ID: 1156444470

View in Genome Browser
Species Human (GRCh38)
Location 18:37225002-37225024
Sequence CCAAACCTGATCCCCATGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156444467_1156444470 0 Left 1156444467 18:37224979-37225001 CCAGGAGGCAAACTTGTGTTTAT 0: 1
1: 0
2: 1
3: 10
4: 159
Right 1156444470 18:37225002-37225024 CCAAACCTGATCCCCATGATGGG 0: 1
1: 0
2: 0
3: 5
4: 96
1156444466_1156444470 7 Left 1156444466 18:37224972-37224994 CCGCTTTCCAGGAGGCAAACTTG 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1156444470 18:37225002-37225024 CCAAACCTGATCCCCATGATGGG 0: 1
1: 0
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156444470 Original CRISPR CCAAACCTGATCCCCATGAT GGG Exonic
900654757 1:3750796-3750818 CCCAGCCTGATACCCATGAAGGG + Intergenic
901692201 1:10980839-10980861 CCAAAGCTGAGCCCCCTCATGGG + Intronic
904447591 1:30587499-30587521 CCCAACCTGATCCTCATCGTGGG + Intergenic
904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG + Intergenic
910633986 1:89386815-89386837 CCAGAACTGAACCCCCTGATGGG + Intergenic
912120357 1:106464224-106464246 CCAAGCCTGAACCCAAAGATAGG + Intergenic
912620185 1:111147967-111147989 CCAAATCTCATCACCATCATTGG + Exonic
916615539 1:166435427-166435449 TCAAACCTCATCCCCATCTTGGG + Intergenic
920255158 1:204649743-204649765 CCCACACTGATCCCCATGACTGG + Intronic
923667736 1:236013846-236013868 CCAAACTAGATCCCCATCACAGG + Intronic
1063592061 10:7405113-7405135 CCAAACCTGAACCCTAGGAACGG + Intronic
1063631403 10:7737054-7737076 AGAAACCTGATTCCAATGATTGG - Intronic
1070130033 10:73649315-73649337 CCTAACATGGTCCCTATGATGGG - Intronic
1070449823 10:76546908-76546930 CCTCATCTGATCCCCATCATTGG - Intronic
1073637360 10:105213599-105213621 ACAACCCTGATCTGCATGATGGG - Intronic
1074560995 10:114535058-114535080 CCCAACCTGATAGCCATGAAGGG + Intronic
1075078512 10:119367771-119367793 CCCAACATGATCCCCATCAAGGG - Intronic
1075987763 10:126802814-126802836 CCCCACCAGATCCCCATGGTTGG + Intergenic
1080465095 11:32488912-32488934 CCAAGCCTGATGCCTATGCTGGG + Intergenic
1087094302 11:94305330-94305352 CAAAGCCTGATCCCCATCACAGG - Intergenic
1089904100 11:122020255-122020277 CCAAAACTGATTCCCATCATAGG - Intergenic
1094268540 12:28585886-28585908 CCCAACCTGATCCCCAAGGGAGG + Intergenic
1102299465 12:111760463-111760485 CCTAACCTGATCCCCAGGGGAGG + Intronic
1103681308 12:122696323-122696345 CCAAATCAGACACCCATGATGGG + Intergenic
1103683038 12:122709748-122709770 CCAAATCAGACACCCATGATGGG + Intergenic
1105271050 13:18875510-18875532 CCCAACCCGCTCCCCACGATGGG + Intergenic
1105271101 13:18875695-18875717 CCAAACCTGATCCCCGCCACAGG + Intergenic
1105283351 13:18983051-18983073 CCCAACCTGATCCCAAGGAGTGG - Intergenic
1105706576 13:22971153-22971175 CCAAGCCTGATCTCCAGGACTGG - Intergenic
1112288214 13:98122839-98122861 TGAAACCTGATCCCCAATATTGG + Intergenic
1113518341 13:110920105-110920127 CCAAAGCTGTTTCCCATGTTAGG + Intergenic
1114372643 14:22107281-22107303 CCAAACCAGCTCTCCATTATTGG + Intergenic
1116146339 14:41074647-41074669 GCCAATCTGATCACCATGATGGG - Intergenic
1116516192 14:45809073-45809095 CCAGGCCTGATCCCCAGGCTCGG - Intergenic
1119017215 14:71071369-71071391 CCAAACCGTATCACCAGGATGGG - Intronic
1119123114 14:72098177-72098199 CCAAACCAGACCCCGAGGATGGG - Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1202902305 14_GL000194v1_random:50853-50875 CCACACCTGATCTCCACCATGGG + Intergenic
1127559222 15:60119213-60119235 CTAAACCTGAGCCCCCTGAAAGG - Intergenic
1127815472 15:62604931-62604953 CCAAGACTGAGCCCCATCATAGG + Intronic
1128323424 15:66707712-66707734 TCAACCCTAAGCCCCATGATGGG - Intronic
1129266767 15:74397433-74397455 CCCATCTTGATCCCCATGGTGGG - Intergenic
1143517838 17:7428916-7428938 GCACACCTGGGCCCCATGATAGG - Intergenic
1151414373 17:73952185-73952207 CCAAACCTCTCCCCCATGAGAGG + Intergenic
1154170506 18:12047436-12047458 CCCAACCCACTCCCCATGATGGG + Intergenic
1154416528 18:14178517-14178539 CCCAACCCGCTCCCCACGATGGG - Intergenic
1156444470 18:37225002-37225024 CCAAACCTGATCCCCATGATGGG + Exonic
1158497560 18:57970250-57970272 CCAAACAAGAAGCCCATGATGGG + Intergenic
1158892300 18:61884059-61884081 CCAGAACTGAGCCCAATGATTGG + Intronic
1160033626 18:75282351-75282373 CCAATCCTCATCCCCTTGCTTGG - Intronic
1167148921 19:47698036-47698058 CCAGGCCTGAGCCCCATGTTGGG + Intronic
928081455 2:28316218-28316240 ACAAACCTGTTCCCCATATTTGG + Intronic
928288928 2:30020365-30020387 CCATAGATTATCCCCATGATTGG + Intergenic
933644141 2:84796539-84796561 CCACACCCTATCCCCATGCTTGG + Intronic
940179399 2:150915115-150915137 CCAAACTTGATCCAAATGCTTGG - Intergenic
944513653 2:200489731-200489753 CCAAACCTCATGCCCATCCTCGG + Exonic
1169760467 20:9086755-9086777 CGAAACCTTTTCCCTATGATCGG - Intronic
1174533000 20:51229633-51229655 CCACACCTGGCCCACATGATAGG - Intergenic
1176621673 21:9065620-9065642 CCACACCTGATCTCCACCATGGG + Intergenic
1176856800 21:13980741-13980763 CCCAACCCGCTCCCCACGATGGG + Intergenic
1176867780 21:14063472-14063494 CCCAACCCGCTCCCCACGATGGG - Intergenic
1178415926 21:32405085-32405107 ACAAAACTGGTCCCCATGTTCGG - Intergenic
1183671649 22:39276374-39276396 CCAAATCTGATTCCCATGGCAGG + Intergenic
950067216 3:10122281-10122303 CAAAACCAAATGCCCATGATTGG - Intronic
950131739 3:10552067-10552089 CCAAAACTGGGCCCCAGGATAGG - Intronic
950336260 3:12196134-12196156 TCAAACCTGATAACCTTGATGGG - Intergenic
955494750 3:59519659-59519681 CCAAGCCTGCACCCCATGCTAGG - Intergenic
955501228 3:59585169-59585191 TAAAATCTGATCCCCATGAAGGG - Intergenic
961098183 3:124175479-124175501 CCAGGCCTGATCTCCAGGATGGG + Intronic
961098209 3:124175611-124175633 CCAGGCCTGATCTCCAGGATGGG + Intronic
970932093 4:21524028-21524050 CCAAACCTGAGCCCCTTCACAGG - Intronic
972318273 4:37948103-37948125 CAAGACCTGAACCCCATGGTAGG + Intronic
980275622 4:130646531-130646553 CCAACTCTGATGCCCATGACTGG - Intergenic
986625861 5:9723480-9723502 CCACACCTGTTCCCCATGACTGG + Intergenic
998251455 5:140556263-140556285 CCAAACCTGAGCCCCTTTATGGG + Intronic
998434672 5:142097330-142097352 CCTAACCTTATCCCCAAGTTGGG - Intergenic
998661657 5:144245610-144245632 CCAGACCTGACCTCCAAGATTGG - Intronic
999364023 5:151009676-151009698 CCTAACCTGGTCCCCAGGATAGG - Intergenic
1003666327 6:8115078-8115100 CCACACCTGAACCCCGTGAATGG - Intergenic
1006695460 6:35926872-35926894 CCAAACCTGATTCACATCACAGG + Intergenic
1008488274 6:52058426-52058448 CCAATCCTCATCCCCCTGCTTGG + Exonic
1009505086 6:64467926-64467948 CCAACCCTGAAGCCCATGAGTGG - Intronic
1014180730 6:118381499-118381521 AGGAACCTGATCCACATGATGGG + Intergenic
1015776693 6:136822083-136822105 CCAAACCAACTCCCCATGCTTGG - Intergenic
1017140682 6:151187309-151187331 CCCAGCCTGATCCCCAGTATTGG - Intergenic
1021980180 7:26046558-26046580 CCAGCTCTGATCCCCATGAAGGG - Intergenic
1024187095 7:46961145-46961167 ACAAACCTGAGCCACATGATTGG - Intergenic
1026341760 7:69440287-69440309 CCAAACCATATCACCATGACAGG + Intergenic
1032253825 7:130281248-130281270 TGAAATCTGATCCCCAAGATTGG - Intronic
1041484497 8:58359397-58359419 CCAAACCTGATAGCCACTATAGG + Intergenic
1043555103 8:81421321-81421343 CCCAACCTGAGCCCCTTGGTAGG + Intergenic
1047775839 8:128069712-128069734 TCAAACCTGCTCTTCATGATGGG + Intergenic
1055169331 9:73235998-73236020 CCAGCCCTGATCCCCAGGAGAGG - Intergenic
1057495567 9:95557987-95558009 CCAACAATGATCCCAATGATGGG + Intergenic
1058917849 9:109584782-109584804 CCAAACCTGTTTCCCATTGTGGG + Intergenic
1059186910 9:112282795-112282817 CCAAACCATATCACCAAGATAGG - Intronic
1059433057 9:114261239-114261261 CCAAGCCTGATCCCCAGGCCTGG + Intronic
1203744856 Un_GL000218v1:36030-36052 CCACACCTGATCTCCACCATGGG + Intergenic
1192202133 X:69073166-69073188 CCAGACCTGACCCCCAGGCTAGG - Intergenic
1195067556 X:101251067-101251089 CCCTACCTGAACCCCTTGATGGG - Exonic
1200144343 X:153918826-153918848 CCTCACCTCATCCCCATCATGGG + Exonic
1201158195 Y:11151073-11151095 CCACACCTGATCTCCACCATGGG + Intergenic