ID: 1156443053

View in Genome Browser
Species Human (GRCh38)
Location 18:37211213-37211235
Sequence ATTCTAGTCTGGGAAGTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156443049_1156443053 10 Left 1156443049 18:37211180-37211202 CCTCTTACTTTTCTTGATGGAAA 0: 1
1: 0
2: 3
3: 38
4: 311
Right 1156443053 18:37211213-37211235 ATTCTAGTCTGGGAAGTCAAGGG 0: 1
1: 0
2: 2
3: 19
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156443053 Original CRISPR ATTCTAGTCTGGGAAGTCAA GGG Intronic
901681172 1:10913675-10913697 GGTCTTGTCTGGGAAGACAAAGG + Intergenic
902157482 1:14500198-14500220 AATAAAGTCTGGGAACTCAAGGG + Intergenic
903926664 1:26835334-26835356 ATTCAAGTTTGAGAATTCAAAGG - Intronic
908505837 1:64799091-64799113 ATTAGAGTCTGGGAAGAGAAGGG - Intronic
908522650 1:64959071-64959093 ATTCTAGAGTGGGAAGACAAGGG + Intronic
909618207 1:77636629-77636651 ACTTGAGCCTGGGAAGTCAAGGG + Intronic
911688065 1:100800144-100800166 TTTCTAGCCTGGAATGTCAAAGG - Intergenic
913202438 1:116506124-116506146 ATTGGAGGCTGGGAAGTCCAAGG + Intergenic
913497672 1:119443404-119443426 ATTCTGGTCCGGGGAGCCAACGG - Intergenic
913538723 1:119798536-119798558 ATCCTGGTCTGGCAAGTCCATGG - Exonic
916116167 1:161486714-161486736 ACACAAGTCTAGGAAGTCAAAGG - Intergenic
921954684 1:220969772-220969794 ATTTTAGTTTGGGAAGTAAAGGG + Intergenic
922064218 1:222120860-222120882 TTTTGAGTCTGGGAAGTCCAAGG - Intergenic
924498404 1:244612601-244612623 ATACTAGACTGGGAAGTCCTGGG + Intronic
1067374019 10:45710928-45710950 GTTCCAGCCTTGGAAGTCAACGG - Intergenic
1067379669 10:45761334-45761356 GTTCCAGCCTTGGAAGTCAACGG + Intronic
1067881847 10:50052684-50052706 CTTCCAGCCTTGGAAGTCAACGG - Intergenic
1067887367 10:50101991-50102013 GTTCCAGCCTTGGAAGTCAACGG + Intronic
1068480169 10:57579611-57579633 ACACAAGTCTAGGAAGTCAAAGG - Intergenic
1068496410 10:57789795-57789817 ACACAAGTCTAGGAAGTCAAAGG + Intergenic
1070328611 10:75403155-75403177 CTTCTAGTCCTGGAGGTCAATGG + Intergenic
1070945928 10:80391628-80391650 ACTCTAGTCTGGGCAGCAAAGGG + Intergenic
1073040129 10:100598366-100598388 ACTTGAGTCTGGGAGGTCAAAGG - Intergenic
1073948907 10:108784657-108784679 ACACAAGTCTAGGAAGTCAAAGG + Intergenic
1074171169 10:110938967-110938989 CTTTTAGTCTGGAAAATCAATGG - Intronic
1074325980 10:112451459-112451481 ATTCTAGTCTAGGAACAGAAAGG - Intronic
1074538770 10:114347556-114347578 ACTTGAGTCTGGGAGGTCAAGGG - Intronic
1076089040 10:127663201-127663223 ATTCTATTCTGATAAATCAAGGG + Intergenic
1079105659 11:17570683-17570705 ATTCCAGTATGGGAGGTCTATGG + Intronic
1079561631 11:21828606-21828628 AATCTTTTCTGGGAAGACAATGG - Intergenic
1080056754 11:27914667-27914689 ATCCTAGTCTATAAAGTCAATGG - Intergenic
1081205800 11:40274216-40274238 AATCTAGTGTGGGAAGTCAAAGG + Intronic
1083104864 11:60347827-60347849 ATACAAGTCTAGGGAGTCAAAGG - Intronic
1084277038 11:68057970-68057992 ACTTTAGCCTGGGAAGTCAGGGG - Intronic
1086621072 11:88887449-88887471 ACACAAGTCTAGGAAGTCAAAGG + Intronic
1087089678 11:94255703-94255725 ATTCTGCTCTGGGAAGTACAGGG + Intergenic
1088696455 11:112370308-112370330 ATTAGGGTCTGGGAATTCAATGG + Intergenic
1089610829 11:119667619-119667641 AATCTTGTATGGGAAGGCAAGGG - Intronic
1089712214 11:120323848-120323870 ATTCTAGTTTGGTAGGTCCAGGG + Intergenic
1090206014 11:124884860-124884882 ATTCCCGTCTGGGAAGTCTCAGG + Exonic
1090947236 11:131441747-131441769 ATTCCAGTCTGTGAATTCAATGG - Intronic
1091769246 12:3140675-3140697 AGTTTGGTGTGGGAAGTCAAAGG + Intronic
1091803161 12:3337746-3337768 TTCCTCATCTGGGAAGTCAAGGG - Intergenic
1092072896 12:5647545-5647567 ATTCTAGCATGGGTGGTCAATGG + Intronic
1092337410 12:7645469-7645491 ATTCTCTAATGGGAAGTCAAGGG + Intergenic
1092846030 12:12586090-12586112 CTTCCAGTCTGGGAAGGGAATGG + Intergenic
1093279054 12:17168424-17168446 ATTCTAGTCTGGGAACAGGACGG - Intergenic
1095300177 12:40575136-40575158 ATTCAAGTCTGAGAATTTAATGG + Intergenic
1095640082 12:44477358-44477380 ACACAAGTCTAGGAAGTCAAAGG + Intergenic
1096319177 12:50596063-50596085 ATTCTAGTCTGAGAAGTCCATGG + Intronic
1097651753 12:62307201-62307223 ATTGGAGTTTGGGAGGTCAAAGG - Intronic
1098900219 12:76104712-76104734 ACTCGAGCCTGGGAAGTCAAGGG - Intergenic
1102936247 12:116899477-116899499 ATTTTGCTCTGGGAAGTCCAAGG - Intergenic
1107913520 13:45126816-45126838 GTCCTGGTCTAGGAAGTCAAGGG + Intronic
1112235115 13:97629028-97629050 AATCTAGTGTATGAAGTCAAGGG + Intergenic
1112628826 13:101138500-101138522 ATTCTATGCTGGGAAGTACAGGG + Intronic
1113470224 13:110539243-110539265 TTTCTAGTCTAGCAAGTCCAAGG + Intronic
1114777876 14:25505594-25505616 TTGCTAGTCTGGGAATTCACTGG + Intergenic
1115907400 14:38214953-38214975 ATGCTACTCTGGGAACACAAAGG - Intergenic
1116749149 14:48860888-48860910 ATTTTATTCTGGCAAGTAAAGGG - Intergenic
1118678728 14:68216970-68216992 ATTAGAGTCTGGGAGGTAAAAGG - Intronic
1118768005 14:68922847-68922869 ATTCTGGTGTGGGTAGTCCAAGG + Intronic
1120834598 14:89028252-89028274 CTTCTAGCCATGGAAGTCAACGG + Intergenic
1126773614 15:52081003-52081025 ATTCTAGTCTGGGGCAGCAAAGG + Intergenic
1127717062 15:61658916-61658938 ATTCTGGTCTTGGGGGTCAAAGG + Intergenic
1129626483 15:77205781-77205803 ATTTTAAGCTGGGAAGTCACTGG + Intronic
1130967703 15:88709543-88709565 ATTCTAGTCCGTGAGTTCAAGGG + Intergenic
1134057179 16:11177951-11177973 ATACTTGTTTGGGAAGTAAATGG - Intronic
1136272669 16:29157923-29157945 GTTCTCCTCTGGGAAGTCAACGG + Intergenic
1137224345 16:46488898-46488920 ATTAGAGTCTGGGAAATGAAGGG + Intergenic
1137948989 16:52764125-52764147 ATTCTAGAGTGGGAAGACAGGGG - Intergenic
1139829039 16:69781759-69781781 ATTTGAGTCTGGGAAGTCTAAGG + Intronic
1142076221 16:88119737-88119759 GTTCTCCGCTGGGAAGTCAACGG + Intergenic
1142766056 17:2064962-2064984 ACTCTGGCCTGGGAAGTCTAAGG - Intronic
1147619222 17:41852955-41852977 AGTGTAGACTGGGAAATCAAAGG - Intergenic
1150350905 17:64443768-64443790 ACTTGAGTCTGGGAGGTCAAGGG - Intergenic
1150505394 17:65693430-65693452 ATTCTGCTCAGTGAAGTCAAGGG + Intronic
1151525415 17:74662685-74662707 AGTTGAGCCTGGGAAGTCAAGGG + Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1155894928 18:31313203-31313225 ATTCTAGAATGGGAATTCAACGG - Intergenic
1156443053 18:37211213-37211235 ATTCTAGTCTGGGAAGTCAAGGG + Intronic
1156493642 18:37511572-37511594 ATTCACATCTGGGTAGTCAATGG - Intronic
1157805218 18:50652810-50652832 AAGCTAGTCTGGGAAGGGAAAGG + Intronic
1158240337 18:55370321-55370343 ACTTGAGTCTGGGAGGTCAAGGG + Intronic
1158273284 18:55739624-55739646 ATTTTTCTCTGGGATGTCAAAGG - Intergenic
1159174378 18:64814591-64814613 ACACGAGTCTAGGAAGTCAAAGG + Intergenic
1159359898 18:67386496-67386518 ATTCTAGTGAGGGAAGTTAATGG - Intergenic
1165974883 19:39667002-39667024 ATTCAAGTCTGAGAAGAAAAAGG + Intergenic
1168711140 19:58500591-58500613 ATTCGGATCTGGGAAGTCTACGG - Exonic
925472233 2:4175035-4175057 TTACAAGTCTAGGAAGTCAAGGG - Intergenic
926133502 2:10320187-10320209 ACTCATGTCTGGGAAGTGAAAGG - Intronic
927233714 2:20850496-20850518 ATTGTAGTTTGGGAATTCAAAGG + Intergenic
928317800 2:30259278-30259300 ATTCCGTTCTGGGAAGCCAATGG + Exonic
929393213 2:41495140-41495162 ACACAAGTCTAGGAAGTCAAAGG + Intergenic
930895507 2:56441094-56441116 ATTCCAGCCTGGGCAGCCAAGGG - Intergenic
934305541 2:91818745-91818767 AGTCTGGTCTGGGAAGCCCAGGG + Intergenic
934327715 2:92034003-92034025 AGTCTGGTCTGGGAAGCCCAGGG - Intergenic
936682864 2:114794471-114794493 ATTTTAGCCTGAGAAGACAAGGG + Intronic
938290875 2:130149706-130149728 ATTCTGGTTTTGGGAGTCAAGGG + Intergenic
939295000 2:140250637-140250659 ATTCTAGTCTGGAACATAAAGGG - Intronic
940908712 2:159191458-159191480 ATTCCAGTCAGGGAACTAAAAGG + Intronic
942127959 2:172846502-172846524 TTTCTAGTCTGTGAAGTCTAGGG + Intronic
946370493 2:219278859-219278881 ATTCTAGTGGGGGAGGTGAATGG + Intergenic
946890605 2:224272197-224272219 ATTCAAGTCTAAGAAGTAAAGGG + Intergenic
947254257 2:228144136-228144158 ATTCTAGTTAGGGGAGTCAGAGG - Intronic
948937175 2:241174464-241174486 ATTGTAGTTTGGGGAGGCAAAGG - Intronic
1171381780 20:24738848-24738870 TTTGGAGTCTGGGAAGTCCAAGG - Intergenic
1173677162 20:44845917-44845939 ATTCTAGTTTAGGAGGTCCAGGG - Intergenic
1173722780 20:45273942-45273964 ATTTTATTCTGGGAAATCATTGG - Intergenic
1175726542 20:61322438-61322460 ATGCCAGTCTGGGAAGGAAAGGG - Intronic
1178484412 21:33008911-33008933 TTTCTATTCTGGGATGTCAAAGG - Intergenic
1179493782 21:41758853-41758875 ATTCTAGTCTGTGAAAACACAGG - Intronic
1181376612 22:22463758-22463780 ACACAAGTCTAGGAAGTCAAAGG - Intergenic
951073988 3:18366909-18366931 GTTCTAGTCTGGGAAACAAAAGG - Intronic
951252525 3:20410513-20410535 CTTCTGGTCTGAGAAATCAAAGG - Intergenic
952256948 3:31704004-31704026 ATTCTACACTGGGAAGTTAGGGG + Intronic
957116810 3:76036897-76036919 ATTATATACTGGGAAGTAAATGG - Intronic
957389174 3:79539607-79539629 ATTATACTCTGAAAAGTCAAGGG + Intronic
958581540 3:96031914-96031936 ATTATGGTCAGGGAAGTTAATGG - Intergenic
959722352 3:109506560-109506582 ATTGGAGGCTGGGAAGTAAAGGG + Intergenic
960698690 3:120419815-120419837 AATCTAGTCGGGGATGACAAGGG + Intronic
962750739 3:138433392-138433414 AGTGTAGCCTGGGAAATCAACGG - Intergenic
963174193 3:142281260-142281282 ACACAAGTCTAGGAAGTCAAAGG + Intergenic
965381644 3:167996645-167996667 AGTCTAGTGTGGGAATTGAATGG - Intergenic
966120456 3:176513956-176513978 ACACAAGTCTAGGAAGTCAAAGG - Intergenic
967142421 3:186572080-186572102 AATCTCGTCTGGGAAGTAGAGGG - Exonic
971064047 4:23007275-23007297 ATACAAGTCTGTGAAGGCAAGGG + Intergenic
971482370 4:27126056-27126078 ATTCTTGGCTGAGAAGTCAAGGG + Intergenic
971513465 4:27457056-27457078 TTTCTACTCTGGGAAAACAATGG + Intergenic
971539712 4:27800747-27800769 ATCCTAGTCTGGGAAGTATGTGG + Intergenic
972002077 4:34050100-34050122 ATTGTAGTATGGGAAGGCTATGG - Intergenic
973269847 4:48251409-48251431 ACTTTAGACTGGGTAGTCAAAGG - Intronic
974542439 4:63255313-63255335 GTTCTTTTCTGGGAAGTGAAAGG - Intergenic
974647904 4:64717758-64717780 ACACAAGTCTAGGAAGTCAAGGG - Intergenic
975421850 4:74174003-74174025 TTTGTAGACTGGGAAGTCCAAGG + Intronic
975606072 4:76155672-76155694 ATTGAAGTCTGGGAGGTAAATGG + Intergenic
977289075 4:95143797-95143819 CTGCTTGTCTGGGAATTCAAAGG + Intronic
979369585 4:119868335-119868357 GACCTAGTCTGGGGAGTCAAAGG - Intergenic
983331563 4:166335244-166335266 TTTCTAATCTGTGAAGGCAACGG + Intergenic
989279476 5:39624219-39624241 ATTATAGTCTCTGAATTCAAGGG - Intergenic
990658878 5:57989865-57989887 ATACTATTCTGGGAATGCAATGG + Intergenic
991027207 5:62042718-62042740 ACTCTACTCTGGGAAGGCAAAGG + Intergenic
991960762 5:72041787-72041809 TTTAGAGTCTGGGAAGTCCAAGG + Intergenic
993299224 5:86185748-86185770 ATTTTAGTCAGGAAAGTCAGTGG + Intergenic
993520782 5:88897317-88897339 ATTCTAGTCTGTGTAGCCTACGG + Intronic
994221073 5:97195559-97195581 GTTCTTGTCAAGGAAGTCAAGGG + Intergenic
994276530 5:97844864-97844886 TTCCCAGTCTGGGAAGTCTATGG + Intergenic
994787130 5:104179774-104179796 ATACAAGTCTAGGAAGTCAAAGG + Intergenic
995062861 5:107830623-107830645 TTTCTAGTCTGGTGAGTTAAAGG - Intergenic
995716200 5:115083816-115083838 ACACAAGTCTAGGAAGTCAAAGG - Intergenic
1000535571 5:162473825-162473847 ATTCTAGTCTGGAAGCTAAAAGG - Intergenic
1001299825 5:170525503-170525525 ATTCTAGGGAGGGAAGGCAAAGG - Intronic
1001978666 5:176022076-176022098 GTTCTGGTCTGGGCAGTCCAAGG - Intronic
1002058325 5:176610956-176610978 TTTCTCCTCTGGGAAGTCAAGGG - Intergenic
1002238751 5:177821686-177821708 GTTCTGGTCTGGGCAGTCCAAGG + Intergenic
1006045634 6:31294354-31294376 ATTCCAGTCTGTGAAGTGAAGGG + Intronic
1009494861 6:64333883-64333905 GTACTAATCTGGGAGGTCAATGG + Intronic
1009657721 6:66567978-66568000 ACACAAGTCTAGGAAGTCAAAGG - Intergenic
1010574262 6:77512153-77512175 ACACAAGTCTAGGAAGTCAAAGG - Intergenic
1010931330 6:81807245-81807267 ATGGGAGTCTGGGAAGTCAAAGG + Intergenic
1015948394 6:138526158-138526180 ATTATGATCTGGGAACTCAAGGG - Intronic
1016130621 6:140464047-140464069 ACTCTCTTCTGGGAAGTCACTGG + Intergenic
1019169122 6:170119810-170119832 GCTCTAGTCAGGGAAGTAAAAGG - Intergenic
1021876597 7:25055079-25055101 AGTCTGGTCTGGTAAATCAAAGG + Intergenic
1022712002 7:32860234-32860256 ATACTCTTCTGGGAAGTCCAAGG + Intergenic
1022756409 7:33296679-33296701 ACACAAGTCTGGGAAGTCAAAGG - Intronic
1024363352 7:48492675-48492697 TTTGGAGTCTGGGAAGTCCAAGG - Intronic
1028254545 7:88577891-88577913 CTTCGAGTCTGGGAAGACATAGG - Intergenic
1032856267 7:135836160-135836182 ATTGGGGCCTGGGAAGTCAAAGG + Intergenic
1032867003 7:135935972-135935994 ATTGTGGTCTTGGAAGTTAAGGG - Intronic
1035164692 7:156979588-156979610 ATTTGAGCCTGGGAGGTCAAGGG - Intergenic
1037969476 8:23161704-23161726 TTGCTAGTCTAGGAAGTAAAAGG - Intronic
1038063513 8:23937912-23937934 ATTCCAGTCAGGGAAGACACTGG - Intergenic
1038647236 8:29372073-29372095 ACTCTAGTCTGGGCAGCCGAGGG + Intergenic
1038946701 8:32369422-32369444 ATTCTACTCTGGAAAGTCACTGG + Intronic
1039183486 8:34891854-34891876 ACACAAGTCTAGGAAGTCAAAGG + Intergenic
1040880841 8:52202614-52202636 ATCTTAGTCTGGGAGGTCATGGG + Intronic
1041137836 8:54779175-54779197 ATTATAGTCAGGGAAGTGAGAGG + Intergenic
1041214678 8:55588404-55588426 ATTAAAGTTTGGGAAGTAAAAGG + Intergenic
1043208774 8:77483685-77483707 TTTCTAGTCTCTGAAGACAAAGG + Intergenic
1044342603 8:91064545-91064567 ATTCTAGACAGGGCGGTCAAGGG + Intergenic
1044749455 8:95402189-95402211 ATTCAAATCTAGGAAGTCATGGG - Intergenic
1046105506 8:109661079-109661101 ATTCAAATCTGGAAAGGCAAAGG + Intronic
1047363426 8:124190651-124190673 TTTCTGCTCTGGGAAGGCAAGGG - Intergenic
1050647672 9:7739023-7739045 ATTTTAGTCTGGAAACTAAAAGG - Intergenic
1051106364 9:13585238-13585260 ATTCTAGTGTGTGAATTCCAAGG - Intergenic
1052674447 9:31601673-31601695 ATTTTATTCTGGGAAGATAAAGG - Intergenic
1053082995 9:35193095-35193117 ACACAAGTCTAGGAAGTCAAAGG - Intronic
1053967289 9:43667909-43667931 ATTCTACTCTGTGACTTCAATGG - Intergenic
1054021973 9:44615714-44615736 ATTCTACTCTGTGACTTCAATGG - Intergenic
1055376327 9:75651682-75651704 ATTCTACTGTGAGAAGTCTAAGG - Intergenic
1056385374 9:86092446-86092468 ATCCTGGTCTGGGATGTCCACGG - Intronic
1056746290 9:89306594-89306616 TTTGGAGGCTGGGAAGTCAAAGG - Intergenic
1059280415 9:113128543-113128565 ATTCTAGTCTTGAAAGTAGAGGG - Intergenic
1059718030 9:116931696-116931718 ATTCTAATTTGGGAAGCAAAGGG + Intronic
1186503002 X:10066845-10066867 AGTCTAGTCTGGAAAATGAAAGG + Intronic
1186667774 X:11735899-11735921 AGTCTGGTCTAGGAAGTGAATGG + Intergenic
1186716997 X:12262890-12262912 ATTCTACACTTGGAAGTCACTGG + Intronic
1187630396 X:21163035-21163057 ATTCTAGGCTGGCAAGTGATAGG - Intergenic
1188554368 X:31395394-31395416 ATTCAAGTCAGGGAAAACAAAGG - Intronic
1191158687 X:57303417-57303439 ATTCTTGTCAGGAAAATCAAAGG - Intronic
1191893593 X:65970159-65970181 ATTAAAATCTGGGAAGTGAAGGG + Intergenic
1192047566 X:67692253-67692275 ATTCTAGTCTAGAGAATCAAAGG - Intronic
1192235894 X:69295900-69295922 ATTCTAGTATGTGAGGGCAATGG - Intergenic
1192242882 X:69348828-69348850 TTTCTAGTCTGGGCAATGAAAGG - Intergenic
1193527392 X:82610596-82610618 AATCTAGGCAGAGAAGTCAAGGG - Intergenic
1194577536 X:95631423-95631445 ATTCTATTTTGTGATGTCAATGG + Intergenic
1197306817 X:124852682-124852704 AATCTAGACTGGGAAGCCACTGG + Intronic
1197356122 X:125438862-125438884 ACACAAGTCTCGGAAGTCAAAGG - Intergenic
1198621600 X:138517981-138518003 TATCTAGGCTGGTAAGTCAAGGG - Intergenic