ID: 1156445139

View in Genome Browser
Species Human (GRCh38)
Location 18:37231066-37231088
Sequence CTCAGTTATCATCACTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156445136_1156445139 9 Left 1156445136 18:37231034-37231056 CCTCTATCTTGGATGAATCTTTC 0: 1
1: 0
2: 0
3: 8
4: 171
Right 1156445139 18:37231066-37231088 CTCAGTTATCATCACTTCCATGG 0: 1
1: 0
2: 0
3: 12
4: 171
1156445134_1156445139 16 Left 1156445134 18:37231027-37231049 CCAGGTCCCTCTATCTTGGATGA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1156445139 18:37231066-37231088 CTCAGTTATCATCACTTCCATGG 0: 1
1: 0
2: 0
3: 12
4: 171
1156445135_1156445139 10 Left 1156445135 18:37231033-37231055 CCCTCTATCTTGGATGAATCTTT 0: 1
1: 0
2: 1
3: 18
4: 192
Right 1156445139 18:37231066-37231088 CTCAGTTATCATCACTTCCATGG 0: 1
1: 0
2: 0
3: 12
4: 171
1156445132_1156445139 30 Left 1156445132 18:37231013-37231035 CCTATGTGACTTTTCCAGGTCCC 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1156445139 18:37231066-37231088 CTCAGTTATCATCACTTCCATGG 0: 1
1: 0
2: 0
3: 12
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156445139 Original CRISPR CTCAGTTATCATCACTTCCA TGG Intronic
902162201 1:14540099-14540121 TTCACTTAGCAGCACTTCCAGGG - Intergenic
906374270 1:45281966-45281988 CTGGCTTATTATCACTTCCAGGG - Intronic
906384446 1:45355331-45355353 CTCAGCTACCTTCACTTCAAAGG - Exonic
908162598 1:61425574-61425596 CTTCTTTATCATCACCTCCAAGG - Intronic
908807107 1:67943261-67943283 TTCAGTTTCCCTCACTTCCAGGG - Intergenic
911627841 1:100146160-100146182 CTCAGTTGTCACCACTCTCAGGG + Intronic
911772486 1:101764397-101764419 TTAAGGTATCATCACTTCCTAGG - Intergenic
913110121 1:115650004-115650026 GTCAGGTACGATCACTTCCAAGG - Intronic
913240768 1:116827371-116827393 CTCAGGCATTATCTCTTCCAAGG + Intergenic
915626886 1:157119307-157119329 CTCAGATGCCATCACCTCCACGG - Intergenic
917835228 1:178936652-178936674 CTCTGTTATCATGAGCTCCAGGG - Intergenic
918601904 1:186374764-186374786 CTCTGTTAACCTCACTTCCTGGG - Intronic
919841126 1:201610146-201610168 CTCAGTTATAAATACTTCCCAGG - Intergenic
920828526 1:209445195-209445217 CTCAGTTGTCAGCACTTCTGAGG - Intergenic
922554514 1:226522505-226522527 CTCAGTTCTCATCCTTCCCATGG + Intergenic
922897771 1:229113766-229113788 CTCTGTGCCCATCACTTCCATGG - Intergenic
923607157 1:235454383-235454405 CTCCTTTATCATCACTACAAAGG + Intronic
923813636 1:237348492-237348514 CCTAGTAATCATAACTTCCAAGG - Intronic
1072907316 10:99466367-99466389 ATCAGTAATCTTCACTTCCAGGG + Intergenic
1075588329 10:123673445-123673467 CCAAGTTATCTTCACTTCCTGGG + Intronic
1077662742 11:4084105-4084127 CTCAACTCTCATCACTTGCAGGG - Intronic
1078157327 11:8810176-8810198 CTGAGTTAACATCACTCCCGTGG - Intronic
1078195453 11:9133384-9133406 TACACTTACCATCACTTCCAAGG + Intronic
1078614607 11:12853400-12853422 CTCAGTTATAAGACCTTCCAAGG - Intronic
1080294727 11:30713510-30713532 CCCAGTTATCACCACTATCATGG + Intergenic
1082732451 11:56816664-56816686 CTCTGTGATCTTCACTTCAAAGG - Intergenic
1086739386 11:90348889-90348911 CTCAGTCATCATAATTTCAATGG - Intergenic
1086842486 11:91704836-91704858 CACAAATATCATCACTTCAAAGG + Intergenic
1088821921 11:113463884-113463906 CCCAGGTATCACCTCTTCCAGGG - Intronic
1095354396 12:41254755-41254777 CTTAGACATCACCACTTCCAAGG - Intronic
1097173698 12:57130731-57130753 CCCAGATAGCATCACTCCCAGGG + Intronic
1101351325 12:103931782-103931804 CTCAGTTTTCATCACTCCTAGGG - Intronic
1102354072 12:112217730-112217752 TTCCATTATCATCAATTCCAAGG + Intronic
1109847884 13:68021182-68021204 CTGAGTCATCCTCACTTCCCTGG - Intergenic
1110931836 13:81228897-81228919 CTCATATATCATACCTTCCAAGG - Intergenic
1112794196 13:103037162-103037184 CTGAATTATCATCAATTCCATGG - Intergenic
1113188780 13:107720044-107720066 CTTACTTGTCATCACCTCCATGG + Intronic
1115141717 14:30179334-30179356 CTCACTTATTATCACTTTCTGGG - Intronic
1116455387 14:45115416-45115438 CTCATTTATAATCTATTCCAAGG - Exonic
1117426255 14:55600917-55600939 CTCATTTAAAAACACTTCCATGG - Intronic
1117779214 14:59215306-59215328 CTGAGTTATTAACAATTCCATGG + Intronic
1118012064 14:61619684-61619706 CTCAGCTGTCATCACTCTCATGG - Intronic
1119128346 14:72149269-72149291 GTCATCTAGCATCACTTCCATGG + Intronic
1120524890 14:85566526-85566548 CTCAGTCCTCTTAACTTCCATGG + Intronic
1122182366 14:99965407-99965429 TTCATTTCTCTTCACTTCCAGGG - Intergenic
1202917317 14_GL000194v1_random:188239-188261 CTCAGTTATCATACCTTCAGAGG - Intergenic
1126256282 15:46629091-46629113 CTTATGTATCATCTCTTCCAGGG - Intergenic
1126570073 15:50141248-50141270 ATCAGTTAGCATCACTTAAAAGG - Intronic
1130198693 15:81805389-81805411 CTCAGTCAGGATGACTTCCAAGG + Intergenic
1130304193 15:82702118-82702140 CTGAGTTATCTTCACTTCTGTGG + Intronic
1131656992 15:94471269-94471291 CTCAATGCTCGTCACTTCCAGGG + Intronic
1132135443 15:99333221-99333243 TACAGTTGTCATCTCTTCCATGG - Intronic
1136049481 16:27640331-27640353 CACAGTCATCATCCCTTGCAAGG + Intronic
1137578861 16:49621436-49621458 CTGAGTCATCATAACTCCCAGGG + Intronic
1139207615 16:65044507-65044529 CTCAGTGTCTATCACTTCCACGG - Intronic
1139744759 16:69065348-69065370 CTGAGCTATCATCCCTCCCAAGG + Intronic
1140290162 16:73645869-73645891 TACAGTTACCATCACCTCCAAGG - Intergenic
1140380256 16:74480487-74480509 CTCATTGATAATCACTTCCAGGG + Intronic
1143547898 17:7610459-7610481 CCCAGCTACCATGACTTCCAAGG + Intronic
1144282431 17:13739689-13739711 ATCAGTTAGCTTCACTTTCAGGG + Intergenic
1146735267 17:35233190-35233212 CCCACTTACCATCACTTCCAAGG - Intergenic
1147027686 17:37602468-37602490 CTCAGTTATAAGCACTCCCTTGG - Intronic
1147741816 17:42674383-42674405 CTGAGTCAGCGTCACTTCCAGGG + Exonic
1148026907 17:44594901-44594923 CTCAGCTATCGTCCCTGCCATGG + Intergenic
1149335788 17:55634459-55634481 CCCATCTATCATCAGTTCCAGGG - Intergenic
1150101524 17:62428243-62428265 CTGAGTTGTCATCACCCCCATGG + Intronic
1150319804 17:64203195-64203217 CTGAATTCTCATCACTTCCTCGG - Intronic
1152023290 17:77793046-77793068 CTTGGTTATCCTCACATCCACGG + Intergenic
1153677566 18:7468990-7469012 CACAGTCATCATCACATCTAGGG + Intergenic
1155638230 18:27980418-27980440 TTCACTTATCCTCATTTCCAAGG - Intronic
1156445139 18:37231066-37231088 CTCAGTTATCATCACTTCCATGG + Intronic
1156802330 18:41131399-41131421 CACATTTATCATCATTTGCATGG + Intergenic
1157434429 18:47656480-47656502 CTCAGTCATCTTCACCTCCAGGG - Intergenic
1158541962 18:58365282-58365304 CACAGTCATCATCATTACCAGGG - Intronic
1166623334 19:44325367-44325389 CTTTGATATCATCACTTACAGGG - Intergenic
925549514 2:5056240-5056262 CTCAGTGGTAATCACTTCCCTGG - Intergenic
926305769 2:11636661-11636683 CTCCTTTAACATCACTTCCCTGG - Intronic
927055173 2:19360199-19360221 CTCAGCTCTCTTCTCTTCCAAGG - Intergenic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
930638119 2:53828197-53828219 TTCGGTTGACATCACTTCCATGG + Intergenic
932857540 2:75252577-75252599 CTCAGTTAAAATTACTTTCAGGG + Intergenic
935534253 2:104274479-104274501 CTCAGTTATAATAACTTGGAAGG - Intergenic
935950571 2:108324963-108324985 CTCAGTTCTCATGAGTCCCAAGG - Intergenic
936045988 2:109188355-109188377 CACAGTGATCACCACCTCCAGGG + Intronic
938858037 2:135335873-135335895 CTAAGTTTTCATTACTTCCAGGG + Intronic
939568774 2:143815456-143815478 CTCAATTATCATAACTTACAGGG + Intergenic
943265908 2:185732175-185732197 CACATTTATCATCTCTTACAGGG - Intergenic
943300596 2:186192940-186192962 CTCAATTTTCATCAGTTACAGGG + Intergenic
943483336 2:188449566-188449588 GTGAGATATCATTACTTCCATGG + Intronic
944474613 2:200090887-200090909 CTCAGTTTTCATCTCTGTCATGG - Intergenic
1169731627 20:8792356-8792378 TTCAGTTTTCCTCAGTTCCATGG + Intronic
1169902974 20:10571519-10571541 CTCAGGTATCACCTCCTCCAAGG + Intronic
1169941894 20:10946540-10946562 CTCACTTTTAATCACTTCCCTGG - Intergenic
1176636759 21:9252325-9252347 CTCAGTTATCATACCTTCAGAGG + Intergenic
1176873132 21:14099961-14099983 ATCAGTTTTCATGACTTGCAGGG - Intergenic
1179527224 21:41988902-41988924 CTGAGTAATCATCACCTACATGG - Exonic
953718263 3:45334102-45334124 CTCTGATATCACCACTTCCCAGG - Intergenic
954816321 3:53284145-53284167 CTCAGTTCTCCTCACTCACACGG + Exonic
954843113 3:53530622-53530644 CACTGTTGTCACCACTTCCATGG + Intronic
955872420 3:63453191-63453213 GTCAGTTAGCATCACAACCAGGG - Intronic
955920266 3:63947750-63947772 CTCAGCTGTCACCACTTCAAAGG - Intronic
956116330 3:65922683-65922705 CTCAGGTGTCATCATTTCCCTGG - Intronic
957104001 3:75862940-75862962 CTCAGTTATCATACCTTCAGAGG - Intergenic
958031559 3:88116948-88116970 CTCAGTTATCATCAGTTAACTGG + Intronic
959902415 3:111675179-111675201 CTCAGTGATCATCACTTCTTGGG - Exonic
960852889 3:122074337-122074359 CACCGGTATCATCTCTTCCATGG + Intronic
961212674 3:125137838-125137860 CTCAGTTGCCATCTCTTGCAGGG + Intronic
962237262 3:133717269-133717291 CTCAGGTATCAGCCCTTTCAAGG - Intergenic
962695034 3:137939550-137939572 CCCACTTACCATCACTCCCAAGG - Intergenic
962838494 3:139211777-139211799 CGCAGCTAACATCACCTCCATGG - Intronic
964544195 3:157815367-157815389 CAAAGTTATGCTCACTTCCAAGG - Intergenic
966424268 3:179764105-179764127 CGTAGCTATCATCACCTCCATGG + Exonic
967928478 3:194672230-194672252 CTCGCTTATCGTCACTTCCGGGG - Exonic
1202750136 3_GL000221v1_random:152694-152716 CTCAGTTATCATACCTTCAGAGG - Intergenic
970560365 4:17276333-17276355 CTCAAATCTCTTCACTTCCATGG - Intergenic
971141198 4:23926723-23926745 CTCAGTTGTCAGTTCTTCCAGGG + Intergenic
971512312 4:27442450-27442472 CTCTGTTATCAACAGTACCATGG - Intergenic
972236303 4:37137890-37137912 CTCACTCACCATCACTCCCAAGG + Intergenic
974685938 4:65229400-65229422 CTCTGTGATCATCACTTACTAGG + Intergenic
979753353 4:124306999-124307021 CTCAGATGCAATCACTTCCAAGG + Intergenic
984412370 4:179410350-179410372 CTCAGAGATCATGACTTTCAAGG - Intergenic
1202751647 4_GL000008v2_random:10767-10789 CTCAGTTATCATACCTTCAGAGG + Intergenic
986846006 5:11754375-11754397 CTTTGTTCTCATCACTTTCAAGG + Intronic
987361326 5:17109224-17109246 CTCAGTTATCAACAAGGCCATGG - Intronic
987600451 5:20061920-20061942 GACAATTATCAACACTTCCATGG + Intronic
988792916 5:34624945-34624967 CTCAGCTATCACCTCCTCCAGGG - Intergenic
988896399 5:35679028-35679050 CTCTGTTGTCATCTCTTCCAGGG - Intronic
991319172 5:65349987-65350009 CTGACTTATGATCAGTTCCATGG - Intronic
991922606 5:71671675-71671697 ATCAGTTATCATCATTGCCTTGG - Intergenic
992810436 5:80382391-80382413 CACAGTTTTCATCCCCTCCAGGG - Intergenic
994826163 5:104715189-104715211 TTCACTTATCATCATTTCGATGG - Intergenic
995425205 5:112013661-112013683 CTCAGACATCAGGACTTCCATGG - Intergenic
995869261 5:116726882-116726904 CTTAGTTATAATCTCTTCCATGG + Intergenic
996827981 5:127706944-127706966 CTCAGTTCCCAGCACATCCAAGG - Intergenic
1000102423 5:158029115-158029137 CTCAGATATCATCTATCCCAGGG + Intergenic
1000663113 5:163961027-163961049 ATCAATTATCATCACATCAATGG - Intergenic
1005232981 6:23725857-23725879 CTCAGTTATACTCTCTTCTAGGG + Intergenic
1007384999 6:41514496-41514518 CTCAAATATCCTCACCTCCAAGG + Intergenic
1009165991 6:60341709-60341731 CTCAGTCAGCATCACTTATAGGG + Intergenic
1010258068 6:73783108-73783130 TTCAGTTAGCAGCACTGCCAGGG - Intronic
1011955655 6:93022027-93022049 CTCATTTATCATAAGTTTCATGG + Intergenic
1012256263 6:97036524-97036546 CTCAGGTATCATCACATCTCAGG - Intronic
1016626613 6:146177623-146177645 CTCAGTTATCATTATTTAAATGG + Intronic
1017446819 6:154514478-154514500 CTCATCTATCAACTCTTCCAAGG - Intergenic
1019512361 7:1424106-1424128 CACTGTTGTCCTCACTTCCATGG + Intergenic
1020711497 7:11611905-11611927 CTCAGTTACCATATCTTTCAGGG - Intronic
1021199071 7:17707149-17707171 ATCATTTGTCATCATTTCCAGGG - Intergenic
1021321008 7:19211452-19211474 CTCAGTGAGCGTCACATCCAAGG - Intergenic
1026384291 7:69830609-69830631 CTCAGTTATAATGAAATCCAAGG - Intronic
1029926132 7:104319921-104319943 ATCATTTATCATGACTTACATGG + Intergenic
1030123879 7:106136416-106136438 CTCAGTTCTCAACACTTTCTGGG - Intergenic
1031436466 7:121738088-121738110 CTCTGTCACCACCACTTCCAAGG - Intergenic
1031766106 7:125779646-125779668 ATCAGTAATCATCTCTTCAAGGG - Intergenic
1035060101 7:156062732-156062754 CCCTATTATCATCAATTCCAAGG - Intergenic
1035692189 8:1567565-1567587 CTCATTCACCATCACTGCCACGG + Intronic
1037753066 8:21695257-21695279 CTCTGTTATCATCACTGTAATGG + Intronic
1038717028 8:30000317-30000339 GTCAGTTATCCTGACTTTCAGGG + Intergenic
1039980441 8:42405491-42405513 TTCATTTCTCTTCACTTCCAGGG - Intronic
1043219830 8:77646410-77646432 ATCAGTTATAATCAATTACAAGG - Intergenic
1043401466 8:79889310-79889332 TTTAGTTCTCATCACTTCCCAGG + Intergenic
1046237611 8:111447269-111447291 CTCAGTTATCATCACGGGGATGG + Intergenic
1046568075 8:115926613-115926635 TTCAGGTATCATGACTTCCTTGG - Intergenic
1046855824 8:119030606-119030628 CTCAGTTTTCATCACTAAGATGG + Intronic
1047185071 8:122625570-122625592 CTCAGTTATCAGTGCTCCCATGG - Intergenic
1047506705 8:125486062-125486084 CTCAGATCCCATCACTTCCGAGG + Intergenic
1047582788 8:126235155-126235177 CTTAGCTATCAGGACTTCCATGG - Intergenic
1048354815 8:133644586-133644608 CTCAGGTATCATAATTTCCCTGG + Intergenic
1050960910 9:11729550-11729572 CTCTGTTTTAATCACTTCCAAGG - Intergenic
1055480566 9:76705334-76705356 CTCAGGTCTCAACACATCCACGG - Exonic
1059030383 9:110687251-110687273 CTCACTCATCTTCACTTGCAGGG - Exonic
1059459708 9:114421904-114421926 CTGAGTTGCCATCATTTCCAAGG - Intronic
1059742664 9:117167916-117167938 ATCAGTTCTTATCACCTCCATGG - Intronic
1203718778 Un_KI270742v1:182784-182806 CTCAGTTATCATACCTTCAGAGG - Intergenic
1203653006 Un_KI270751v1:146458-146480 CTCAGTTATCATACCTTCAGAGG - Intergenic
1185809722 X:3095145-3095167 CTCAGAAATAATCATTTCCATGG + Intronic
1186539128 X:10382348-10382370 CTCAATAATCATCTCCTCCATGG + Intergenic
1186798562 X:13069902-13069924 CTCAGTTATCACTTCTTACATGG - Intergenic
1188302452 X:28521797-28521819 CTCTGTTTTCATTACTTCAAAGG + Intergenic
1189508161 X:41634093-41634115 CTCCCTTTTAATCACTTCCAAGG + Intronic
1189886693 X:45553741-45553763 CTCAGTAATTATCTCTTCAAAGG - Intergenic
1192048014 X:67696873-67696895 CTAAGGTATCCTGACTTCCAGGG - Intronic
1195162461 X:102183962-102183984 CTAACTCAACATCACTTCCATGG - Intergenic
1196396444 X:115267592-115267614 CTCAGAGATCATCTCTTACATGG - Intergenic
1196859122 X:120011221-120011243 CTCAACTATCACCACTACCAGGG - Intergenic