213 10:73287320-73287342 TGTGTATCTAAACATAGAAAAGG + Intronic
1070182000 10:74023230-74023252 GGTGTATCTAAACATAGAAAAGG - Intronic
1070670431 10:78373841-78373863 TGTGAAGCTGTATAGAGAAAAGG + Intergenic
1070701752 10:78607386-78607408 TATGTATCTAAATATAGAAAAGG - Intergenic
1070868564 10:79726634-79726656 TGTGTACCTAAATGTAGAAAAGG - Intergenic
1071003170 10:80854254-80854276 TGTGTATCTAAACATAGAAAAGG - Intergenic
1071091603 10:81925305-81925327 TGTGCAACAGAATATAGAATTGG + Intronic
1071350509 10:84737205-84737227 TGTGTATCTAAACATAGAAAAGG + Intergenic
1071541085 10:86484732-86484754 TGTGTATCTAAACCTAGAAAAGG - Intronic
1071635478 10:87248848-87248870 TGTGTACCTAAATGTAGAAAAGG - Intergenic
1071659762 10:87489126-87489148 TGTGTACCTAAATGTAGAAAAGG + Intergenic
1071742601 10:88377584-88377606 TGTGTATCTACACATAGAAAAGG + Intronic
1071839387 10:89453498-89453520 TGTGTATATAAACATAGAAAAGG - Intronic
1071926853 10:90419179-90419201 TGTGTATCTAAACATGGAAAAGG - Intergenic
1071950261 10:90696183-90696205 TGTGTATCTAAACAAAGAAAAGG + Intergenic
1072210475 10:93241874-93241896 TGGGTTACAGAATATAGAAACGG - Intergenic
1072557824 10:96537271-96537293 TGTGTATGTAAACATAGAAAAGG - Intronic
1072579499 10:96727651-96727673 TGTCTACCAGAAAATAGAGAAGG - Intergenic
1072598792 10:96903071-96903093 TGTGTATCTAAACATAGAAAAGG + Intronic
1072752214 10:97989537-97989559 TGTGTATCTAAATATAGAAAAGG + Intronic
1072998239 10:100265837-100265859 TTTGTATTTAAATATAGAAAGGG - Intronic
1073031295 10:100528151-100528173 TGTGTATCTAAACATAGAAAAGG - Intronic
1073159691 10:101380977-101380999 TGTATATCTAAACATAGAAAGGG + Intronic
1073658408 10:105444187-105444209 TGTGTCAATGAATACAGAAAAGG - Intergenic
1073846624 10:107563325-107563347 ATTGTACATGAATATATAAAAGG + Intergenic
1074167230 10:110892933-110892955 TGTGTATCTAAACATAGAAAAGG - Intronic
1074652385 10:115538899-115538921 TGTGTATCTAAACATAGAAAAGG - Intronic
1074666016 10:115725625-115725647 TTTGTACATGAGTATAGGAAGGG + Intronic
1074730319 10:116365804-116365826 TGTGTATCTAAACATAGAAAAGG - Intronic
1074736399 10:116438624-116438646 TCTGTACCTGAATTTTGTAATGG + Intronic
1074993741 10:118736839-118736861 TGTGTATTTAAACATAGAAAAGG - Intronic
1075296675 10:121282874-121282896 TGTGTATCTAAACATAGAGAAGG - Intergenic
1075498182 10:122946351-122946373 TGTGTATCTAAACATAGAAGAGG - Intronic
1076182038 10:128417278-128417300 TGTGTATCTAAACCTAGAAAAGG - Intergenic
1076304305 10:129453340-129453362 TGTGTATCTAAACATGGAAAAGG - Intergenic
1076941572 10:133613580-133613602 TGTGGATCAGAATATAGATAAGG + Intergenic
1077371513 11:2184172-2184194 TGTGTATGTGTATACAGAAAGGG - Intergenic
1077871595 11:6266972-6266994 TGTGTATCTAAACATAGAAAAGG + Intronic
1078124403 11:8546037-8546059 TGTGTATCTAAACATAGAAAAGG + Intronic
1078933577 11:15932508-15932530 TGTGTATATAAATGTAGAAAAGG - Intergenic
1079053563 11:17185179-17185201 TGCGTATCTAAACATAGAAAAGG - Intronic
1079065705 11:17289480-17289502 CGTGTATCTGAATAAAGAATAGG - Intronic
1079118878 11:17662831-17662853 TATGTATCTAAACATAGAAAAGG + Intergenic
1079320153 11:19445205-19445227 TGTGGTCCTGAAGATAGACAGGG + Intronic
1079352840 11:19706989-19707011 TGTGTATCTAAACGTAGAAAAGG + Intronic
1079559257 11:21802487-21802509 TGTCTATCTAAACATAGAAAAGG - Intergenic
1079837556 11:25352325-25352347 TGTATATCTAAACATAGAAAAGG + Intergenic
1079954377 11:26844283-26844305 AGTCTACCTGAGTATGGAAAAGG + Intergenic
1080172145 11:29317713-29317735 TGTGTTCCTAAACATAGAAAAGG + Intergenic
1080364780 11:31560848-31560870 TGGGTATCTAAATATAGCAAAGG - Intronic
1080428924 11:32180817-32180839 TGTGTATCTAAACATAGAAGAGG - Intergenic
1080468015 11:32516526-32516548 TGTGTAATTGAATAAACAAATGG + Intergenic
1080516332 11:33024671-33024693 TGTGTATCTAAACATAGAAAAGG + Intronic
1080593837 11:33749842-33749864 TGTGTATTTGGATATAGCAAAGG + Intronic
1080650573 11:34219624-34219646 TCTGTATCTAAATATAGAAAAGG - Intronic
1080686519 11:34520111-34520133 TGGGGACCTCAATATTGAAAAGG + Intergenic
1080724848 11:34886709-34886731 TGTGTATCTAAACATAGAAAAGG - Intronic
1080730160 11:34942258-34942280 TGTCTACCTGAATCAAGATACGG - Intronic
1080880746 11:36318051-36318073 TGTGTATGTAAACATAGAAAAGG - Intronic
1081060986 11:38477130-38477152 TGTGTATCTACATATAGAAAAGG + Intergenic
1081471530 11:43376969-43376991 TGTGTATCTAAACATAGAAAAGG + Intronic
1081610426 11:44559534-44559556 TGTGTTCAGGAATAGAGAAATGG + Intergenic
1081688764 11:45060981-45061003 TGTGTGTCTAAATATGGAAAAGG + Intergenic
1082804944 11:57442191-57442213 TGTGTAGCTAATCATAGAAAAGG + Intergenic
1083073399 11:60011019-60011041 TATGTATTTAAATATAGAAAAGG - Intergenic
1083974986 11:66111195-66111217 TGTGGATCTAAACATAGAAAAGG + Intronic
1084135479 11:67176745-67176767 TGTGTATCTAAACATAGAAAAGG + Intronic
1084976690 11:72804063-72804085 TGTGTATCTTAACATAGAAAAGG + Intergenic
1085061515 11:73451617-73451639 TGTGTATCTAAACATAGAAAAGG - Intronic
1085551248 11:77374828-77374850 TGTATATCTAAACATAGAAAAGG + Intronic
1086004416 11:82020554-82020576 TGTGTATCCAAACATAGAAAAGG + Intergenic
1086251605 11:84821809-84821831 TGTCTTACTGAATATAGATAGGG + Intronic
1086305468 11:85476202-85476224 TGTGTATCTAAACATAGAAAAGG + Intronic
1087003553 11:93445563-93445585 TGTGTATCTAAATATAGAAAAGG + Intergenic
1087010827 11:93512556-93512578 TGTGTATCTAAACATATAAAAGG - Intronic
1087258526 11:95984101-95984123 TGTGTATCTAAACATAGAAAAGG - Intronic
1087808548 11:102583431-102583453 TGTGTATCTAAACTTAGAAATGG - Intronic
1088269679 11:108020991-108021013 TGTGTATCTAAACATAGAAAAGG - Intronic
1088462679 11:110098641-110098663 TGTGTATCTAAGCATAGAAAAGG - Intronic
1088744015 11:112789589-112789611 TATGTATCTAAACATAGAAACGG + Intergenic
1089008079 11:115109335-115109357 TGTGTATCTAAACATAGACAAGG + Intergenic
1089123401 11:116158895-116158917 TGTGTACCTAAACATAGAAAAGG - Intergenic
1089995296 11:122901174-122901196 TGTGCATCTAAACATAGAAAAGG + Intronic
1090444451 11:126751710-126751732 TGTCTATCTGAATATGGGAAGGG + Intronic
1090603613 11:128398098-128398120 TGTGTATCTAAACAGAGAAAAGG - Intergenic
1090652326 11:128818059-128818081 TGTGTATCTAAACATGGAAAAGG + Intergenic
1090785145 11:130042007-130042029 TGTGTATCTAAACATAGAAAAGG - Intergenic
1091144226 11:133263347-133263369 TGTGTATCTAAACATAGGAAAGG - Intronic
1091269380 11:134295153-134295175 TCTGTTCCAGAAAATAGAAAAGG - Intronic
1091984295 12:4895614-4895636 AGTTTACCTGAAGATAAAAAGGG + Intergenic
1092804356 12:12205984-12206006 TGTGTATCTAAACATAGAAAAGG - Intronic
1093218248 12:16387848-16387870 TGTGTATCTAAACATAGAAAAGG - Intronic
1093218273 12:16388233-16388255 TGTGTACCTAAACATAGAAAAGG + Intronic
1093283374 12:17225193-17225215 TGTATACCTAAACAGAGAAAAGG + Intergenic
1093453716 12:19343690-19343712 TGTATATCTAAACATAGAAAAGG + Intronic
1093547326 12:20364464-20364486 TGTGTATCTAAACATAGAAAGGG - Intergenic
1093562503 12:20559160-20559182 TGTGTATCTAAACATAGAAAAGG - Intronic
1093598297 12:20989015-20989037 TTTGTATCTAAACATAGAAAAGG + Intergenic
1093819016 12:23588870-23588892 TGTGTATCTAAACATAGAAAAGG - Intronic
1094363485 12:29655189-29655211 TCTGAACATGTATATAGAAATGG - Intronic
1094481205 12:30883475-30883497 TGTGTATCTAAACACAGAAAAGG - Intergenic
1094533507 12:31299948-31299970 TGTGCATCTAAATATAGAAAAGG + Intronic
1095088301 12:38082326-38082348 TGAGTACGTGAATATAGGATTGG + Intergenic
1095224027 12:39657201-39657223 TGTGTATCTAAACATAGAAAAGG - Intronic
1095381732 12:41602800-41602822 TTTGTATCTAAACATAGAAAAGG + Intergenic
1095762809 12:45859222-45859244 TGTGTATCAAAACATAGAAAAGG - Intronic
1096246170 12:49988398-49988420 TATGTATCTAAACATAGAAAGGG - Intronic
1097462394 12:59878183-59878205 TGTGCATCTAAACATAGAAAAGG + Intergenic
1097790531 12:63810846-63810868 TGTGTAGTTAAACATAGAAAAGG - Intergenic
1098017220 12:66118530-66118552 TGTGTATCTAAACATAGAAAAGG - Exonic
1098102615 12:67034499-67034521 TGTGTATCTAAACATAGAAAAGG + Intergenic
1098177884 12:67812061-67812083 TGTGTATCTAAATATAGAAAGGG + Intergenic
1098244224 12:68499819-68499841 TGTGTGCCAGAATGTGGAAAAGG + Intergenic
1098427599 12:70383035-70383057 TGTGTATTTAAACATAGAAAAGG + Intronic
1098512334 12:71331436-71331458 TGTTTACCTGAATAAAGCAGGGG + Intronic
1098522288 12:71446698-71446720 TGTGTTCCTGAAAAGAAAAATGG - Intronic
1098745960 12:74236902-74236924 TGTGTATCTAAACATAGAAAAGG - Intergenic
1098855437 12:75647684-75647706 AGGGTGCCTGAATATAGCAAGGG - Intergenic
1098871694 12:75823922-75823944 TGTGTCCCTGAAAACCGAAAAGG + Intergenic
1098913767 12:76236610-76236632 TGTGTATCTAAACACAGAAAAGG + Intergenic
1099057875 12:77868188-77868210 TATGTTCCTGTATATAAAAATGG + Intronic
1099121735 12:78698097-78698119 TGTGTATCTAAACATAGAAGAGG + Intergenic
1099170429 12:79357550-79357572 TGTGTATCTAAACATAGAGAAGG + Intronic
1099172648 12:79383308-79383330 TGTGTATCTAAAGATAGAAAAGG + Intronic
1099302792 12:80918901-80918923 TGTGTATCTGAATATAGAAAAGG - Intronic
1099639359 12:85265862-85265884 TGTGTAAAATAATATAGAAAGGG + Intergenic
1100170021 12:91964066-91964088 TGTATATCTAAAAATAGAAAAGG - Intergenic
1100470969 12:94892569-94892591 AGTGTATCTAAACATAGAAAAGG - Intergenic
1100625927 12:96332068-96332090 AGTGTATCTAAACATAGAAAAGG - Intronic
1100705127 12:97192607-97192629 TGTGTATCCAAACATAGAAAAGG - Intergenic
1101076613 12:101136068-101136090 TGTGTACCTAAACACAGAAAAGG + Intergenic
1101164288 12:102011966-102011988 TGTGTATCTAAATGTAGAAAAGG - Intronic
1101227964 12:102708787-102708809 TGTGTACCTGGAGGTAGAACAGG + Intergenic
1101272215 12:103159685-103159707 TGTGAACCTGAGTATTGAAGGGG - Intronic
1101498543 12:105279262-105279284 TGTGTATCTAAACATAGAAAAGG - Intronic
1101938528 12:109080761-109080783 TGTGTATCTAAAAACAGAAAAGG - Intronic
1102801145 12:115735302-115735324 TGTATATCTAAACATAGAAAAGG + Intergenic
1103064557 12:117886438-117886460 TGTGTACCTAAACATAGCAAAGG - Intronic
1103471152 12:121182562-121182584 TGTATATCTAAATATAGAAAAGG + Intronic
1103806256 12:123575547-123575569 TGTGTATCTAAACATAGAAAAGG - Intergenic
1103835393 12:123815902-123815924 TGTGTATCTAAACATAGAAAAGG + Intronic
1103837179 12:123831579-123831601 TGTGTATCTAAACATAGAAAAGG + Intronic
1104115290 12:125744029-125744051 TGTGTATCTAAACATAGAAAAGG - Intergenic
1104167011 12:126241928-126241950 TGTGTAGCTAAACATAGAAAAGG - Intergenic
1105471528 13:20699606-20699628 TGTGTATCTAAATATAGAAAAGG - Intergenic
1105484098 13:20809591-20809613 TGGGTAACTGAAAATTGAAAAGG + Intronic
1105525348 13:21172840-21172862 TGTGTATCTAAACATAAAAAAGG - Intronic
1105776350 13:23664875-23664897 TGTGGATCTAAACATAGAAAAGG + Intronic
1106529805 13:30579350-30579372 TGTGTACCTGTATATTGGACTGG + Intronic
1106635700 13:31526254-31526276 TATTTACCTTAAGATAGAAAAGG - Intergenic
1106711693 13:32342709-32342731 TGTGTATGTGAACATAGAAAAGG + Intronic
1106747867 13:32722413-32722435 TGTATATCTAAACATAGAAAAGG - Intronic
1107068015 13:36237809-36237831 TGTGTATCTAAACATAGAAAAGG - Intronic
1107300741 13:38963355-38963377 TGTGTATCTAAACATAGAAAAGG + Intergenic
1107302899 13:38984520-38984542 TGTATATCTAAACATAGAAAAGG - Intronic
1107371961 13:39761298-39761320 TTTGTTGCTGTATATAGAAATGG + Intronic
1107636130 13:42394436-42394458 TGTGTGCCTAAATACAGGAAGGG + Intergenic
1107667710 13:42709308-42709330 TGTGTAACTCAACGTAGAAAAGG + Intergenic
1108104590 13:46995285-46995307 GGTGTATCTAAACATAGAAAAGG + Intergenic
1108319854 13:49278993-49279015 TGCGTATCTGAACATAAAAAAGG - Intronic
1108356044 13:49629548-49629570 CGTGTATCTAAACATAGAAAAGG - Intronic
1108361865 13:49675281-49675303 TGTGCACCTAAACACAGAAAAGG + Intronic
1109454967 13:62573799-62573821 TGTGTATCTAAACATAGAAAAGG + Intergenic
1109488729 13:63065232-63065254 TGTGTACCTGAAGATACATAAGG + Intergenic
1109987937 13:70015341-70015363 TGTGTATCTAAACATAAAAATGG + Intronic
1109990142 13:70043617-70043639 TGTGTATCTAAGCATAGAAAAGG - Intronic
1110093370 13:71483779-71483801 TGTGTGTCTAAACATAGAAAAGG - Intronic
1111145815 13:84177815-84177837 TTTTTAGCTGAATATAGAAAAGG - Intergenic
1111255043 13:85656555-85656577 TATGTACCTGCTTCTAGAAATGG + Intergenic
1111410800 13:87874057-87874079 TGTGTATCTAAGCATAGAAATGG - Intergenic
1111708284 13:91778980-91779002 TGTGTATCTAGACATAGAAAAGG + Intronic
1111782562 13:92747033-92747055 TGTGTATCTAAACATGGAAAAGG + Intronic
1111863520 13:93739308-93739330 TGTGCCCTTGAATATATAAAAGG + Intronic
1111880148 13:93945734-93945756 TGTGGGACTGAATATACAAATGG - Intronic
1112414439 13:99192568-99192590 TGTGTATCTAAACACAGAAAAGG - Intergenic
1112616771 13:101014556-101014578 TGTTTATCTAAACATAGAAAAGG - Intergenic
1113228593 13:108186641-108186663 TGTGTATCTAAACATAGAAAGGG + Intergenic
1113236832 13:108285552-108285574 TGTGTATCTAAACATAGAAAAGG + Intronic
1113390441 13:109891411-109891433 TGTGTATCTAACCATAGAAAAGG + Intergenic
1113390818 13:109894669-109894691 TGTGTATCTAACCATAGAAAAGG + Intergenic
1113444915 13:110357789-110357811 TGTATATCTAAATACAGAAAAGG + Intronic
1114135289 14:19841675-19841697 TGTTTACCAGAACAAAGAAAAGG - Intergenic
1114286088 14:21245155-21245177 TGTGTACTTCAAAAAAGAAAAGG + Intronic
1114381777 14:22213172-22213194 TGTGTATCTAAACATAGACAAGG - Intergenic
1114815680 14:25955125-25955147 TTTGTTCCTGAATACAGCAAGGG - Intergenic
1114847070 14:26335470-26335492 TGTGTATCAGAACATAGAAAAGG - Intergenic
1115116583 14:29887704-29887726 TGTGTATCTAAGTATATAAAAGG - Intronic
1115179566 14:30607474-30607496 TGTATATCTAAATATACAAAAGG + Intronic
1115210484 14:30962853-30962875 TGTGTATCTAAACATAGAAAAGG - Intronic
1115227091 14:31114940-31114962 TGTGTATCTAAACATAAAAAAGG + Intronic
1115378064 14:32700589-32700611 TGTGTACATAAATATAGAAAAGG - Intronic
1115404929 14:33004404-33004426 TGTGTATCTAAACATAGAAAAGG + Intronic
1115458537 14:33633601-33633623 TGTGTATCTAAACATAGAAAAGG + Intronic
1115603191 14:34975310-34975332 TGTGTATCTAAACATAGAAAAGG - Intergenic
1115830994 14:37340942-37340964 TGTGCATCTAAACATAGAAAAGG - Intronic
1116020697 14:39456703-39456725 TGTATAACTAAACATAGAAAAGG - Intergenic
1116048224 14:39770706-39770728 TGTGTAGCTAAACATAGAAAAGG + Intergenic
1116318723 14:43432326-43432348 TATGTATCTAAACATAGAAATGG + Intergenic
1116748784 14:48854824-48854846 AGTGTTCTAGAATATAGAAAAGG - Intergenic
1117110218 14:52445684-52445706 TGTGAATCTAAACATAGAAAAGG - Intronic
1117154337 14:52923070-52923092 TGTGTAGCTAAGCATAGAAAAGG + Intronic
1117672223 14:58120197-58120219 TGTGTATCTAAACATAGAAAAGG + Intronic
1117732582 14:58738487-58738509 TATGTATCTAAATATAGAAAAGG - Intergenic
1117795602 14:59389973-59389995 TGTGTATCTAAACATAGAAAAGG + Intergenic
1117835101 14:59796138-59796160 TGTGTATCTAAGTATAGAAATGG - Intronic
1117907705 14:60607801-60607823 TGTTTATCTAAACATAGAAAAGG - Intergenic
1117998487 14:61500660-61500682 TGTGCACATGAAAATAGAGAAGG + Intronic
1118098735 14:62570455-62570477 TGTCTATCTAAACATAGAAAAGG + Intergenic
1118413884 14:65512122-65512144 TGTGTACCTAAACGTAGAAAAGG + Intronic
1119403484 14:74380203-74380225 TGTGTATCTAAACATAGAAAAGG - Intergenic
1120267735 14:82272787-82272809 TGTGTATCTAAACATAGAAAAGG - Intergenic
1120611990 14:86653285-86653307 TGTCTACCTGAGTAAAGAAAAGG + Intergenic
1120783413 14:88507530-88507552 TGTGTATCTAAACACAGAAAAGG + Intronic
1121750710 14:96353046-96353068 TGTGTATCTAAACATAGAAAAGG - Intronic
1121927328 14:97939845-97939867 TGTTAACATGAATATAAAAAGGG - Intronic
1122132932 14:99616137-99616159 TGTGTGTCTAAACATAGAAAAGG - Intergenic
1122147584 14:99701405-99701427 TGTATATCTAAACATAGAAAAGG - Intronic
1122303590 14:100747008-100747030 TGTGTATCTAAACATAGAAAAGG - Intergenic
1122378025 14:101280179-101280201 TGTGTATCTAAACAGAGAAAAGG + Intergenic
1123441256 15:20293678-20293700 TGTGTACCTGAACATAGAGAAGG - Intergenic
1123631575 15:22264085-22264107 TGTGTATCTGAACACAGAATAGG + Intergenic
1124665696 15:31590165-31590187 TGTATATCTAAACATAGAAAAGG - Intronic
1124716043 15:32063020-32063042 TGTGTATCTAAACATAGAAAAGG + Intronic
1124965671 15:34431591-34431613 TGTGTATCTAAACATAGAAAAGG + Intronic
1124982301 15:34577737-34577759 TGTGTATCTAAACATAGAAAAGG + Intronic
1125439569 15:39687495-39687517 TGTTTACCTTAGAATAGAAATGG - Intronic
1125586420 15:40823590-40823612 TATATATCTGAACATAGAAAAGG - Intronic
1126196830 15:45940735-45940757 TGTGTATCTAAACATAGAAAAGG + Intergenic
1126453061 15:48831464-48831486 TGTGTATGTAAACATAGAAAAGG - Intronic
1126494394 15:49274353-49274375 TGTGTAGCTAAACATAAAAAAGG + Intronic
1126529491 15:49697430-49697452 TGTGTATCTAAACATAGAAAAGG - Intergenic
1126701980 15:51376316-51376338 TGTGTATCTAAACATAGGAAAGG + Intronic
1127063422 15:55212161-55212183 TGTGTACCTGAATACAGTAGTGG - Intronic
1127141050 15:55977250-55977272 TGTGTACCAAAACATAGAAAAGG - Intronic
1127223074 15:56900705-56900727 TGTGTATCTAAACATAGAAAAGG + Intronic
1127235608 15:57047979-57048001 TGTGTATCTAAACATAGAAAAGG + Intronic
1128297324 15:66534635-66534657 TGTGTATCTAAACATAGAAGGGG + Intronic
1128493091 15:68170395-68170417 TGTGTACCTAAACATAGAAAAGG + Intronic
1128494521 15:68186732-68186754 TGTATATCTCAACATAGAAAAGG - Intronic
1128808213 15:70550290-70550312 TGTGTATCTAAACATAGAAAAGG + Intergenic
1129043635 15:72712615-72712637 AGTGTATCTAAACATAGAAAAGG + Intronic
1129067259 15:72915859-72915881 TGTGTGTCTAAACATAGAAAAGG - Intergenic
1129547074 15:76407304-76407326 TGTGTATCTAACCATAGAAAGGG + Intronic
1129620358 15:77138202-77138224 TGTGTATCTAAATGTAGAAAAGG + Intronic
1129781998 15:78278550-78278572 TGAGTATCTGAACATAGGAAAGG + Intronic
1129983750 15:79897601-79897623 TGTGTATCTAAACACAGAAAAGG + Intronic
1130004870 15:80085880-80085902 TGTGTATCTAAACATAAAAAAGG - Intronic
1130055599 15:80522634-80522656 TGTATATCTAAACATAGAAAAGG + Intronic
1130921482 15:88348930-88348952 TGTGTACCTAAACATAGAAAAGG + Intergenic
1131274249 15:90967563-90967585 TGTGTATCTAAACATAGAAAAGG - Intronic
1131392405 15:92060038-92060060 TGTGTATCTAAACATAGAAAAGG + Intronic
1131891503 15:96976880-96976902 TTTCTACATGAATATAGAATGGG + Intergenic
1132226651 15:100147537-100147559 TGTGTATCTAAACATCGAAAAGG + Intronic
1132280989 15:100615006-100615028 TGTGTACCTAACCATAGAAAAGG - Intronic
1132487514 16:202484-202506 TGTGTACGTAAACATAGAAAAGG - Intronic
1133151213 16:3832641-3832663 TGTGTATCTAAACATAGAAAAGG + Intronic
1134146406 16:11767143-11767165 TGTGTATCTAAACATAGGAAAGG - Intronic
1134385897 16:13772094-13772116 TTTGTATCTAAACATAGAAAAGG - Intergenic
1134470808 16:14524011-14524033 TGTTTACCTAAACACAGAAAAGG + Intronic
1135569683 16:23539147-23539169 TTTGTACTTTAATATAGATAGGG + Intronic
1136017964 16:27417736-27417758 TGTGTATCTAAACATAGAAAAGG + Intronic
1136122683 16:28149533-28149555 TTTGTATCTAAACATAGAAAAGG - Intronic
1136535854 16:30898958-30898980 TGTGTATCTAAACATAGAAAAGG - Intronic
1136725007 16:32350236-32350258 TGTGTACCTGAACATAGAGAAGG + Intergenic
1136843336 16:33556289-33556311 TGTGTACCTGAACATAGAGAAGG + Intergenic
1136859038 16:33684818-33684840 TGTGTATCGAAATATAGAAAAGG - Intergenic
1137345857 16:47658584-47658606 TGTGTATCTAAAGATAGAAAAGG - Intronic
1138047173 16:53737510-53737532 TGTGTATCTAAACATATAAAAGG + Intronic
1138406215 16:56796273-56796295 TGTGTATCTAATTATAGACAAGG - Intronic
1138611069 16:58124603-58124625 TGTGTGTCTAAACATAGAAAAGG + Intronic
1138849008 16:60604477-60604499 TGTGTACCTAAACATTAAAAAGG + Intergenic
1139002318 16:62527611-62527633 TGTGTATCTAAACATAGAAAAGG + Intergenic
1139790880 16:69433968-69433990 TGTGCATCTAAACATAGAAAAGG + Intronic
1140320234 16:73943576-73943598 TGTTTATCTAAACATAGAAAAGG + Intergenic
1140397288 16:74638995-74639017 TATGTATCTAAACATAGAAAAGG + Intronic
1140443612 16:75006041-75006063 TGTGTGTCTAAACATAGAAAAGG + Intronic
1140763065 16:78129439-78129461 TGTGTATCTAAACATAGAAATGG + Intronic
1140777567 16:78264084-78264106 AGTGTATCTGAATATTGTAACGG + Intronic
1140803059 16:78506538-78506560 TGTGTCCCTGCATCCAGAAAAGG - Intronic
1141257913 16:82420428-82420450 TGTGTATCTAAACACAGAAAAGG - Intergenic
1142384692 16:89756042-89756064 TGTGTATCTAAACATAGAAAAGG + Intronic
1203001423 16_KI270728v1_random:167518-167540 TGTGTACCTGAACATAGAGAAGG - Intergenic
1203120551 16_KI270728v1_random:1532997-1533019 TGTGTATCGAAACATAGAAAAGG - Intergenic
1203133026 16_KI270728v1_random:1703922-1703944 TGTGTACCTGAACATAGAGAAGG - Intergenic
1203153501 16_KI270728v1_random:1856587-1856609 TGTGTACCTGAACATAGAGAAGG + Intergenic
1142478397 17:203405-203427 TGTGTAGCTAATCATAGAAAGGG - Intergenic
1142501104 17:333758-333780 TGTGAACCTGACTATGGAAAAGG - Exonic
1144117685 17:12115474-12115496 TGTGTGTCTAAATATAGAAAAGG + Intronic
1144157768 17:12523618-12523640 TGTGTATCTAAACATAGAAAAGG + Intergenic
1144241454 17:13316683-13316705 TGTGTGTCTAAACATAGAAAAGG - Intergenic
1144251507 17:13421250-13421272 TGTGTATCTAAACATAGAAAAGG + Intergenic
1144417672 17:15067233-15067255 TGTGTGTCTGAAGATAGCAAGGG - Intergenic
1145762298 17:27432324-27432346 TGTGTATCTAAACACAGAAAAGG + Intergenic
1146129087 17:30255220-30255242 TGTGTATCTAAACATAGAAAAGG - Intronic
1146235027 17:31151152-31151174 TGTGTATCTAAACATAGAAAAGG - Intronic
1147549152 17:41426434-41426456 TGTGTATCTAAACATAGAAAAGG + Intergenic
1148497690 17:48063411-48063433 TGTGTATCTAAACCTAGAAAAGG + Intergenic
1148571159 17:48670248-48670270 TGTGTATCTAAACATAGAAATGG - Intergenic
1148768055 17:50050911-50050933 TGTATATTTGAATATAGATAGGG - Intergenic
1148990810 17:51665728-51665750 TGTGTATCTAAACGTAGAAAAGG + Intronic
1149127042 17:53247461-53247483 AGTGTATCTAAACATAGAAAAGG - Intergenic
1149327375 17:55545808-55545830 TGTGTATCTAAACATAGGAAAGG - Intergenic
1149672924 17:58431381-58431403 TATGTATCTAAACATAGAAAAGG + Intronic
1149683990 17:58525014-58525036 TGTGTACCTGTGTATGGAGAAGG + Intronic
1149700295 17:58649517-58649539 TGTGTACCTGGATATAGAACAGG - Intronic
1149891715 17:60395072-60395094 TGTGTATCTAAACATAGAAAAGG + Intronic
1149960685 17:61106334-61106356 TGTGTATCTAAACATAGAAAAGG - Intronic
1150607124 17:66702912-66702934 TGTGTATCTAAACATAGAAAAGG + Intronic
1150707418 17:67499699-67499721 TGTGTATCTAAACACAGAAAAGG - Intronic
1150845410 17:68652263-68652285 TGTGTATCTAAACATAGAAAAGG - Intergenic
1151020755 17:70614691-70614713 TATGTATCTAAATATAGAAAAGG - Intergenic
1151166761 17:72210354-72210376 TGTGTATCTAAACACAGAAAAGG - Intergenic
1151268444 17:72974863-72974885 TGTGTATCTGAACATAGAAGAGG - Intronic
1152180396 17:78817080-78817102 TGTGTATCTAAACATAGAGAAGG - Intronic
1152977665 18:238607-238629 TGTGTATCTAAACATAGAAAAGG + Intronic
1152990460 18:358853-358875 TGTGTATCTAAACATAGAAAAGG + Intronic
1153160464 18:2199070-2199092 TGTGTATCTGAACATAGAGTAGG - Intergenic
1153205327 18:2693474-2693496 TGTGTAGCTAAACATAGAAAAGG + Intronic
1153211305 18:2767974-2767996 TGTGTATCTAAACATAGAAAAGG + Intronic
1153213339 18:2792247-2792269 TGTGTATCTAAACATAGAAAAGG - Intronic
1153269433 18:3305278-3305300 TGTGTATCTAAACATAGAAAAGG - Intergenic
1153298335 18:3569973-3569995 TGTGTATCTAACCATAGAAAAGG - Intronic
1153697487 18:7659014-7659036 TGAAGACCTGAATATGGAAATGG - Intronic
1153734626 18:8052398-8052420 TTTGTATCTAAACATAGAAACGG - Intronic
1154079201 18:11237530-11237552 TGTGTATCTAAACATAGAAAAGG + Intergenic
1154459419 18:14565672-14565694 TGTTTACCAGAACAAAGAAAAGG - Intergenic
1154500460 18:14993644-14993666 TGTGTATCTAAACATGGAAAAGG - Intergenic
1154503651 18:15010392-15010414 TGTGTATCTAAACATAGAAAAGG - Intergenic
1155300537 18:24425329-24425351 TGTGTATCTAAACAAAGAAAAGG - Intergenic
1155439765 18:25850046-25850068 TGTGTATCTAAACATAGAAAAGG - Intergenic
1155445280 18:25905117-25905139 TATATATCTGAACATAGAAAAGG + Intergenic
1155516785 18:26631455-26631477 TGTGTATCTAAACATAGAAAAGG + Intronic
1155732853 18:29183068-29183090 TCTGTATCTAAACATAGAAAAGG - Intergenic
1156275430 18:35579548-35579570 TGTGTATCTAAACACAGAAAAGG + Intergenic
1156437599 18:37149620-37149642 TGTGTACCTGAATATAGAAAAGG + Intronic
1156875474 18:42005317-42005339 TGTGTATCTAAACATAGAAAAGG + Intronic
1157129083 18:44986236-44986258 TGAGTATCTAAACATAGAAAAGG + Intronic
1157338980 18:46762345-46762367 TGGGTACCTGAGAAGAGAAAAGG + Intergenic
1157418054 18:47522374-47522396 TGTGTGTCTAAACATAGAAAAGG - Intergenic
1157532915 18:48437253-48437275 CGTGTATCTAAACATAGAAAAGG + Intergenic
1157646092 18:49273562-49273584 TGTGTATCTAAACATAGAAAGGG - Intronic
1158348153 18:56536683-56536705 TGTGTATCTAAACATAGAAAAGG - Intergenic
1158634610 18:59145808-59145830 TATGTAACTAAACATAGAAAAGG - Intronic
1159315095 18:66762551-66762573 AACGTACCTAAATATAGAAAAGG - Intergenic
1159573520 18:70147289-70147311 TGTGTATCTAAACATAGAAAAGG - Intronic
1160173326 18:76572461-76572483 TGGGTAGCAGAATACAGAAATGG + Intergenic
1160248174 18:77177376-77177398 GGTGTATCTAAACATAGAAAAGG + Intergenic
1160476836 18:79198687-79198709 TGTGTATCTAACCATAGAAAAGG + Intronic
1162231795 19:9272946-9272968 TGTGTATCTAGACATAGAAAAGG - Intergenic
1163098183 19:15076266-15076288 TGTGTATCTAAACATAGAAAAGG + Intergenic
1163222445 19:15931224-15931246 TGTGTCCCTGCGTATGGAAAGGG + Intronic
1164436705 19:28236640-28236662 TGTGAACCAGAATGGAGAAAGGG + Intergenic
1165379689 19:35469699-35469721 TGTGTATCTCAACATAGAAAAGG + Intergenic
1165380863 19:35479075-35479097 TGTGTTTCTAAACATAGAAAAGG + Intergenic
1165550477 19:36579627-36579649 TGTGTATCTAAACATAGCAAAGG + Intronic
1165699075 19:37923447-37923469 TGTGTATCTAAACATAGAAAAGG + Intronic
1165935675 19:39387260-39387282 TGTGTATCTAAACATAGAAAAGG + Intronic
1166973334 19:46586654-46586676 TGCATACCTAAACATAGAAAAGG + Intronic
1167488632 19:49778651-49778673 TGTGCATCTAAACATAGAAAAGG + Intronic
1168386153 19:55964973-55964995 TGTGTCCCTGGTTTTAGAAAAGG + Intronic
1168477770 19:56689854-56689876 TGTGTATCTAAACATAGAAAAGG + Intergenic
925654554 2:6131764-6131786 TGTGTGTATAAATATAGAAAAGG - Intergenic
925733100 2:6936578-6936600 TGTGTCTATCAATATAGAAAAGG - Intronic
925838429 2:7967770-7967792 TGTGTATCTAAATGTAGAAAAGG - Intergenic
925915866 2:8605626-8605648 TGTTTATATAAATATAGAAAAGG - Intergenic
925933313 2:8728644-8728666 TGCGTTCCTGTAGATAGAAAAGG - Intronic
926201919 2:10806790-10806812 TGTGTATCTAAACATAGAAAGGG - Intronic
926282408 2:11460816-11460838 TGTGCATCTAAACATAGAAAAGG + Intronic
926303968 2:11624314-11624336 TGTGTATCTAAACATAGAAAAGG - Intronic
926433360 2:12813881-12813903 TATGTATCTAAACATAGAAAAGG - Intergenic
926652318 2:15360055-15360077 TGTGTATCTAAACATAGAAAAGG + Intronic
926664244 2:15502580-15502602 TGTGTATCTAAACACAGAAAAGG + Intronic
926889536 2:17627282-17627304 TGTGTACCTGAAAACACAGAGGG - Intronic
927375553 2:22408851-22408873 TGTATACTAGAAAATAGAAAGGG - Intergenic
927529893 2:23786545-23786567 TCTGTATCTGAACATAGAAAAGG + Intronic
927732225 2:25483916-25483938 TATGTATCTAAACATAGAAAAGG - Intronic
928152871 2:28847865-28847887 TGTGTATCTAAACATAGAAAAGG - Intronic
928355383 2:30608580-30608602 TGTGTGTCTAAACATAGAAAAGG - Intronic
928437463 2:31264257-31264279 TGTGTATCTAAACATAGAAATGG + Intronic
928505406 2:31946886-31946908 TGTGTATGTAAACATAGAAAAGG - Intronic
928662574 2:33518307-33518329 TGTGTATCTAAACATAGAAAAGG + Intronic
928874528 2:36022225-36022247 TGTGTATCTAAACATAGAAAAGG - Intergenic
929011748 2:37451861-37451883 TGAGAAGCTGAATATACAAAGGG - Intergenic
929014343 2:37479764-37479786 TGTGTATCTAAACATAGAAAAGG + Intergenic
929262529 2:39881886-39881908 TGTGTATCTAAACATAGAAAAGG + Intergenic
929388896 2:41444826-41444848 TGTCTATCTAAACATAGAAAAGG - Intergenic
929583051 2:43096110-43096132 TGTGTATCTAAACATAGAAAAGG - Intergenic
929621804 2:43362462-43362484 TGTGTATCTAAACATAGAAAAGG + Intronic
929819937 2:45264847-45264869 TGTGAACCTCAATATATAAAGGG - Intergenic
930058215 2:47268221-47268243 TGAGTACCTGGAGAGAGAAAGGG + Intergenic
930169713 2:48238627-48238649 TGTATATCTAAACATAGAAAAGG - Intergenic
930181500 2:48363696-48363718 TGTGTATCTAAACACAGAAAAGG - Intronic
930653022 2:53981094-53981116 TGTGTATCTAAACATAGAAGAGG - Intronic
930679607 2:54242621-54242643 TGTGTATCTAAACATAAAAAAGG - Intronic
930679663 2:54243393-54243415 TGTGTACCTAAACATAGAAAAGG + Intronic
930978294 2:57491073-57491095 TGTGTATTTAAATATAGAAAAGG - Intergenic
931327191 2:61238628-61238650 TGTGTACATGAATATTAATATGG - Intronic
931412619 2:62047837-62047859 TATGTATCTAAACATAGAAAAGG - Intronic
931507330 2:62944394-62944416 TGTGTATCTAAACATAGAAAAGG - Intronic
931860053 2:66345610-66345632 TGTGTACATGTAACTAGAAATGG + Intergenic
931898434 2:66760745-66760767 TGTGTATCTAAACATAGTAAAGG - Intergenic
931900014 2:66778099-66778121 TGTGTATTTAAACATAGAAAAGG + Intergenic
932444580 2:71768466-71768488 TGTGCATCTAAACATAGAAACGG + Intergenic
932491514 2:72125872-72125894 TGTGTATCTAAACATAGAAAAGG + Intergenic
932548748 2:72744023-72744045 TGTATATCTAAATGTAGAAAAGG - Intronic
932585813 2:73027999-73028021 TGTGTATCTAAACATAGACAAGG - Intronic
932639635 2:73430636-73430658 TGTGTATCTAAACATAGGAAAGG - Intronic
932694217 2:73940699-73940721 TGTGTATCTAAACATAGAAAAGG - Intronic
932809833 2:74815738-74815760 TGTGTATCTAAACATAGATAAGG + Intergenic
933034053 2:77369861-77369883 TGTATATCTAAACATAGAAAAGG + Intronic
933337668 2:80979454-80979476 TATGTGCCCGAATAAAGAAAGGG - Intergenic
933708982 2:85311840-85311862 TATGTATCTAAACATAGAAAAGG + Intergenic
934321171 2:91973429-91973451 TGTGTACCTGAACATAAAGAAGG - Intergenic
934691635 2:96365200-96365222 TGTGTCCCTGTATGTGGAAAGGG + Intronic
934877081 2:97932963-97932985 CGTGTATCTAAACATAGAAAAGG - Intronic
934944825 2:98532696-98532718 TGTGTGTCTAAACATAGAAAAGG + Intronic
934972875 2:98777096-98777118 TGTGTATCTAAACATAGAAAAGG - Intergenic
935032276 2:99334583-99334605 TGTGTATCTAAACATAGAAAAGG + Intronic
935148828 2:100415991-100416013 TGTGTATCTAAAATTAGAAAAGG + Intronic
935541832 2:104357611-104357633 TGTGTGCCTGTATATACACATGG + Intergenic
935611888 2:105034288-105034310 TGTGTATCTAAACATAGAAAAGG + Intergenic
935625026 2:105165056-105165078 TGTGTTCTTTATTATAGAAAAGG + Intergenic
935809938 2:106787816-106787838 TGTCTAGCTGAGTATACAAAAGG + Intergenic
936143505 2:109962180-109962202 CGTGTATCTCAACATAGAAAAGG + Intergenic
936180189 2:110260143-110260165 CGTGTATCTCAACATAGAAAAGG + Intergenic
936201182 2:110409286-110409308 CGTGTATCTCAACATAGAAAAGG - Intronic
936442863 2:112570639-112570661 TGTGTAGCTAAACATAGAAAAGG + Intronic
936518049 2:113194715-113194737 TGTATATCTAAACATAGAAAAGG + Intronic
937062647 2:118991930-118991952 TCTGTACCTTAAAATAGGAAAGG + Intronic
938031857 2:128001590-128001612 TGTATATCTAAATACAGAAAAGG - Intronic
938375358 2:130801804-130801826 TGTGTATCTAAACATAGAAAAGG + Intergenic
938499660 2:131823991-131824013 TGTGTATCTAAACATAGAAAAGG - Intergenic
938502827 2:131840535-131840557 TGTGTATCTAAACATAGAAAAGG - Intergenic
938635807 2:133225205-133225227 TATGTAGCTTAATATGGAAAGGG + Intronic
938808813 2:134832548-134832570 TGTGTATCTAAACATAGAAAAGG - Intergenic
938827578 2:135020991-135021013 TATGTACATTAATATTGAAAAGG - Intronic
938850398 2:135253665-135253687 TGTGTATCTAAACATAGAAAGGG + Intronic
939235831 2:139491222-139491244 TGTGTATCTAAACATAGAAAAGG + Intergenic
939359266 2:141147868-141147890 TGTGTATCTAAACATAGAAAAGG - Intronic
939425979 2:142037077-142037099 TATGAACGTGAATAAAGAAAAGG - Intronic
939541142 2:143495227-143495249 TGTGCACCTAAATAAAGAAGAGG - Intronic
939621212 2:144421116-144421138 TGTTAACCTGAAAATACAAAAGG + Intronic
939694667 2:145309822-145309844 TGTGTATCTAAACATAGAAAAGG - Intergenic
939965258 2:148604480-148604502 TGTCTTCCTGAAAATTGAAAGGG - Intergenic
940038642 2:149335769-149335791 TGTGTATCTAAACATAGAAAAGG - Intronic
940227741 2:151417953-151417975 TGTGTACCTAAACATAGAAAAGG + Intronic
940240248 2:151554704-151554726 TGTGTATCTAAACATAGAAAAGG - Intronic
940474233 2:154141054-154141076 TTTGTATCTAAACATAGAAAAGG + Intronic
940959676 2:159770672-159770694 TGTGTATCTAAATATAGAAAAGG - Exonic
940994262 2:160130185-160130207 TGTGTATCTAGACATAGAAAAGG + Intronic
941011514 2:160305362-160305384 TGTGTATCTAAATATAGAAAAGG - Intronic
941059959 2:160835829-160835851 TTGGTACATGAATATAAAAAAGG - Intergenic
941278413 2:163519527-163519549 TGTGTAACTAAATACAGAAAAGG - Intergenic
941282025 2:163564093-163564115 TGTGTATCTAAACATAGAAAAGG + Intergenic
941470326 2:165877456-165877478 TGTGTATGTAAACATAGAAAAGG - Intronic
941502365 2:166295547-166295569 TGTGTATCTAAAGACAGAAAAGG + Intronic
941549451 2:166896879-166896901 TGTGTATCTAAACATAGAAAAGG - Intronic
941694888 2:168540430-168540452 TGTGTATCTAAACATAGAAAAGG - Intronic
941862563 2:170298881-170298903 TATGTATCTAAACATAGAAAAGG - Intronic
941875922 2:170433130-170433152 TGTGTATCTAAACATAGAAAAGG - Intronic
941891771 2:170589936-170589958 TGTGTATCTAAACATAGAAAAGG - Intronic
942037753 2:172027346-172027368 TGTGTATCTAAACATGGAAAAGG - Intronic
942067142 2:172282243-172282265 TGTGTATCTAAACATAGAGAAGG + Intergenic
942106044 2:172634693-172634715 TTTGTACCTGAACATGAAAAAGG - Intergenic
942765794 2:179455160-179455182 TGTGTATCTAAACATAGGAAAGG - Intronic
942797650 2:179840465-179840487 TGTGGAGCTGAAATTAGAAAAGG + Intronic
942819197 2:180091076-180091098 TGTGTATCTAAACATAGAAAAGG - Intergenic
943034193 2:182720512-182720534 TTTGTATTTAAATATAGAAAAGG - Intronic
943131950 2:183864773-183864795 TATGTATCTAAACATAGAAAAGG - Intergenic
943288413 2:186035333-186035355 TGTGTATCTAAACATAGAAAAGG - Intergenic
943326977 2:186511589-186511611 TGTGCATCTAAACATAGAAAAGG - Intergenic
943342900 2:186702306-186702328 TGTGTATCTAAACATAGAAAAGG + Intronic
943462208 2:188183536-188183558 TGTGTACCTAAACATAGTAAAGG + Intergenic
943480113 2:188406294-188406316 TGTGTATCTAAATACAGAAGAGG + Intronic
943506978 2:188773109-188773131 TGTGTATCTAAACATAGAAAAGG - Intronic
943618833 2:190124440-190124462 TGTATATCTAAATATACAAAAGG + Intronic
943620797 2:190145567-190145589 TGTGTACCTAAACACAGAAAAGG - Intronic
943687261 2:190831595-190831617 TGGGCACCTGAAGATAGAAACGG + Intergenic
943702873 2:191005469-191005491 TGTGTATCTAAACATAGAAAAGG - Intronic
943769223 2:191697052-191697074 TGTGTATCTAAACATAGAAAAGG + Intergenic
943929281 2:193829139-193829161 TGTGTATGTAAACATAGAAAAGG + Intergenic
943978491 2:194514183-194514205 AGTGTACCTAAATATAGAAAAGG + Intergenic
944200251 2:197099152-197099174 TGTGTCACAGAATATAGACAGGG - Intronic
944620999 2:201516174-201516196 TGTGTATCTAAACACAGAAAAGG + Intronic
945113201 2:206384133-206384155 TGTGTATTTAAACATAGAAAAGG + Intergenic
945526611 2:210895657-210895679 TGTGTATCTAAACATAGAAGAGG - Intergenic
945542222 2:211102752-211102774 TGTGTATCTAAACATAGAAAAGG + Intergenic
945601749 2:211875819-211875841 TGTGTATCTGAACATAGAAAAGG - Intronic
945900285 2:215529701-215529723 TGTGTATCTAAACATAGAAAAGG + Intergenic
946233985 2:218310902-218310924 TGTGTATCTAAACCTAGAAAAGG - Intronic
946385281 2:219380529-219380551 AGTGTATCTAAACATAGAAAAGG - Intronic
946492272 2:220160503-220160525 TGTGCATCTAAACATAGAAAAGG + Intergenic
946740642 2:222797843-222797865 TGTGTATCTAAACATAGAAAAGG - Intergenic
946755410 2:222940601-222940623 AGTGTATCTAAACATAGAAAAGG - Intronic
947131765 2:226934176-226934198 TGTGTATCTAAACATAGAAAAGG - Intronic
947184465 2:227442674-227442696 TGTGCACCTAAACATAGAAAAGG - Intergenic
947513274 2:230778860-230778882 TGTTTATCTAAACATAGAAAAGG + Intronic
948549020 2:238755667-238755689 TGTAGCCCTGAAAATAGAAACGG + Intergenic
948554867 2:238801852-238801874 TGTGTATCTAAACATAGAAAAGG - Intergenic
1168782748 20:508037-508059 TGTGTATCTAAACGTAGAAAAGG + Intronic
1168993992 20:2118774-2118796 TGTGTATCTAAACACAGAAAAGG - Intronic
1169057968 20:2639396-2639418 TGTGTATCTAAACATAGAAAAGG - Intronic
1169389936 20:5181832-5181854 TGTGTATCTAAACATAGAAAAGG + Intronic
1170201380 20:13747982-13748004 TGTGTATCTAAACATAAAAAAGG + Intronic
1170411540 20:16097427-16097449 TATGTATCTAAACATAGAAAAGG + Intergenic
1170751868 20:19155746-19155768 TGTGTATCTAAACATAGGAAAGG + Intergenic
1170881582 20:20301240-20301262 GGTGTATCTAAACATAGAAAAGG - Intronic
1171471199 20:25372972-25372994 TGTGTATCTACACATAGAAAAGG - Intronic
1171515765 20:25732988-25733010 AGTGTCCTTGAATATAGAGATGG + Intergenic
1172322413 20:34006648-34006670 TGTGCACCTAAATATACAATGGG - Intronic
1172568628 20:35951931-35951953 TGTGTATCTATACATAGAAATGG - Intergenic
1172892401 20:38275961-38275983 TGTGTATCTAAATATACAAAAGG + Intronic
1174310124 20:49646446-49646468 TGTGTATCTAAACATAGAAAAGG - Intronic
1174862077 20:54100262-54100284 TGTGTATCTAAACATAGAAAAGG + Intergenic
1175337969 20:58208662-58208684 TGTATATCTAAACATAGAAAAGG - Intergenic
1175582280 20:60109707-60109729 TGTGTATCTAAACATAGAAAAGG - Intergenic
1175843178 20:62043653-62043675 TGTGTATCTAAACATAGAAAAGG - Intronic
1176187230 20:63787511-63787533 TGTGTGTCTAAACATAGAAAGGG - Intronic
1176668240 21:9707145-9707167 TGTGTATCTAAACATAGAAAAGG + Intergenic
1176814725 21:13587678-13587700 TGTTTACCAGAACAAAGAAAAGG + Intergenic
1176887872 21:14277569-14277591 TATGTACCAGAAAATATAAAGGG + Intergenic
1177043323 21:16139750-16139772 TGTGTATCTAAACATAGAAAAGG - Intergenic
1177415846 21:20792661-20792683 TGTGTTCTTGACTATATAAAAGG + Intergenic
1177443469 21:21159507-21159529 TGTGTATCTAAACATACAAAAGG - Intronic
1177895668 21:26854262-26854284 TGTATATCTAAACATAGAAAAGG - Intergenic
1177934439 21:27325531-27325553 TGTGTAACCGCATATAGAAAAGG + Intergenic
1178481205 21:32980595-32980617 TGTGTGCCTGTAAATGGAAATGG + Intergenic
1178628891 21:34242254-34242276 TGTGTATCTAAACATAGAAAGGG - Intergenic
1178904804 21:36627737-36627759 TGTGTATCTCAACCTAGAAAAGG + Intergenic
1178946856 21:36955873-36955895 TGTGTATCTAAACATAGAAAAGG - Intronic
1179580550 21:42340842-42340864 TGTGTATCTAAACATAGAAAAGG + Intergenic
1179781518 21:43703902-43703924 TGTGTATCTAAATACAGAAAAGG + Intergenic
1180104112 21:45606063-45606085 TGTGTGTCTAAACATAGAAAAGG - Intergenic
1180309416 22:11157401-11157423 TGTGTACCTGAACATAGAGAAGG - Intergenic
1180547893 22:16519212-16519234 TGTGTACCTGAACATAGAGAAGG - Intergenic
1181046491 22:20216906-20216928 TGTGTATCTAAACATAGAAAAGG - Intergenic
1181863651 22:25838573-25838595 CGTGTATCTAAACATAGAAAAGG - Intronic
1181994643 22:26867100-26867122 TGTGTATCTAAACATAGAAAAGG - Intergenic
1182055119 22:27346636-27346658 TGTGTATCTAAACATAGAAAAGG - Intergenic
1182153287 22:28046447-28046469 TGTGTATCTAAACATAGAAAAGG + Intronic
1182160721 22:28118512-28118534 TGTGTATCTAAACATAGAGAAGG - Intronic
1182211567 22:28681159-28681181 TGTGTACCTGAACATAGAGAAGG + Intergenic
1182285993 22:29247573-29247595 TGTGTATCTAAACATAGAAAAGG + Intronic
1182521788 22:30888933-30888955 TGTGTATCTAAACATAGAAAAGG + Intronic
1182580293 22:31304876-31304898 AGTGTATCTAAACATAGAAAAGG + Intergenic
1182756658 22:32685515-32685537 TGTGTATCTAAACATAGAAAAGG - Intronic
1182855496 22:33513937-33513959 TGTGTATCTCAACATAGAAAAGG - Intronic
1182879302 22:33719844-33719866 TGTGTACCTAAACATGGAAAAGG - Intronic
1183130526 22:35830665-35830687 TGTGTGTCTAAATATAGAAAAGG + Intronic
1183608440 22:38881230-38881252 TCTCTACCTGATTAGAGAAAAGG + Intergenic
1184312485 22:43656571-43656593 TGTGTATCTAAACATAGAAAAGG - Intronic
1184317680 22:43709592-43709614 TTTGTACGTGAATACAAAAATGG + Intronic
1184543437 22:45146969-45146991 TGTGTATTTAAACATAGAAAAGG - Intergenic
1184633975 22:45811487-45811509 TGTGTATCTAAACATAGAAGAGG - Intronic
949206579 3:1446530-1446552 TGTGTGCCTGGGTATAGGAAAGG - Intergenic
949387691 3:3521669-3521691 TGTGTATCTAAACATATAAAAGG + Intergenic
949704677 3:6802884-6802906 TCTTTATTTGAATATAGAAACGG - Intronic
949965386 3:9351670-9351692 TGTGTATCTAAACATAAAAAAGG - Intronic
950051985 3:9998707-9998729 TGTCTACAAAAATATAGAAATGG - Intronic
950108983 3:10406475-10406497 TGTGTATCTAAACATAGAGAAGG - Intronic
950370584 3:12526375-12526397 TGTGTATCTAAACATAGAAATGG - Intronic
950405658 3:12802901-12802923 TGTGTGTCTAAACATAGAAAAGG + Intronic
950453765 3:13080405-13080427 TGTGTCCCTGTATAGACAAAGGG - Intergenic
950734742 3:14997141-14997163 TGTGTATCTAAACATAGAAAAGG - Intronic
950759451 3:15207250-15207272 TGTGCATCTAAACATAGAAAAGG + Intronic
950921733 3:16701843-16701865 TGTGTATATGAATGGAGAAAAGG - Intergenic
951009331 3:17657993-17658015 TGTTTATCTAAACATAGAAAAGG - Intronic
951213733 3:20004179-20004201 TGTGTACCTAAACACAGAAGAGG - Intronic
951372238 3:21864119-21864141 TGTGTACATGCATACACAAAGGG + Intronic
951527310 3:23665826-23665848 TGTGTATCTTGACATAGAAAAGG + Intergenic
952060304 3:29500565-29500587 TGTATATCTAAACATAGAAAAGG - Intronic
952112427 3:30139299-30139321 TGTGTATCTAAACATAGAAAGGG - Intergenic
952234980 3:31470118-31470140 TTTGTACCTGATTTCAGAAATGG + Intergenic
952426642 3:33181716-33181738 TGTGTATCTAAACATAGAAAAGG - Intronic
952440406 3:33321796-33321818 TGTGTATCTAAATGTAGAAAAGG + Intronic
952546488 3:34425417-34425439 TGTGTATGTAAACATAGAAAAGG + Intergenic
952675416 3:36024271-36024293 TGTATATCTAAATATAGAAAAGG - Intergenic
952975455 3:38690817-38690839 TGTGTATCTAAATATAGAAAAGG - Intergenic
953141813 3:40236131-40236153 TGTGTATCTAAACATAGAAACGG - Intronic
953670003 3:44954348-44954370 TGTATATCTAAACATAGAAATGG - Intronic
953819827 3:46197317-46197339 TGTATACCTAAGCATAGAAAAGG - Intronic
953919459 3:46941925-46941947 TGTCTCCCTGAATATAGCATAGG - Intronic
954221500 3:49157564-49157586 TGTGTATCTAAACATAGAAAAGG - Intergenic
954345092 3:49990348-49990370 TGTGTATCTAAATATAGAAAAGG + Intronic
954668173 3:52271238-52271260 TGTGTATCTAAACATAGAAAAGG - Intronic
954816237 3:53283003-53283025 TGTGTATCTAAACACAGAAAAGG + Intergenic
955379503 3:58425904-58425926 TGTGTACTTGAATTTTTAAATGG - Intronic
955493565 3:59507590-59507612 TGTGTATCTAAACATAAAAAAGG - Intergenic
955578386 3:60391592-60391614 TGTGTATCTAAACGTAGAAAAGG - Intronic
955594992 3:60579333-60579355 TGTGTATCTAAATATAGAAAAGG + Intronic
955936192 3:64104908-64104930 TGTGTACTTGCCTCTAGAAAGGG + Intronic
955995170 3:64672925-64672947 TGTGTATCTAAACATAGAAAAGG - Intronic
956299734 3:67759025-67759047 TGTTTAACTTAATATAGATATGG + Intergenic
956306618 3:67833312-67833334 TGTGTATCTCAACATAGGAAAGG + Intergenic
956325534 3:68048554-68048576 TGTGTACAAAAATATGGAAAGGG - Intronic
956703417 3:71979040-71979062 TGTCTACCTAAAGAAAGAAACGG + Intergenic
956721427 3:72121186-72121208 TGTGTACCTAAACTTGGAAAAGG + Intergenic
956842132 3:73150492-73150514 TGCGTATCTAAACATAGAAAAGG - Intergenic
956895976 3:73660233-73660255 TGTGAATCTAAATGTAGAAAAGG + Intergenic
957112675 3:75985443-75985465 TGTGTATCTAAACACAGAAAAGG + Intronic
957393215 3:79606012-79606034 TGGGTACATGTATATATAAATGG - Intronic
957638097 3:82813617-82813639 TGTGTATCTAAACATAGAAAAGG + Intergenic
957825079 3:85431077-85431099 TGTGTATCTAAACATAGAAAAGG - Intronic
958635750 3:96743167-96743189 TGTATGCCTGAAGATTGAAAAGG + Intergenic
958647851 3:96895676-96895698 TTTGTGCCTAAACATAGAAATGG - Intronic
958648743 3:96908108-96908130 TGTGTATCTAAACATAGAAAGGG + Intronic
959182879 3:103004512-103004534 TATGTATATGAATATAGAAATGG + Intergenic
960252916 3:115476442-115476464 TATGTATCTAAACATAGAAAAGG - Intergenic
960981606 3:123233236-123233258 TGTGTATCTAAACATAGAAAAGG - Intronic
962567424 3:136676086-136676108 TGTGTATCTAAACATAGAAATGG + Intronic
962609288 3:137060154-137060176 TGTGTATCCAAACATAGAAAAGG + Intergenic
962646131 3:137442276-137442298 TGTGTATCTAAATATAGAAAAGG + Intergenic
962659813 3:137589947-137589969 TGTGCACATGAGTATAAAAATGG - Intergenic
962828089 3:139117299-139117321 TATGTATCTAAACATAGAAAAGG - Intronic
962896484 3:139719499-139719521 TGTATATCTAAACATAGAAAAGG + Intergenic
963227912 3:142881667-142881689 TGTGTATCTAAACACAGAAAAGG + Intronic
963341313 3:144037182-144037204 TGTGTATCTAAATATAGAAAAGG - Intronic
963536997 3:146542047-146542069 TATGTATCTAAACATAGAAAGGG - Intronic
963671860 3:148260917-148260939 TGTGTATCTAAACATAGAAAAGG - Intergenic
963875527 3:150470462-150470484 TGTGTACCTAAACATAGAAAAGG + Intergenic
964050702 3:152389616-152389638 TGTGTATCTAGACATAGAAAAGG + Intronic
964127697 3:153253043-153253065 TGTGTATCTAAACATAGAAGAGG + Intergenic
964331004 3:155602682-155602704 TGTGTATCTAAACACAGAAAAGG + Intronic
964333518 3:155629917-155629939 TCTTCACCTGAATATAAAAAAGG - Intronic
964383048 3:156117673-156117695 TGTGTATCTAAATACAGAAAAGG + Intronic
964423184 3:156526091-156526113 TGTGTATCTAAACATAGAAAAGG - Intronic
964679715 3:159324170-159324192 TGAGAAACTGAATATACAAATGG - Intronic
964920817 3:161893185-161893207 TGTGTGTCAGAAAATAGAAAAGG + Intergenic
965001339 3:162958174-162958196 TGTTTCCCAGAATGTAGAAATGG - Intergenic
965346375 3:167556004-167556026 TGCGTATCTAAACATAGAAAAGG + Intronic
965364887 3:167786123-167786145 TGTGTATCTAAACACAGAAAAGG + Intronic
965426408 3:168529465-168529487 TGTGTATCTAACCATAGAAAAGG - Intergenic
965549720 3:169952050-169952072 TGTGTATCTAAACACAGAAAAGG - Intergenic
965786449 3:172340195-172340217 TGTGGAACTGAAGAGAGAAACGG - Intronic
965819595 3:172672124-172672146 TGTATATCTAAACATAGAAAAGG - Intronic
965943282 3:174210843-174210865 TGTGTATCTAAACCTAGAAAAGG - Intronic
965990649 3:174813398-174813420 TGTGTGTCTAAACATAGAAAAGG - Intronic
966270832 3:178103443-178103465 TGTGTATGTAAATATAGAATTGG - Intergenic
966426598 3:179786648-179786670 TGTGTATCTCAATATATACAAGG + Exonic
966508902 3:180738660-180738682 TGTGTATCTAAACATGGAAAAGG - Intronic
966553726 3:181234243-181234265 TGTGTATCTAAACATAGAAAAGG + Intergenic
966950736 3:184814580-184814602 TGTATATCTAAACATAGAAAAGG + Intronic
967667843 3:192195450-192195472 TTTGTATCTAAACATAGAAAAGG - Intronic
967938970 3:194751615-194751637 TGTGTCTCTAAATATAGAAAAGG + Intergenic
968475404 4:803979-804001 TGTGCACCTAAGCATAGAAAAGG - Intronic
968772829 4:2519154-2519176 TGTGTATCTAAACATAGAAAAGG + Intronic
969057447 4:4410583-4410605 TGTGTATCTAAACATAGAAGAGG + Intronic
969925430 4:10581052-10581074 TGTGTATCTAAACATAGAAAAGG - Intronic
969982878 4:11177090-11177112 TGTGTATCTAAACATAGAAAAGG - Intergenic
969983789 4:11186370-11186392 TGTATATCTAAACATAGAAAAGG - Intergenic
969993245 4:11285541-11285563 TGTGTAACTGAAAATATATATGG + Intergenic
970265550 4:14280039-14280061 TGTGCATGTAAATATAGAAAAGG + Intergenic
970444341 4:16111461-16111483 TGTGTATCTAAACATAGAAAAGG + Intergenic
970890383 4:21037410-21037432 TGTGTATCTAAACAGAGAAAAGG - Intronic
971315258 4:25562551-25562573 TGTGTATCTAAACATAGAAAAGG - Intergenic
971627195 4:28936670-28936692 GGTGTACCTGAAGATATGAAGGG - Intergenic
972105158 4:35475982-35476004 TGTGTATCTAAACATAGAGAAGG + Intergenic
972588304 4:40459608-40459630 GGTTTACCTGCATATAGAACTGG + Intronic
972713454 4:41621873-41621895 TGTGGAGCTGTATAGAGAAATGG - Intronic
972967702 4:44531933-44531955 TGTGTGCCTGAATACAGAAAAGG + Intergenic
973270585 4:48258585-48258607 TGTGTATCAGAATACAGATATGG - Intronic
973344973 4:49045502-49045524 TGTGTATCTAAACATAGAAAAGG - Intronic
973753691 4:54050631-54050653 TGTGTATCTAAACATAGAAAAGG - Intronic
973904418 4:55513209-55513231 TGTGTATCTGAATGTAGAAAAGG - Intronic
974012183 4:56617261-56617283 TGTGTAGCTAAACATAGAAAAGG + Intergenic
974200545 4:58633727-58633749 TGTGGACCAGAAGAAAGAAAGGG + Intergenic
974542826 4:63261174-63261196 TGAGTACCTGAATAAGAAAAGGG - Intergenic
974737099 4:65950540-65950562 TGCGTATCTAAACATAGAAAAGG - Intergenic
974928288 4:68328927-68328949 TGTGTATCTAAACATAGAAAAGG + Intronic
975491928 4:74998768-74998790 TCTTTCCCTGAATAAAGAAAGGG - Intronic
975544983 4:75551192-75551214 TGTGTATCCAAACATAGAAAAGG + Intergenic
975693564 4:76989714-76989736 TGTATATCTAAACATAGAAATGG - Intronic
975878810 4:78876998-78877020 TTTGTATCTAAACATAGAAAAGG + Intronic
976002928 4:80393553-80393575 TGTGTATCTAAACATAGAAAAGG - Intronic
976038088 4:80848481-80848503 TGTGTATCTAAACATAGAAAAGG + Intronic
976398208 4:84580756-84580778 TGTGTATCTAAACATAGAAAAGG - Intergenic
976616482 4:87082868-87082890 TGTGTAATTTAATATAGAACTGG - Intronic
976630885 4:87235300-87235322 TGTGTACCTAAACGTAGGAAAGG - Intronic
976757601 4:88515190-88515212 TGTATATCTAAAAATAGAAAAGG + Intergenic
977173988 4:93797103-93797125 TGTGAATCTAAACATAGAAAAGG + Intergenic
977202574 4:94133691-94133713 TGTGTATCTAAACACAGAAAGGG - Intergenic
977286572 4:95115028-95115050 TGTGTATCTAACCATAGAAAAGG - Intronic
978076609 4:104538999-104539021 TGTCTACATGAATATTGAAATGG + Intergenic
978121479 4:105084403-105084425 TGTGCATCTAAACATAGAAAAGG + Intergenic
978330396 4:107606736-107606758 TGTGTATGTAAACATAGAAATGG - Intronic
978417046 4:108487857-108487879 TGTGTATCTAAACATAGAAAAGG + Intergenic
978430100 4:108624599-108624621 TTTGTGCCTTAATATAGAGAAGG + Intronic
978554748 4:109967861-109967883 TGTGTATCTAAACATAGAAAAGG + Intronic
978920748 4:114180271-114180293 TGTGTATCTAAACATAGAAAAGG + Intergenic
979106427 4:116694692-116694714 TGTGTATCTAAACATAGAAAAGG + Intergenic
979159533 4:117442099-117442121 TGTGTATTTAAACATAGAAAGGG + Intergenic
979350373 4:119637262-119637284 TGTGTAGCTAAACATAGAAAAGG + Intergenic
979372372 4:119904653-119904675 TGTATATCTAAACATAGAAAAGG - Intergenic
979554187 4:122026085-122026107 TGTGTATCTAAACATAGAAAAGG + Intergenic
979616596 4:122749767-122749789 TGTGTAACTGCTTATAGATAAGG - Intergenic
979665616 4:123307782-123307804 TGTGTATCTAAACATAGAAAAGG - Intronic
979807389 4:124991341-124991363 TGTTTTTCTGAATATAGACATGG + Intergenic
980049749 4:128027090-128027112 TGTGTATCTAATCATAGAAAAGG - Intronic
980199098 4:129631521-129631543 TGTGTATCTAAACATAGAAAAGG - Intergenic
980224037 4:129957779-129957801 TGTGTATCTAAACATAGAAAAGG - Intergenic
980510247 4:133775965-133775987 TGAGTATCTAAACATAGAAAAGG + Intergenic
980538217 4:134158733-134158755 TATGTACCAGAATATAAATATGG + Intergenic
980739672 4:136932838-136932860 TGGGTAAATGAATAAAGAAATGG + Intergenic
980765392 4:137296797-137296819 TGTGTATCTAAATATAGCAAAGG + Intergenic
980955487 4:139424429-139424451 TGTATATCTAAACATAGAAAAGG + Intergenic
981073122 4:140565961-140565983 TGTGTACCTAAAAATAGAAAAGG - Intronic
981125445 4:141100887-141100909 TGTGTATCTAAACATAGAAAAGG + Intronic
981148615 4:141354959-141354981 TGTGTATCTAGACATAGAAAAGG + Intergenic
981224984 4:142283648-142283670 TGTGTACCTAAACATGGAAAAGG + Intronic
981226013 4:142295068-142295090 AGGGTACCTGAATGTAGGAAGGG + Intronic
981269240 4:142824683-142824705 CTTGTATCTGAATAAAGAAATGG - Intronic
981296094 4:143133474-143133496 TGTTTACCTAAACATAGAAAAGG - Intergenic
981791017 4:148536356-148536378 TGTGTATCAAAACATAGAAAAGG - Intergenic
981973940 4:150700370-150700392 TGTATACCTAAACACAGAAAAGG + Intronic
982027724 4:151268222-151268244 TATGTATCTAAACATAGAAAAGG + Intronic
982049125 4:151482288-151482310 TGGGTAACAGAAAATAGAAAAGG - Intronic
982211766 4:153042853-153042875 TGTGTATCTAAACATAGAAAAGG - Intergenic
982624407 4:157748013-157748035 AGCATACCTGAATATGGAAATGG - Intergenic
982711973 4:158767367-158767389 TTTGTAACTGCATATAGAAGAGG - Intergenic
982772757 4:159413185-159413207 TGTGTATCTAACTGTAGAAAAGG - Intergenic
983122624 4:163906280-163906302 TATGTAACTGAATAAATAAATGG + Intronic
983151719 4:164291739-164291761 TGCATATCTAAATATAGAAAAGG + Intronic
983260117 4:165447064-165447086 TGTATATCTAAATATAGAAAAGG + Intronic
983261864 4:165466261-165466283 TGTGTATCTAAACATAGAAAAGG + Intronic
983327841 4:166282088-166282110 TGTGTATCTAAACAAAGAAAAGG - Intergenic
983421053 4:167517445-167517467 TGTGTAGCTAAACACAGAAAAGG + Intergenic
983463549 4:168057211-168057233 TGTGACCCTGAATGTACAAAAGG + Intergenic
983967198 4:173827233-173827255 TGTATAACTGATTATGGAAATGG - Intergenic
984304300 4:177967213-177967235 TATGTATCTAAACATAGAAAAGG - Intronic
984691271 4:182728693-182728715 TGTGTATCTAAACCTAGAAAAGG + Intronic
984697954 4:182798328-182798350 TGTGTATCTAAACATAGAAGAGG - Intronic
984740893 4:183161644-183161666 TGTGTAGCTAAACATAGAAAAGG - Intronic
984787162 4:183578318-183578340 TGTGTATCTAAACATAGAAAAGG - Intergenic
984914037 4:184704324-184704346 TGTGTATCTAAACATAGAAAAGG - Intronic
984979495 4:185265414-185265436 TGTGTATCTAAGTATAGAAAAGG + Intronic
985060652 4:186074390-186074412 TGTGTATCTAAACATAGAAAAGG + Intronic
985257683 4:188085763-188085785 TGTGTATCTAAACATAGAAAAGG + Intergenic
985294047 4:188415719-188415741 TGTGTACCCAAACATAGAAAAGG - Intergenic
985406543 4:189644345-189644367 TGTGTATCTAAACATAGAAAAGG - Intergenic
985928846 5:3039600-3039622 TGTGTATCTAAGAATAGAAAAGG - Intergenic
985983833 5:3496532-3496554 TTTGGACCACAATATAGAAAAGG + Intergenic
986098766 5:4586036-4586058 TGTGTATCTAAACATAGAAAAGG - Intergenic
986189513 5:5481765-5481787 TGTGTATCTAAACATAGAAAGGG - Intronic
986285814 5:6358137-6358159 TGTGTATCGCAACATAGAAAAGG - Intergenic
986495220 5:8334389-8334411 TGTTTACCTGAAGAGAGAGAAGG - Intergenic
986578681 5:9240312-9240334 TTTCTACCTGAATAGAGAACAGG + Intronic
986825593 5:11518671-11518693 TGTGTATCTAAACATAGTAAAGG - Intronic
987031232 5:13978612-13978634 TGTGTATCTAAACATAGAAAAGG - Intergenic
987289847 5:16498369-16498391 TGTGCATCTAAACATAGAAAAGG + Intronic
987603530 5:20103890-20103912 TGTGTACCTAAACATAGAAAAGG - Intronic
987824188 5:23007174-23007196 TGTGTATCTGAACATAGAAAAGG - Intergenic
987857219 5:23436323-23436345 TGTGTATCTCAACATAGAAAAGG - Intergenic
988006679 5:25421425-25421447 TGTGTATCTAAACATAGAAAAGG - Intergenic
988027508 5:25716314-25716336 TATGTTCCTGTAAATAGAAATGG + Intergenic
988791757 5:34614900-34614922 TGTATATCTAAACATAGAAAAGG - Intergenic
988842906 5:35100484-35100506 TGTGTATCTAAACATAGGAAAGG - Intronic
989005792 5:36810855-36810877 TGTATATCTAAACATAGAAAAGG + Intergenic
989016099 5:36936355-36936377 TGTGTATCTAAACATAGAAAAGG - Intronic
989038721 5:37203833-37203855 TGTGTACATGAATATTTGAATGG + Intronic
989190152 5:38662761-38662783 TGTGCAAATGAATACAGAAATGG - Intergenic
989273866 5:39564211-39564233 CGTGTTCCTGAATACAGAGATGG + Intergenic
989553402 5:42762160-42762182 TGTATATCTAAACATAGAAAAGG + Intronic
989791514 5:45408390-45408412 GGTGTATCTAAACATAGAAAAGG - Intronic
990086474 5:51984479-51984501 TGTGTATCTAAACACAGAAAAGG + Intergenic
990313574 5:54563389-54563411 TGTATATCTAAACATAGAAAAGG - Intergenic
990399244 5:55420891-55420913 AGTAAACCTGAATATAAAAAAGG + Intronic
990476605 5:56167349-56167371 TATGTATCTAAACATAGAAAAGG + Intronic
990480712 5:56207637-56207659 TGTGTATCTAAACATAGTAAAGG + Intronic
990484899 5:56248571-56248593 TTTTTACCTGAAAATAGACACGG - Intergenic
990813899 5:59761142-59761164 TGTATATCTAAACATAGAAAAGG + Intronic
990926750 5:61034444-61034466 TGTGTATCTAAACATAGAAAAGG + Intronic
991400779 5:66249239-66249261 TGTGTATCTAAACACAGAAAAGG + Intergenic
992224411 5:74605803-74605825 TGTGTATCTAAACATAAAAAAGG - Intergenic
992238879 5:74744243-74744265 TGTGTATCTCAACATAGAAAAGG + Intronic
992303765 5:75412685-75412707 TGTGAATCTAAACATAGAAAAGG + Intronic
992308691 5:75471349-75471371 TGTGTATCTAAAAATAGAAATGG + Intronic
992408084 5:76478620-76478642 TGTGTATCTAAACATAAAAAGGG - Intronic
992449892 5:76866607-76866629 TGTGTAGGTAAATATAGAAAAGG - Intronic
992517923 5:77514834-77514856 TGTGTATCTAAACATAGAAAAGG + Intronic
992519561 5:77536645-77536667 TGTGGACCTAAACATAGAAAAGG - Intronic
993346542 5:86790623-86790645 TATGTATCTAAAGATAGAAAAGG - Intergenic
993369707 5:87077235-87077257 TGTGTATCTAAACATAGAAAAGG - Intergenic
993734541 5:91460567-91460589 TGTGTATCTAAACATAGAAAAGG - Intergenic
993737637 5:91496986-91497008 TGTGGATCTAAACATAGAAAAGG + Intergenic
993969129 5:94395663-94395685 TGTGTACCTGATTGTCAAAAAGG - Intronic
993985975 5:94597854-94597876 TGTGTATCTAAACATAGAAAAGG + Intronic
994376676 5:99022662-99022684 TCTGTACCTGAATATATAGAAGG + Intergenic
994678761 5:102859806-102859828 TGTGTATCTAAACATAGAAAAGG - Intronic
994788814 5:104198486-104198508 TGTGTATCTAAACATACAAAAGG + Intergenic
994820062 5:104637812-104637834 TGTGTATCTAAACATAGAAATGG - Intergenic
994820876 5:104649847-104649869 TGTGTATCTAAACATAGAAAAGG + Intergenic
994853089 5:105081886-105081908 AGTGTATCTAAACATAGAAAGGG - Intergenic
994997665 5:107084875-107084897 TGTTTACATTAATATGGAAAAGG + Intergenic
995058832 5:107792135-107792157 TGTGCATCTAAACATAGAAAAGG + Intergenic
995103586 5:108347271-108347293 TCTGTATCTAAACATAGAAAAGG + Intronic
995176661 5:109185962-109185984 TGTGTATCTAGACATAGAAAAGG + Intronic
995262033 5:110115443-110115465 TGTCTATCTAAATATAGAGAAGG - Intergenic
995300869 5:110580306-110580328 TGTGTCTCTAAACATAGAAAAGG - Intronic
995469615 5:112487068-112487090 TGTGTATCTAAACATACAAAAGG + Intergenic
995702526 5:114952518-114952540 TGTGTATCTAAATATAGAAGAGG + Intergenic
995720697 5:115129026-115129048 TGTGTATCTAAACATAGAAAAGG - Intronic
996277633 5:121686670-121686692 TGTGTACAAGAACAAAGAAATGG + Intergenic
996628849 5:125603403-125603425 TGTATATCTAAACATAGAAAAGG + Intergenic
997109304 5:131057452-131057474 TGTGTATCTAAACATAGAAAAGG + Intergenic
997517163 5:134498534-134498556 TGTGTATCTAAACACAGAAAAGG + Intergenic
997547373 5:134720252-134720274 TGTGTATCTAAACATAGGAAAGG - Intronic
998298360 5:140993718-140993740 TGTGTATCTAAACATAGAAAAGG - Intronic
998467818 5:142359654-142359676 TGTGTATCTAAACATAGAAAAGG - Intergenic
998578032 5:143338952-143338974 TATGTATCTAAACATAGAAAAGG - Intronic
998615813 5:143739098-143739120 TGTGTATCTAAACATAGAAAAGG + Intergenic
998674185 5:144388921-144388943 TGTGTATATGAATATATAAGAGG + Intronic
999077533 5:148810903-148810925 TGTGTAGCTAAACATAGAAAAGG + Intergenic
999330200 5:150668615-150668637 TGTGTATCTGATTTTAGAGATGG + Intronic
999437722 5:151576979-151577001 TGTGTATCTAAACATAGAAAAGG + Intergenic
999845337 5:155473402-155473424 TGTGTATCTAAACATAAAAAAGG + Intergenic
999883520 5:155893950-155893972 TGTATATCTAAAAATAGAAAAGG + Intronic
1000016091 5:157277983-157278005 TGTGTATCTAAACATAGAAAAGG + Intronic
1000078263 5:157815848-157815870 TTTGTATCTAAACATAGAAAAGG + Intronic
1000372026 5:160546218-160546240 TGTGTATCTAAACATAGAAAAGG + Intergenic
1000471273 5:161645156-161645178 TGTCTACCTGAATATACATATGG - Intronic
1000880206 5:166688615-166688637 TGCGTACCTAAATATAGAAAAGG - Intergenic
1000964934 5:167645048-167645070 TCTGTATCTGAACACAGAAAAGG + Intronic
1001013229 5:168117400-168117422 TGTGTACCTGAAACCACAAATGG + Intronic
1001060043 5:168480362-168480384 TGTGTTTCTAAACATAGAAAAGG + Intergenic
1001609152 5:172986012-172986034 TGTGTATCTAAACATAGAAAAGG + Intronic
1001702757 5:173719503-173719525 TGTGTACATGTATATAGAGGTGG + Intergenic
1001826909 5:174752402-174752424 TGTGTATCTAAACATAGAAAAGG + Intergenic
1002667467 5:180835992-180836014 TGTGTATCTAACCATAGAAAAGG - Intergenic
1002763964 6:223898-223920 TGTGTATCTAAACAGAGAAAAGG + Intergenic
1002855232 6:1030616-1030638 TCTGAACCTGAAGATACAAAAGG + Intergenic
1002871948 6:1174720-1174742 TGTGTATCTCAACATAGAAAAGG - Intergenic
1002963218 6:1937047-1937069 GGTGTATCTAAACATAGAAAAGG - Intronic
1003210510 6:4060187-4060209 TATGTATCTAAACATAGAAAAGG + Intronic
1003291662 6:4784699-4784721 TGTGTATCTAAACATAGAAAAGG - Intronic
1003721239 6:8704896-8704918 TGTGTATTTAAACATAGAAAAGG - Intergenic
1003752197 6:9071469-9071491 TGTGCATCTAAACATAGAAACGG - Intergenic
1004112846 6:12737261-12737283 TGTGTATCTAAATATAGAAAAGG + Intronic
1004342259 6:14818020-14818042 TGTTTATCTAAATATAGAAAAGG - Intergenic
1004891390 6:20104039-20104061 TGTGTATCTAAACATAGAGAAGG - Intronic
1005094217 6:22095125-22095147 TGTGTGTCTAAACATAGAAAAGG - Intergenic
1005224415 6:23624559-23624581 TGTGTATCTTAACATAGAAAAGG + Intergenic
1005229197 6:23680811-23680833 TGTGTATCTAAACATAGGAAAGG + Intergenic
1005267273 6:24125651-24125673 TGTGTGTCTAAACATAGAAAAGG - Intergenic
1005593680 6:27355576-27355598 TGTGTATCTAAATATTAAAAAGG - Intergenic
1005698183 6:28371205-28371227 TGTGTATCTAAACATAGAAAAGG - Intergenic
1005710662 6:28501096-28501118 TGTGTACCTAAATAGAAATATGG - Intergenic
1006256477 6:32836683-32836705 TGTGTATCTAAACATAGAAAAGG + Intronic
1006353596 6:33540166-33540188 TGTGTATCTAAACATAGAAAAGG + Intergenic
1006354797 6:33548950-33548972 TGTGTATCTAAACATGGAAAAGG - Intergenic
1006754742 6:36405801-36405823 TGTGTATCTAAACATAGAAAAGG - Intronic
1006953996 6:37850532-37850554 TGTGTATCTAAACATAGCAATGG - Intronic
1006960276 6:37922730-37922752 TGTGTATCTAAACATAGAAAAGG + Intronic
1006964552 6:37969129-37969151 TGTGTGTCTAAACATAGAAAAGG + Intronic
1007050934 6:38828469-38828491 TGTGTATCTAAATATAGAAAAGG - Intronic
1007353053 6:41288979-41289001 TGTGTATCTAAACATAGAAGAGG + Intergenic
1007672046 6:43563714-43563736 TGTGTATCTAAATACAGAAAAGG + Intronic
1007799827 6:44382743-44382765 TGTGTATCTAAATACAGAAAAGG - Intergenic
1007849069 6:44786393-44786415 TTTTTACTGGAATATAGAAAGGG + Intergenic
1008046055 6:46852385-46852407 TTTGAACCTCAATAAAGAAATGG + Intergenic
1008230238 6:48978100-48978122 TGTGTATCTAAACATAGAAAAGG + Intergenic
1008273163 6:49513450-49513472 TCTGAATCTGAATATTGAAAGGG + Intronic
1008593934 6:53022381-53022403 TGTGTATCTAAACATAGAAAAGG - Intronic
1008695785 6:54034949-54034971 TGTGTATCTAAACATAGAAAAGG - Intronic
1008708125 6:54188061-54188083 TATGTATCTAAACATAGAAAAGG + Intronic
1008802247 6:55383461-55383483 TGTGTACCTAAACATAGAGAAGG - Intronic
1009306402 6:62095412-62095434 TGTGTATCTAAACATAGAAAAGG - Intronic
1009445693 6:63739575-63739597 TGAGTACCTCCATTTAGAAAGGG + Intronic
1009607305 6:65888506-65888528 TGTGTGACTGAATATATAAATGG - Intergenic
1009757648 6:67960120-67960142 TGTGTTCATAAATATAGAAGTGG + Intergenic
1010035582 6:71321794-71321816 TGTGAAGCTGAATCTAAAAAAGG - Intergenic
1010309632 6:74369724-74369746 TGTGTATCTAAACATAGAAAAGG - Intergenic
1010688934 6:78886174-78886196 TATCTGCCTGAAGATAGAAACGG - Intronic
1011399659 6:86946314-86946336 TGTGTATCTAAACGTAGAAAGGG - Intronic
1011451960 6:87502591-87502613 AGCGTACCTAAACATAGAAAAGG + Intronic
1011716056 6:90106394-90106416 TGTGTATCTAAACATAGAAAAGG - Intronic
1011763240 6:90591295-90591317 TGTGTATCTAAACATAGAAAAGG - Intergenic
1011847135 6:91580154-91580176 AGTGTATCTAAAGATAGAAAAGG + Intergenic
1012114877 6:95284479-95284501 TGTGTATCTAAACATGGAAAAGG - Intergenic
1012178380 6:96119285-96119307 TGTATATCTAAACATAGAAAAGG - Intronic
1012286648 6:97398307-97398329 TGTGTATCTAAACATAGAAAAGG + Intergenic
1012364842 6:98426015-98426037 TGTGTACCTGAATGGAAGAAAGG + Intergenic
1013097781 6:106961646-106961668 TGTGTATCTCAACATAGAAAAGG - Intergenic
1013330023 6:109091177-109091199 TGTGTATCTAAACATAGAAAAGG - Intronic
1013415312 6:109919558-109919580 TGTGTATCTAAACATAGAAAAGG + Intergenic
1013446052 6:110228142-110228164 TGTGTATCTAAACATAGAAAAGG + Intronic
1013471573 6:110471177-110471199 TGTGTACCTAAACATGGAAAGGG - Intronic
1013550043 6:111198614-111198636 TGTGTATCTAAACATGGAAAAGG + Intronic
1013717556 6:112980660-112980682 TGTGTATGTAAACATAGAAAAGG - Intergenic
1013774252 6:113661692-113661714 TGTGTATCTAAACATAGAAAAGG - Intergenic
1013835874 6:114334566-114334588 TGTGTATCTAAACATAGAAAAGG - Intronic
1013968769 6:115989484-115989506 TGGGTACATGAACATAAAAATGG - Intronic
1014640472 6:123903475-123903497 TATCTACTTGAATATACAAAAGG - Intronic
1014768784 6:125437549-125437571 TGATTACCTGAACAAAGAAAAGG + Intergenic
1014769117 6:125441293-125441315 TGTGTATCTAAACATAGAAAAGG - Intergenic
1015099498 6:129459231-129459253 TGTGTACCTAAACATAAACAAGG + Intronic
1015331132 6:131980517-131980539 TGTGTATCTAAACATAAAAAAGG + Intergenic
1015644668 6:135373239-135373261 TGTGTATCTAAACATAGAAAAGG - Intronic
1015695801 6:135978248-135978270 TGTGTATCTAAACATAGAAAAGG + Intronic
1015752749 6:136576839-136576861 TGTGTGTCTGAACATACAAAAGG - Intronic
1015781217 6:136868043-136868065 TCTGTATCTAAACATAGAAAAGG - Intronic
1015826809 6:137322279-137322301 TGTGTTACTGAATAGTGAAACGG - Intergenic
1015913981 6:138196430-138196452 TGTGTAACTAAACATAGAAAAGG + Intronic
1015923100 6:138284950-138284972 TGTGTATCTAAACATAGAAAAGG + Intronic
1015942739 6:138468259-138468281 TGTGTATCTGAACCTAGGAAAGG - Intronic
1015958488 6:138622641-138622663 TGTGTACCTGAATTTCAGAAGGG + Intronic
1016105274 6:140154655-140154677 TGTGTATCTAAACATAGATAAGG - Intergenic
1016592336 6:145760467-145760489 TGTGTATCTAAACATAGAAAAGG - Intergenic
1016720631 6:147293028-147293050 TGTGTATATAAACATAGAAAAGG - Intronic
1016780738 6:147954996-147955018 TGTGTATCTAAATATAGAAAAGG - Intergenic
1017133048 6:151124266-151124288 TGTGTATCTAAACATAGAAAAGG - Intergenic
1017634315 6:156428877-156428899 TGTGTATCTAAGCATAGAAAAGG + Intergenic
1017671688 6:156775714-156775736 TATGTATTTGAATATATAAAGGG + Intergenic
1017875137 6:158517893-158517915 TTTGTATCTAAACATAGAAAAGG + Intergenic
1018033215 6:159860419-159860441 TGTGTATCTAGACATAGAAAAGG + Intergenic
1018191983 6:161317155-161317177 TGTGCATCTAAACATAGAAAAGG - Intergenic
1018355577 6:163011400-163011422 TGTGTATCTAAACATAGAAAAGG + Intronic
1018527802 6:164733599-164733621 TGTGTATCTAAACATAGAAAAGG - Intergenic
1018631025 6:165822568-165822590 TGTGTATCTAAACATAGAAAAGG + Intronic
1018675539 6:166219115-166219137 TGGGTAACTGAACAAAGAAAAGG - Intergenic
1020209904 7:6151075-6151097 TGTGTATCTAAACATAGAAAAGG + Intronic
1020384151 7:7579476-7579498 TGAGTACCTAAACACAGAAAAGG - Intronic
1020412200 7:7904921-7904943 TGTGTATCTAAACATAGAAAAGG - Intronic
1020491144 7:8785773-8785795 TATGGACATGAATAAAGAAAAGG + Intergenic
1020504869 7:8972781-8972803 AATGTACCTGAATATAATAAAGG - Intergenic
1020505767 7:8985906-8985928 TGTGTATCTAAACATAGAAAAGG + Intergenic
1021281453 7:18724384-18724406 TGTGTATATAAACATAGAAAAGG + Intronic
1021615192 7:22496583-22496605 TGTGTATCTGAACATAGAAAAGG - Intronic
1021751385 7:23804219-23804241 TGTGTCTCTGAATAAATAAAAGG - Intronic
1021799753 7:24293174-24293196 TTTGTATCTAAACATAGAAAAGG - Intergenic
1022021307 7:26401515-26401537 TATGTATCTAAATGTAGAAAAGG + Intergenic
1022058242 7:26763887-26763909 TGTGTATCTAAACATGGAAAAGG + Intronic
1022067470 7:26874275-26874297 TGTGTATCTAAACATAGAAAAGG + Intronic
1022193689 7:28042713-28042735 TGTGTATCTAAACATAGAAAAGG - Intronic
1022573270 7:31473903-31473925 TTTATACATGTATATAGAAAGGG - Intergenic
1022685561 7:32593111-32593133 TGTGTTTCTAAACATAGAAAAGG + Intergenic
1022725464 7:32977498-32977520 TGTGTATCTAAACATAGAAAAGG + Intronic
1022883082 7:34610851-34610873 TGTGTATCTAAACATAGAAAAGG - Intergenic
1023007772 7:35891511-35891533 TGTGTATCTAAACATAGAAAAGG + Intronic
1023015049 7:35958981-35959003 TGTGTATCTAAACATAGAAAAGG + Intergenic
1023223674 7:37947206-37947228 TATGTATCTAAACATAGAAAAGG - Intronic
1023281171 7:38572247-38572269 TGTGTATCTAAACATAGAAAAGG - Intronic
1023669115 7:42557529-42557551 TGTGTACTTGAATCTAGAGCTGG - Intergenic
1023786292 7:43711780-43711802 TGTGTATCTAAACACAGAAAAGG + Intronic
1023952077 7:44854390-44854412 TGTATACCTAAACATAGAAAAGG + Intergenic
1024065897 7:45735719-45735741 TGTGTATCTAAACATAGAAAAGG - Intergenic
1024102460 7:46046507-46046529 TGTGTAGCTATATATAGATATGG + Intergenic
1024366507 7:48526703-48526725 TGTGTATCTAAACATAGACAAGG + Intronic
1024903992 7:54354986-54355008 TGTGGCCCTGAATACAGAATAGG - Intergenic
1025217094 7:57067209-57067231 TGTGTATCTAAACATAGAAAAGG - Intergenic
1025628017 7:63240850-63240872 TGTGTATCTAAACATAGAAAAGG - Intergenic
1025654250 7:63503254-63503276 TGTGTATCTAAACATAGAAAAGG + Intergenic
1026353221 7:69535476-69535498 TGGGTTCCTGAACATAGAATAGG + Intergenic
1027330019 7:77082475-77082497 TGTATATCTATATATAGAAAAGG - Intergenic
1027382914 7:77630546-77630568 TGTGTATCTAAACATAGAAAAGG + Intronic
1027501876 7:78962010-78962032 TGTGTATCTAAACATAGAAAAGG + Intronic
1027572523 7:79888374-79888396 TGTGTCTCTGAACATATAAAAGG - Intergenic
1027798679 7:82724617-82724639 TGTGTTTCTAAACATAGAAAAGG + Intergenic
1027939850 7:84663280-84663302 TGTGTATCTAAACATATAAAAGG - Intergenic
1028196969 7:87918724-87918746 TATGTATCTAAACATAGAAATGG - Intergenic
1028231225 7:88308185-88308207 TGTGTATCTAAGCATAGAAAAGG + Intergenic
1028239441 7:88401523-88401545 TGTGCATCTAAACATAGAAAAGG + Intergenic
1028377304 7:90158047-90158069 TGTGTATCTGAACATAGAAAAGG + Intronic
1028420792 7:90630390-90630412 TGTGTATCTAAACATAGGAAAGG + Intronic
1028438877 7:90835951-90835973 TGTATATCTAAATGTAGAAAAGG + Intronic
1028601380 7:92604217-92604239 TGTGTATCTAAACATAGAAAAGG - Intergenic
1028866937 7:95724526-95724548 TGTGTATCTAAACATAGAAGAGG - Intergenic
1028879647 7:95865667-95865689 TGTGTATCTAAAAATAGAAAAGG - Intronic
1028977276 7:96928169-96928191 TGTGTATCCAAACATAGAAAAGG - Intergenic
1029785749 7:102788866-102788888 TGTATATCTATATATAGAAAAGG + Intronic
1029821053 7:103148098-103148120 AATGTAACTGAAAATAGAAATGG + Intronic
1029980173 7:104871290-104871312 TGTGTATCTAAACATAGAAAAGG + Intronic
1030042209 7:105461869-105461891 TGTGCATCTAAACATAGAAAAGG + Intronic
1030276866 7:107730563-107730585 TGTGTATCTAAACACAGAAAAGG + Intergenic
1030500988 7:110358111-110358133 TGTATATCTAAACATAGAAAAGG + Intergenic
1030507500 7:110443398-110443420 TGTGAACCTGAAAATTGGAAGGG + Intergenic
1030536606 7:110774629-110774651 TGTGCATCTAAACATAGAAAAGG - Intronic
1030578131 7:111316094-111316116 TGTGTATCTAAACATAAAAAAGG + Intronic
1030667111 7:112291219-112291241 TGTGGAATTTAATATAGAAAAGG - Intronic
1030720012 7:112860085-112860107 TGTGTATCTAAACATAGAAAAGG - Intronic
1030724209 7:112906277-112906299 TGTGTATCTAAACATAGAAAAGG + Intronic
1030943752 7:115690286-115690308 TGTGAACCTGTATAAAGAATAGG - Intergenic
1031155783 7:118109950-118109972 TGTGTATCTAAACATAGAAAAGG + Intergenic
1031432710 7:121692386-121692408 TGTGTATCTAAACATAGGAAAGG - Intergenic
1031936965 7:127745310-127745332 TGTGTATCTAAACATAGAAAAGG + Intronic
1031939671 7:127774908-127774930 TGTGTAACTAAACATAGAAAAGG - Intronic
1032154568 7:129457346-129457368 TGTGTATCTCAACCTAGAAAAGG + Intronic
1032158851 7:129494461-129494483 TGTGTATCTAAACATAGAAAAGG + Intergenic
1032620887 7:133530492-133530514 TGTGTATATAAACATAGAAAAGG + Intronic
1032867773 7:135945074-135945096 TGTGTATCTAAACATAGAAAAGG + Intronic
1032908654 7:136403637-136403659 TGTGTATCTAAACATAGAAAAGG - Intergenic
1033300563 7:140180879-140180901 TGTGTTTCTAAATATAGAAAAGG + Intergenic
1033379682 7:140803013-140803035 TGTGTATCTAAACGTAGAAAAGG - Intronic
1033426416 7:141248631-141248653 TGTATATCGAAATATAGAAAAGG + Intronic
1034279254 7:149840672-149840694 TGCGTATCTAAACATAGAAAAGG - Intronic
1034780550 7:153876885-153876907 TGTATATCTAAACATAGAAAAGG + Intergenic
1035164285 7:156975674-156975696 TGTGTGTCTAAACATAGAAAAGG - Intergenic
1035340161 7:158155373-158155395 TGTGTACCTTCATATATACATGG - Intronic
1035914695 8:3606433-3606455 AGTATACCTAAACATAGAAAAGG + Intronic
1035952289 8:4036012-4036034 TGTGTCTCTAAACATAGAAAAGG - Intronic
1036116425 8:5965311-5965333 TGTGTATCTAAACATAGAAAAGG - Intergenic
1036347131 8:7974145-7974167 TGTGTACCAGAAAAGAGAGATGG + Intergenic
1036535581 8:9647989-9648011 TGTTTATCTAAACATAGAAAAGG + Intronic
1036596906 8:10221387-10221409 TATGTAGCTTAATATAGACATGG - Intronic
1036630109 8:10507010-10507032 TGTGTATCTAAACATAGAGAAGG + Intergenic
1036803794 8:11813112-11813134 TGTGTATTTAAACATAGAAAAGG + Intronic
1037330969 8:17743343-17743365 TGTGTACATAAATATACAATTGG - Intronic
1037493271 8:19415934-19415956 TGTGTATCTGAACATAGAAAAGG + Intronic
1038415783 8:27394414-27394436 TGTGTATCTAAACATAGGAAAGG + Intronic
1038628060 8:29213644-29213666 TGTGTATCTAAACATAGAAAAGG + Intronic
1038752519 8:30309326-30309348 TTTATACCTGAATATAAATATGG + Intergenic
1039332583 8:36554810-36554832 TGTGTACCGGAACAGAGGAAGGG + Intergenic
1039598663 8:38814424-38814446 TGTGTATCTAAACACAGAAAAGG - Intronic
1039669021 8:39574882-39574904 TTTGGAAGTGAATATAGAAAGGG - Intergenic
1039933932 8:42023120-42023142 TGAGTATCTAAACATAGAAAAGG + Intronic
1040524003 8:48202590-48202612 TGTGTATCTAAACATAGAAAAGG + Intergenic
1040830446 8:51670531-51670553 TGTGTATCTAAACATAGATAAGG + Intronic
1041144843 8:54863222-54863244 TGTGTTTCTAAACATAGAAAAGG - Intergenic
1041148571 8:54907264-54907286 TGTGTATTTAAACATAGAAAAGG - Intergenic
1041410530 8:57549203-57549225 TGTGTATCTAAACATAGAAAAGG - Intergenic
1041503566 8:58567846-58567868 TGTGTATCTAAACACAGAAAAGG + Intronic
1041532617 8:58888090-58888112 TGTGTATCTAAACATAGAAAAGG + Intronic
1041677618 8:60551207-60551229 TGTGTACATGTATACAGAAGAGG - Intronic
1041788019 8:61657505-61657527 TGTGTATCTAAACACAGAAAAGG + Intronic
1041985062 8:63911830-63911852 AGTATATCTAAATATAGAAAAGG - Intergenic
1042041268 8:64593015-64593037 TGTGTACAGGAATTTAGAAATGG - Intronic
1042317644 8:67440757-67440779 TGTGTATCTAAACATGGAAAAGG + Intronic
1042660282 8:71147361-71147383 TGTATATCTAAACATAGAAAAGG - Intergenic
1042925075 8:73959022-73959044 TGTGTATCTAAACATAGAAAAGG + Intronic
1044187635 8:89274659-89274681 AGAATACCTGAGTATAGAAAAGG - Intergenic
1044246780 8:89957690-89957712 TGTGTATCTAAACATAGAAAAGG - Intronic
1044405928 8:91825985-91826007 TATGTATCTAAATGTAGAAAAGG + Intergenic
1044733984 8:95258777-95258799 TGTGTATCTAAATATTAAAAAGG - Intronic
1044957797 8:97499709-97499731 TGTATACCTAAACACAGAAAAGG + Intergenic
1044974359 8:97649033-97649055 TGTGTATCTAAACATAGAAAAGG - Intronic
1045127099 8:99104234-99104256 TGTGTATCTAAAAACAGAAAAGG + Intronic
1045149355 8:99386544-99386566 TGTATATCTAAACATAGAAAAGG + Intronic
1045216326 8:100152331-100152353 TGTATATCTGAACATAGAAAAGG + Intronic
1045224006 8:100226941-100226963 TGTGTATCTAAACACAGAAAAGG - Intronic
1045247151 8:100453009-100453031 TGTGTATCTAAATATGAAAAAGG + Intergenic
1045267141 8:100628941-100628963 TGTGTATCTAAACATAGAAAAGG - Intronic
1045312176 8:101012666-101012688 TGTGCACCTAAACATAGAAAGGG - Intergenic
1045444385 8:102245219-102245241 TGTGTATCTAAACATAGAAAAGG - Intergenic
1045514686 8:102848034-102848056 TGTGTATCTAAACATAGAAAAGG - Intronic
1045688640 8:104737484-104737506 TGTGTATCTAAACATAGAAAAGG + Intronic
1046083270 8:109398573-109398595 TTTTTATGTGAATATAGAAATGG - Intronic
1046601003 8:116316581-116316603 TGTGTATCTGAACACAGGAAAGG + Intergenic
1046650647 8:116833560-116833582 TGTGTGCATCATTATAGAAATGG + Intronic
1047067439 8:121301125-121301147 CGAGTACATGAATACAGAAAGGG + Intergenic
1047384660 8:124397743-124397765 TGTATATCTAAACATAGAAAAGG + Intergenic
1047974351 8:130114366-130114388 TGTGTATCTAAACATAGAAGAGG + Intronic
1048085781 8:131177664-131177686 TGTGTATCTAAACGTAGAAAAGG + Intergenic
1048171734 8:132113288-132113310 TGTGTATCTAAACATAGAAAAGG + Intergenic
1048761698 8:137802621-137802643 TGTGTATCTAAACACAGAAAAGG + Intergenic
1049141370 8:140957702-140957724 TGTGTATCTAAACATAGAAAAGG - Intronic
1049430079 8:142558226-142558248 TGTGTAGCTAAACATAGAAAAGG + Intergenic
1050533959 9:6614933-6614955 TGTGTTTCTAAATACAGAAAAGG + Intronic
1050577947 9:7018248-7018270 CGTGTACCTAAACATAGAAAAGG + Intronic
1051075231 9:13225600-13225622 TGTGTTTCTAAATATAGAAAAGG - Intronic
1051263937 9:15293119-15293141 TGTGTATCTAAACATAGAAAAGG - Intronic
1051647355 9:19281879-19281901 TGTATATCTAAACATAGAAAAGG + Intronic
1052387825 9:27842984-27843006 TGCCTTCCTGAATATAGAACAGG - Intergenic
1052472748 9:28920708-28920730 TGTGTATCTGGATATAACAAAGG - Intergenic
1052617994 9:30867769-30867791 TGTGTATCTAAACATAGAAAAGG + Intergenic
1052623158 9:30940639-30940661 TTTGTGTCTAAATATAGAAAAGG + Intergenic
1052807219 9:33024352-33024374 TGTGTCCCTGGATAAAGAAGCGG + Intronic
1053030371 9:34771375-34771397 TGTATGCCTGAACATAGAAAAGG + Intergenic
1053177156 9:35935284-35935306 TGTGTATCTAAACATAGAAAAGG - Intergenic
1053651333 9:40172921-40172943 TTTGAACCTCAATAAAGAAATGG - Intergenic
1053901726 9:42802274-42802296 TTTGAACCTCAATAAAGAAATGG - Intergenic
1054533247 9:66203282-66203304 TTTGAACCTCAATAAAGAAATGG + Intergenic
1054788942 9:69236689-69236711 TGTGTACCTGCATATCAGAATGG + Intronic
1055307402 9:74944006-74944028 TAAATACCTGAATAAAGAAATGG + Intergenic
1055396151 9:75877355-75877377 TGTGTATCTAAACATAAAAAAGG + Intergenic
1055426166 9:76199309-76199331 TGTGTGTCTAAACATAGAAAAGG + Intronic
1055464808 9:76554047-76554069 TGTGTATCTAAAGATAGAAAAGG + Intergenic
1056122857 9:83506503-83506525 TGTGTATCTAAACATAGAAAAGG + Intronic
1056186328 9:84138536-84138558 TGTGTATCTAAACATAGAAAAGG - Intergenic
1056289393 9:85127485-85127507 TGGGTACCTCAATATTTAAAGGG - Intergenic
1056748519 9:89326862-89326884 TGTGTATCAAAATATAGAAAAGG + Intronic
1057010079 9:91592898-91592920 TGTGTATCTAAACATAGAAAAGG - Intronic
1057568601 9:96186184-96186206 TGTGTATCTAAACATAGAAGAGG - Intergenic
1058434355 9:104948668-104948690 TGTGTATCTAAACATAGAAAAGG + Intergenic
1058488947 9:105474251-105474273 TGTGTATCTCAACATAGAAAGGG + Intronic
1058662429 9:107279086-107279108 TGTGTATCTAAACATAGAAAAGG - Intergenic
1058840704 9:108905839-108905861 TGTGTATCTAAACATAGAAAAGG + Intronic
1058990186 9:110248383-110248405 TGTGTATCTAAACATAGAAAAGG - Intronic
1059066152 9:111086807-111086829 TGTGTATCTAAGCATAGAAAAGG + Intergenic
1059183357 9:112241526-112241548 TGTGTATCTAAACATAGAAAGGG - Intronic
1059230287 9:112714991-112715013 TGTGTATCTCAACATAGAAAAGG + Intronic
1059397417 9:114046328-114046350 TGTGTATCTGAACATAAAAAAGG - Intronic
1059631616 9:116130176-116130198 AGAGTACCTCAATACAGAAAAGG + Intergenic
1060129621 9:121082667-121082689 TGTGCATCTAAACATAGAAAAGG + Intronic
1060255800 9:122029900-122029922 TTTGTATCTAAACATAGAAAGGG - Intronic
1060357522 9:122923898-122923920 TGTGTATCTAAATATAGAAGAGG - Intronic
1060533808 9:124366769-124366791 TGTGTATCTAAACATATAAATGG - Intronic
1060707063 9:125812846-125812868 TGTGTATCTAAACATAGAAAAGG + Intronic
1061383203 9:130271874-130271896 TGTTTAGCTTAATATAGACACGG - Intergenic
1203532633 Un_GL000213v1:161761-161783 TGTTTACCAGAACAAAGAAAAGG - Intergenic
1203657626 Un_KI270753v1:13810-13832 TGTGTATCTAAACATAGAAAAGG - Intergenic
1185579608 X:1201112-1201134 TGTGTATCTAAACATAGAGAAGG + Intronic
1186185554 X:7016509-7016531 TGTGTACCCCATTATTGAAATGG - Intergenic
1186319462 X:8408539-8408561 TGGGTATCTAAATATGGAAAAGG - Intergenic
1186615672 X:11185030-11185052 TGTGTATCTAAATATAGTAAAGG + Intronic
1186621352 X:11243787-11243809 TATGTATCTAAACATAGAAAAGG - Intronic
1186786280 X:12958766-12958788 TGTGTATCTAAAATTAGAAAAGG + Intergenic
1187395088 X:18912442-18912464 TGTGTGTCTAAACATAGAAAAGG + Intronic
1187445013 X:19353393-19353415 TGTGTACCTAAACGTAGAAAAGG - Intronic
1188318467 X:28706179-28706201 TATGTATCTAAACATAGAAAAGG - Intronic
1188351145 X:29132394-29132416 TGTGTATCTAAACATAGAAAAGG - Intronic
1188391082 X:29620448-29620470 TGTGTATCTAAACATAGAAAAGG + Intronic
1188442500 X:30226773-30226795 TGTGTACCTAAACACAGAAAAGG - Intergenic
1188716976 X:33471490-33471512 TGTGTACCTAAGAATAGAACTGG - Intergenic
1188950278 X:36363427-36363449 TGTGTACCTAAACACAGAAAAGG + Intronic
1188950861 X:36372653-36372675 TGTATACCTAAACACAGAAAAGG + Intronic
1189075937 X:37914400-37914422 TGTGTTCTTGCATAGAGAAATGG - Intronic
1189428598 X:40927029-40927051 TGTTTATCTAAACATAGAAAAGG - Intergenic
1189454547 X:41173989-41174011 TGTGTATTTAAACATAGAAAGGG - Intronic
1189457341 X:41204666-41204688 TGTGCATCTAAAAATAGAAAAGG - Intronic
1189469554 X:41303058-41303080 TGTGTAACAGGATATAAAAATGG - Intergenic
1189521535 X:41773745-41773767 TGGGTATCTAAACATAGAAAGGG + Intronic
1189641316 X:43074860-43074882 TCTCTTCCTGAAAATAGAAAAGG - Intergenic
1189650668 X:43185876-43185898 TGTGTATCTAAACCTAGAAAAGG + Intergenic
1189789159 X:44587114-44587136 TGTGTAGCTAAACATAGAAAAGG + Intergenic
1190436973 X:50435091-50435113 TGTGTATGTAAACATAGAAAAGG + Intronic
1190994198 X:55589479-55589501 TGTGTATCTAAACATGGAAAAGG - Intergenic
1191011545 X:55764588-55764610 TGTGTATCTAAATATAGAAAAGG - Intergenic
1191056545 X:56247246-56247268 TGTGTATCTAAACATAGAAAAGG + Intronic
1191726980 X:64291964-64291986 TGTGGGCCTGAATAGAAAAAGGG + Intronic
1191801797 X:65089360-65089382 TGTGTATCTAAACATAGAAAAGG + Intergenic
1191890375 X:65933302-65933324 TGTGTATCTAAATATAGAAAAGG + Intergenic
1191963343 X:66727882-66727904 TGTGTATCTAAACGTAGAAAAGG + Intergenic
1192374336 X:70543974-70543996 TGTGTATCTAAACATAGAAATGG + Intronic
1192569928 X:72194882-72194904 TGGGTATCTAAACATAGAAAAGG - Intronic
1192861156 X:75072524-75072546 TGTGTATCTAAACACAGAAAAGG + Intronic
1193089555 X:77479694-77479716 TGTGTATCTAAACATAGCAAAGG + Intergenic
1193237671 X:79129358-79129380 TGTGTATCTAAACATAGAAAAGG - Intergenic
1193371593 X:80704867-80704889 TGGATACCTAAGTATAGAAAAGG + Intronic
1194063726 X:89236871-89236893 TTTGTATCTAAATATAGAATGGG + Intergenic
1194225261 X:91248817-91248839 CGTGTTCCTGAACTTAGAAAAGG + Intergenic
1194314830 X:92364386-92364408 TGTGTATCTAAACATAGAAAAGG + Intronic
1195070171 X:101271475-101271497 TGTGTATCTAAACATAGAAAAGG + Intronic
1195178366 X:102332976-102332998 TGTGTATCTAAACATAGAAGAGG - Intergenic
1195180498 X:102354107-102354129 TGTGTATCTAAACATAGAAGAGG + Intergenic
1195498995 X:105572100-105572122 TGTGTACCTAATTATATAATAGG + Intronic
1195569835 X:106385729-106385751 TGTGGGCCTGAATAGAAAAAGGG - Intergenic
1195859246 X:109363623-109363645 TGTGTATCCAAACATAGAAAAGG + Intergenic
1195979536 X:110562335-110562357 TGTGTAGCTAAACATAGAAAAGG - Intergenic
1196238341 X:113308999-113309021 TATGTATCTAAACATAGAAAAGG - Intergenic
1196362777 X:114885257-114885279 TGTGTATCTAAACATAGAAAAGG - Intronic
1196555133 X:117076994-117077016 AGTGTACAGGAATACAGAAAAGG + Intergenic
1197945459 X:131834157-131834179 TGTGTATCTAAACATAGAAAAGG + Intergenic
1198195055 X:134351714-134351736 TGTATATCTAAACATAGAAAAGG - Intergenic
1198713957 X:139535998-139536020 TGTGTATCTAAACATAGAAAAGG + Intronic
1198824004 X:140680242-140680264 TGTGTATCTAAACATAAAAAAGG + Intergenic
1199281962 X:146011943-146011965 TTTGTATCTCAACATAGAAAAGG - Intergenic
1199752794 X:150836864-150836886 TGTGTATCTAAACACAGAAAAGG + Intronic
1200171245 X:154076781-154076803 TGTATATCTAAACATAGAAAAGG + Intronic
1200274633 X:154720094-154720116 TGTGTATCTAAACATAGAAAAGG - Intronic
1200283273 X:154796725-154796747 TGTGTACCTTAATATTGTCATGG - Intronic
1200312745 X:155095813-155095835 TGTGTATCTAAACACAGAAAAGG - Intronic
1200561730 Y:4712122-4712144 CGTGTTCCTGAACTTAGAAAAGG + Intergenic
1200622882 Y:5475902-5475924 TGTGTATCTAAACATAGAAAAGG + Intronic
1200717896 Y:6570977-6570999 TTTGTATCTAAATATAGAATGGG + Intergenic
1201188661 Y:11428551-11428573 TGAGTACCTGAACATAGAGAAGG - Intergenic
1201522901 Y:14896319-14896341 TGTGGACATGAATACAGAGAAGG + Intergenic
1202302498 Y:23432130-23432152 TGTGTGTCTAAACATAGAAAAGG + Intergenic
1202568313 Y:26238464-26238486 TGTGTGTCTAAACATAGAAAAGG - Intergenic