ID: 1156445712

View in Genome Browser
Species Human (GRCh38)
Location 18:37235368-37235390
Sequence GGCCCTGCAAAGAGTGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156445699_1156445712 28 Left 1156445699 18:37235317-37235339 CCAGGCTTTCTTTTGATCCCTGT 0: 1
1: 0
2: 1
3: 32
4: 351
Right 1156445712 18:37235368-37235390 GGCCCTGCAAAGAGTGGGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 234
1156445703_1156445712 10 Left 1156445703 18:37235335-37235357 CCTGTTCAGAGTTAGGGCAACAT 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1156445712 18:37235368-37235390 GGCCCTGCAAAGAGTGGGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 234
1156445702_1156445712 11 Left 1156445702 18:37235334-37235356 CCCTGTTCAGAGTTAGGGCAACA 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1156445712 18:37235368-37235390 GGCCCTGCAAAGAGTGGGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156445712 Original CRISPR GGCCCTGCAAAGAGTGGGCC AGG Intergenic
900135948 1:1117008-1117030 GGCCCAGCTAGGAGAGGGCCCGG - Intergenic
900175884 1:1291191-1291213 GGCCCTGCACAGAAGGGGCACGG + Intronic
900183297 1:1321837-1321859 GCCCCTGCACAGACTGTGCCTGG + Intronic
900436668 1:2634299-2634321 GCCCCTGCTGAGAGTAGGCCAGG - Intergenic
900476629 1:2879250-2879272 GGCCCACCAAGGAGTGGCCCCGG - Intergenic
900628885 1:3623482-3623504 GGCCCAGAAAAGAGTGGTCAGGG - Intergenic
900956229 1:5887912-5887934 GGCCATGCACAGAGAGGGCAGGG + Intronic
901053137 1:6435726-6435748 GGTCCTGCCAAGTATGGGCCAGG - Intronic
901260385 1:7866440-7866462 AGCCTTGCACAGAGGGGGCCTGG - Intergenic
902199656 1:14823816-14823838 GGCCAGGGAATGAGTGGGCCCGG + Intronic
902290071 1:15429545-15429567 GGCTCTGGAGAGAGTGGGGCGGG + Exonic
902525142 1:17052447-17052469 GGCCCTGCAAAGACCTTGCCTGG + Intronic
902600368 1:17536787-17536809 GGCCCTGCAGAGTGTGGCCCTGG + Intergenic
904005899 1:27363058-27363080 GTCCCTGGACAGAGTAGGCCAGG - Intronic
906324410 1:44835850-44835872 GGTACTGCTAAGAGTGAGCCAGG + Intronic
906733794 1:48105263-48105285 GGGCCTGCAGGGAGTGGGCGAGG - Intergenic
907470098 1:54668071-54668093 GACCATGCAAAGAGAGGCCCTGG - Intronic
907844245 1:58189591-58189613 GGACCTGCAACCAGTGGGCAGGG - Intronic
907948281 1:59155721-59155743 GGCCTAGCATAGAGAGGGCCTGG + Intergenic
916430351 1:164722049-164722071 GGACCTGTAAAGAGTCGGTCAGG - Intronic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
921200311 1:212799024-212799046 GGCCATGCAAAGAGAGGATCAGG + Intronic
922597139 1:226822849-226822871 GGCCATGCAAGGAAGGGGCCAGG - Intergenic
1063379639 10:5576155-5576177 AGCCCAGGAAAGGGTGGGCCTGG - Intergenic
1063608596 10:7544142-7544164 GGCCCTGCCAAGAGGGTGCCTGG + Intergenic
1067784022 10:49229532-49229554 TCCCCTTCAAGGAGTGGGCCTGG - Intergenic
1069469712 10:68677088-68677110 GGCCCTCCAAAAAGTGAGCAAGG - Intronic
1071342890 10:84664767-84664789 GGCCTGGCAAAGAAAGGGCCTGG + Intergenic
1072021744 10:91409964-91409986 AGCCCTGCAAAGGGTCGGACGGG - Intergenic
1072539485 10:96387305-96387327 GGCTCTGCCAAGAGAAGGCCAGG + Intronic
1073173851 10:101537989-101538011 GGCACTTCTAAGAGTGGCCCAGG - Intronic
1073268831 10:102244727-102244749 GGCGATGAAAAGAGTTGGCCTGG + Intergenic
1076357071 10:129861064-129861086 GGCCCTTTGAAGAGTGGGGCCGG - Intronic
1077014792 11:394720-394742 GGTCCTCCAAAGACTGAGCCTGG + Intronic
1078020907 11:7655293-7655315 GGACAGGCAAGGAGTGGGCCAGG - Intronic
1084004823 11:66317136-66317158 GGCCTTGTAAGGAGTGGGCTGGG + Intergenic
1084191992 11:67503641-67503663 GGCAGTGAGAAGAGTGGGCCAGG - Intronic
1084599012 11:70133854-70133876 GGAGCTGCAGAGGGTGGGCCAGG - Intronic
1085309051 11:75505440-75505462 GGTCATGCAGTGAGTGGGCCTGG - Intronic
1085534986 11:77212299-77212321 GACCCTGGAAAGAGTGCTCCTGG + Intronic
1088526939 11:110766660-110766682 GGCCCAGCAAAGAGCAGGCATGG + Intergenic
1089215861 11:116834318-116834340 GGCCCTGCAGAGAGAGGGTAGGG + Intergenic
1089432745 11:118436821-118436843 GGCCCTGCTCCGGGTGGGCCCGG + Exonic
1089538511 11:119175142-119175164 GACCCTGCAAAAGGTGGGCAAGG + Exonic
1090990797 11:131815369-131815391 GGCCCAGCACAGGGTGGGCGAGG - Intronic
1091833621 12:3568667-3568689 GTCCCTGCAAAGTATGGCCCTGG + Intronic
1092529482 12:9332607-9332629 AGCTCTGCAAAGAGAGTGCCTGG - Intergenic
1093440438 12:19189199-19189221 GGTCCTGCACAGTGTGGCCCCGG - Intronic
1093730345 12:22559302-22559324 GGCCCTTCCAAGAGTGAGGCAGG - Intergenic
1096685020 12:53282549-53282571 GAACCTGCACAGAGTAGGCCTGG + Intronic
1096776561 12:53967847-53967869 GGACTTGCAGAGAGTGGGGCAGG + Intergenic
1096967086 12:55637161-55637183 AGCCCTGGAAAGAGATGGCCTGG - Exonic
1099079368 12:78157292-78157314 GGCCCCGCAAAGTGTTGGCTGGG - Intronic
1107295451 13:38902350-38902372 GGCCCTGCAATCAGTGGTCTGGG - Intergenic
1108623037 13:52202714-52202736 GGCCCTGCTAAGAGAGTGCAGGG - Intergenic
1110333300 13:74297257-74297279 GGCCCTGCAACTAGTGCTCCAGG - Intergenic
1114675349 14:24436529-24436551 GGGCCTGCTGAGAGAGGGCCAGG - Intronic
1115797881 14:36959492-36959514 GGCCCTGGAAAATGTGGGCAAGG - Intronic
1117400976 14:55358378-55358400 GGCCCTGCAAATACTGGGAAGGG - Intronic
1119428920 14:74553059-74553081 AGCCCTGCAGAGAGAGGGCTTGG + Exonic
1120202813 14:81555630-81555652 GGCCCTGCCAGGTGTGTGCCAGG - Intergenic
1120504177 14:85334089-85334111 GGCACTGCAGAGAGTCGGCTAGG + Intergenic
1120680244 14:87472208-87472230 GGCCCAGCAGAGAGGGAGCCTGG - Intergenic
1122551407 14:102552110-102552132 GGCCCTGCCACGGGAGGGCCTGG - Intergenic
1124645843 15:31437078-31437100 TTCCCTGCAAAGACTGGGCCAGG + Intergenic
1128087278 15:64894810-64894832 GGCCCTGCAGAGAGAGGGGAGGG + Intronic
1128382706 15:67125156-67125178 GGCCCAGCAGTGGGTGGGCCTGG - Intronic
1128410212 15:67389372-67389394 GGATCAGCAAAGAGAGGGCCTGG - Intronic
1129283835 15:74507523-74507545 GGCCCTACTAAGTGTGGGCCTGG - Intergenic
1129690531 15:77710814-77710836 GGCCCTGCAATCTGGGGGCCTGG - Intronic
1129910304 15:79221191-79221213 GCCCCTGCAAAGTGTGGGGCTGG - Intergenic
1132666082 16:1081949-1081971 GGCCCTGCAGGGAGAGCGCCCGG - Intergenic
1132871775 16:2118600-2118622 GGCCCTGCAGACACTGGGCAGGG - Intronic
1134201758 16:12205052-12205074 GGCCTTCCAAAGAATGGGGCAGG + Intronic
1134520752 16:14918295-14918317 GGCCCTGCAGACACTGGGCAGGG + Intronic
1134550823 16:15137678-15137700 GGCCCTGCAGACACTGGGCAGGG - Intronic
1134708424 16:16316946-16316968 GGCCCTGCAGACACTGGGCAGGG + Intergenic
1134715639 16:16356979-16357001 GGCCCTGCAGACACTGGGCAGGG + Intergenic
1134951178 16:18351699-18351721 GGCCCTGCAGACACTGGGCAGGG - Intergenic
1134959118 16:18395180-18395202 GGCCCTGCAGACACTGGGCAGGG - Intergenic
1135471388 16:22734558-22734580 AGCCCTGCCAGGAGTAGGCCGGG + Intergenic
1136986120 16:35106705-35106727 AGCTCTGCAAAGAGAGTGCCTGG - Intergenic
1137624810 16:49900873-49900895 TGCCCTGCAAAGAGTGTGCAGGG + Intergenic
1138077776 16:54059347-54059369 GGCCCTGCAAAGAGATGACTAGG - Intronic
1138142860 16:54583399-54583421 GGGCCATCAAAAAGTGGGCCTGG - Intergenic
1138526850 16:57613675-57613697 AGCCGTGGAAAGAGTGGGCCTGG - Intronic
1138560500 16:57798171-57798193 GGGCCTGTGGAGAGTGGGCCGGG - Exonic
1139650892 16:68361554-68361576 GGCCATGCAAAGAGAGAGCAGGG - Intronic
1139775542 16:69314766-69314788 GGCCCTGCCAAGAGCCGGTCAGG + Intronic
1141461173 16:84179606-84179628 GGCCCTGCTAAAAGTGCCCCTGG - Exonic
1141480693 16:84304791-84304813 AGGGCTGCAAAGAGGGGGCCAGG + Intronic
1141722776 16:85766052-85766074 GAGTCTGCAAAGAGTGGGCCAGG - Intergenic
1142137977 16:88460262-88460284 GGCCCTGCCAACAGTAGGCTGGG - Intronic
1142903421 17:3027121-3027143 GGCCCTGCTAACAGTGGACAGGG - Intronic
1143081296 17:4383335-4383357 GCCCCTGTAAAGAATGGGCAAGG - Intergenic
1143585755 17:7849389-7849411 GGCCCCGCCAAGATCGGGCCGGG - Exonic
1144494238 17:15736711-15736733 GGCCCTGCAGGCAGTGGGGCTGG - Intronic
1144584806 17:16481751-16481773 GGCCCTCCAGACAGTGGGGCAGG + Intronic
1144639814 17:16931116-16931138 GGCCCTGCAGGCAGTGGGGCTGG + Intronic
1144726336 17:17504424-17504446 AGCCCTCCAAGGAGAGGGCCAGG + Intergenic
1144906023 17:18639965-18639987 GGCCCTGCAGGCAGTGGGGCTGG + Intronic
1145019268 17:19416828-19416850 GGCCCAGCAAAGAGTGGTTCAGG - Exonic
1145791887 17:27632519-27632541 GGACCTGCACAGAGGGGGCTGGG + Intronic
1146401435 17:32503172-32503194 GGCCCTGCACAAAGTGGGACAGG + Intronic
1147134249 17:38426020-38426042 GGCTCTGGAAAAAGTGAGCCAGG + Intergenic
1147573477 17:41585734-41585756 TGCCCTGCACAGAGAGAGCCTGG - Intronic
1147602382 17:41754531-41754553 GACCCAGCAAAGAGGGCGCCAGG + Intergenic
1148693658 17:49546718-49546740 TGCCCTGCACTGAGGGGGCCTGG - Intergenic
1148865480 17:50626109-50626131 GGCCCCAGAAAGAGTAGGCCCGG - Exonic
1150060801 17:62066160-62066182 TTCCCCGCAAAGAGAGGGCCAGG - Intergenic
1151305798 17:73262005-73262027 GCCCCTGCACTGGGTGGGCCGGG - Intronic
1152012474 17:77726981-77727003 GAACATGCAAAGAGGGGGCCAGG - Intergenic
1152068666 17:78124760-78124782 GGCCTTGCACAGCCTGGGCCTGG - Exonic
1152354334 17:79799354-79799376 GGGCCTTCCCAGAGTGGGCCGGG + Intronic
1152736705 17:82000817-82000839 GGCACTTCAAAGACAGGGCCAGG - Intronic
1153503079 18:5768582-5768604 CACCCTGCAGTGAGTGGGCCGGG + Intergenic
1153824926 18:8866485-8866507 GCCCCTGCTAAGAGGTGGCCTGG + Intergenic
1155606014 18:27606708-27606730 GGCCCAGCAAAGAGTAGTTCTGG + Intergenic
1156182973 18:34627438-34627460 GGCCCTGAGAAGAGTGGACTGGG - Intronic
1156244307 18:35283505-35283527 GCCCCTGCCAAGGGTGAGCCAGG + Intronic
1156445712 18:37235368-37235390 GGCCCTGCAAAGAGTGGGCCAGG + Intergenic
1157370184 18:47103730-47103752 GGCCATGGAAACAGTGGGCATGG - Intergenic
1157505559 18:48223642-48223664 GGCCATACAAAGAGGTGGCCAGG + Intronic
1158162591 18:54502254-54502276 GGCTCTGGAATGAATGGGCCAGG + Intergenic
1160692828 19:467664-467686 GGCCCTGCATGGAGTAGGCAGGG + Exonic
1160840803 19:1146337-1146359 GGCCCTGCAAACAGCTCGCCGGG - Intronic
1160895854 19:1401518-1401540 GCCCCTGCAGGGAGCGGGCCCGG - Exonic
1161713501 19:5863205-5863227 AGCCCTGCTCAGAGAGGGCCAGG - Intergenic
1162826799 19:13257548-13257570 GACCCTGCAAGGAATGGGGCAGG + Exonic
1164573661 19:29392535-29392557 GGCCCTCCATGGAGTGGGCCTGG + Intergenic
1164728088 19:30480271-30480293 TGCCCTGCAAGGAGAGGTCCCGG - Intronic
1165739278 19:38195915-38195937 GGCCCCCCAAAGACGGGGCCTGG + Intronic
1166094431 19:40530391-40530413 GGCCCCGCAAAGAGGCGGGCAGG + Intronic
1166364900 19:42273383-42273405 GGCCTGGCAGACAGTGGGCCTGG + Intronic
1167623287 19:50570253-50570275 GGTCCAGCACAGAGTAGGCCAGG + Intergenic
1167761876 19:51454837-51454859 GGCCCTGCAGACAGTGGGAGGGG - Intronic
1168272608 19:55258395-55258417 GGCCCTGGAGAGAGAGGGTCGGG + Intronic
926137537 2:10347260-10347282 GGCTCAGAAAAGGGTGGGCCGGG - Intronic
927146956 2:20172476-20172498 GGACCTGCAGAGAGTTGCCCAGG + Intergenic
931803219 2:65778799-65778821 GGCACTGTAATTAGTGGGCCTGG + Intergenic
933474076 2:82766491-82766513 GGGCCTGTAGAGAGTGTGCCTGG - Intergenic
934478058 2:94605943-94605965 GGGCCTGCAAAGAGAGTGCTGGG + Intergenic
936091830 2:109506504-109506526 GGCCTTGCAGAGGGTGGGGCAGG + Intergenic
937094626 2:119227371-119227393 AGCCCTGCACTGAATGGGCCAGG + Intronic
938242284 2:129752762-129752784 GGCCCAACAAAGAGTGGTTCCGG + Intergenic
939815908 2:146896922-146896944 GGTCCTTCAAAAAGTGGGCAAGG - Intergenic
944220202 2:197295889-197295911 GTCCCTACAAAAAGTGAGCCAGG + Intronic
947542795 2:230990395-230990417 GGCCCTCGACAGACTGGGCCGGG - Intergenic
948301691 2:236912360-236912382 GTCCCTGCAGAGAGAGAGCCAGG - Intergenic
948498077 2:238367652-238367674 AGCCCTGCACAGAGAGGGCTCGG - Intronic
948611068 2:239167364-239167386 AGCCCTGCATAGAGGGAGCCAGG - Intronic
948770409 2:240248772-240248794 GGCCCTGCAGAGGGTGAGGCAGG - Intergenic
1169122218 20:3103708-3103730 AGCCCTGCAAAGATTGGCTCTGG + Intergenic
1172181479 20:33006465-33006487 GGCCTAGCACAGGGTGGGCCTGG + Intergenic
1172776840 20:37412727-37412749 AGCCCTGCAGAAAGGGGGCCAGG - Intergenic
1173640921 20:44601314-44601336 TGCCATTCAAAGAGTGGCCCTGG - Intronic
1175756855 20:61535675-61535697 GGCCCTTCTGAGAGGGGGCCCGG + Intronic
1175952748 20:62592164-62592186 GGCCCTGCAGAGAGTGAGCTGGG + Intergenic
1176365688 21:6031530-6031552 GGCACAGCAAGGAGTGGTCCAGG + Intergenic
1178056330 21:28803036-28803058 GGCCCTTCTAAGAATGGGTCAGG + Intergenic
1179757828 21:43507015-43507037 GGCACAGCAAGGAGTGGTCCAGG - Intergenic
1180957992 22:19749774-19749796 GGCACTGCAGAGAGGGGCCCTGG + Intergenic
1181103062 22:20554433-20554455 GGCCCTGCACACAGGGGCCCAGG + Intronic
1181427138 22:22850998-22851020 GGCTCTGCAGAGAGTGGGTTAGG + Intronic
1181462106 22:23091992-23092014 GGCCAGGAAAAGAGTGTGCCAGG - Intronic
1182097398 22:27635312-27635334 GCCCCTGCATTGAGGGGGCCAGG - Intergenic
1182771748 22:32801572-32801594 GGCCCTCCAAAAAGGGGGCGGGG - Intronic
1184750690 22:46484620-46484642 GGTGCTGCAGTGAGTGGGCCAGG - Intronic
1184851713 22:47124912-47124934 GTGCCTGCAGAGATTGGGCCAGG + Intronic
1185139184 22:49090761-49090783 GGAGCTGCAAAGAGAGGGGCTGG - Intergenic
950704003 3:14768936-14768958 GTCCCTGCTGACAGTGGGCCAGG - Intronic
954332176 3:49896937-49896959 GCCCCTGGAAGAAGTGGGCCTGG - Intronic
955888046 3:63621112-63621134 GGACATGCAAGGAGTGGGGCGGG + Intergenic
968548771 4:1212124-1212146 GGCACTGCAGAGACTGGTCCGGG - Exonic
969318439 4:6395886-6395908 TGCCCTGCAGAGAGGGGGCCTGG - Intronic
969985887 4:11210175-11210197 ATCCCTGCAATGCGTGGGCCTGG + Intergenic
970120294 4:12746042-12746064 GGTCCTGCAAAGTATAGGCCAGG + Intergenic
975122933 4:70748838-70748860 GGCCCAGGAAAGAGTGGTCAGGG + Intronic
977420304 4:96791272-96791294 GGCACTACAAAGACTAGGCCTGG - Intergenic
981154045 4:141413087-141413109 GATCATGCAAAGAGTGGGCAGGG - Intergenic
981646944 4:147009687-147009709 TGCCATGCAAAGTGTGGGCACGG - Intergenic
983735234 4:171050351-171050373 AGCCATGCAAAAAGAGGGCCAGG + Intergenic
985524164 5:393516-393538 GGCCCTGCAGACACTGGGACAGG - Intronic
985662705 5:1165288-1165310 GGCCCTGGAAACCATGGGCCCGG - Intergenic
990523700 5:56604548-56604570 TGTCCTGCAGAGAGTGGCCCGGG - Intronic
994999846 5:107113617-107113639 CTCCCTGCAAAGAGTGTGACAGG + Intergenic
995158165 5:108940952-108940974 GGCCCTTCAAAGACTAGGCTGGG + Intronic
1001826956 5:174752737-174752759 AGGGCTACAAAGAGTGGGCCCGG - Intergenic
1002041803 5:176520244-176520266 GGCACTGGAAAGAGAGGGCAGGG + Intergenic
1002316900 5:178349517-178349539 GGCCCTGCCTAGGGAGGGCCAGG - Intronic
1002711165 5:181195721-181195743 GGCCCTGCAAAGACTGTGCCAGG - Intronic
1007667328 6:43522835-43522857 GGCCCTGTAAAGAGAGGACATGG - Exonic
1007694029 6:43720218-43720240 GGCCCTGGGAGGAGTGCGCCTGG + Intergenic
1010198618 6:73263627-73263649 TGCCCTGCAGAGGGTGGGCCTGG - Intronic
1010688040 6:78875360-78875382 GGCCCGGCAAAGAGATTGCCAGG - Intronic
1015793387 6:136986500-136986522 GCCCCAGCAAAGTGTGGGCCTGG - Intergenic
1016761938 6:147747327-147747349 GGCCCTGCAAATGGAGGGGCAGG + Intergenic
1016932924 6:149427447-149427469 TGCCCTGCACAGTGTGGGACAGG + Intergenic
1017524743 6:155232639-155232661 GGCTCAGCACAGAGTGGGTCAGG + Intronic
1018399138 6:163404909-163404931 TGCCCTAGAAACAGTGGGCCTGG - Intergenic
1018899704 6:168044879-168044901 GGCCCTGCAACGTCTGTGCCAGG - Exonic
1019216734 6:170448582-170448604 GGCCCTGGCAGGCGTGGGCCTGG + Intergenic
1020022885 7:4879524-4879546 AGCTCTGGAAAGAGTGGTCCAGG + Intronic
1021228194 7:18052852-18052874 GGTCCTGCAGGGAGTTGGCCAGG - Intergenic
1022515784 7:30974313-30974335 GGCACTGCAAAGGCAGGGCCAGG - Intronic
1023095324 7:36654436-36654458 GGACCGGCAAGAAGTGGGCCTGG + Intronic
1024085865 7:45890791-45890813 GGACCAGGAAGGAGTGGGCCAGG - Intronic
1024677215 7:51647549-51647571 GGCCCTGCAGGCAGTGGGCTTGG + Intergenic
1024988293 7:55214379-55214401 GGCCCAGAAAAGAGAGGGGCAGG + Intronic
1025035338 7:55589994-55590016 GGCCCTGGTATGAGTGGGCTTGG + Intergenic
1025988275 7:66474637-66474659 GGGCCTGGCAGGAGTGGGCCGGG - Intergenic
1027320472 7:77006912-77006934 GGCCCTGCCCAGGGTGGTCCCGG + Intergenic
1028113691 7:86973478-86973500 GGTCCTGCAAAGAGTAGGGGTGG - Intronic
1029307226 7:99629331-99629353 GGCCCTGCAGGCAGTGCGCCTGG + Exonic
1034252324 7:149702058-149702080 GGCTCTGCAGAGTGTGCGCCTGG + Intergenic
1034342709 7:150368665-150368687 GCCCCCGCCAAGAGCGGGCCGGG - Intronic
1034397337 7:150837163-150837185 GAGCCTGCTCAGAGTGGGCCTGG + Intronic
1036803282 8:11808651-11808673 GGCCCTGCAAGGACTGGCCTCGG + Intronic
1037477861 8:19275433-19275455 GCCCCTGCATAGAGCAGGCCTGG + Intergenic
1037942135 8:22959547-22959569 AGCCCTAGAAAGAGTAGGCCAGG - Intronic
1037943970 8:22974995-22975017 GGCCCTGGAAAGAGATGTCCAGG - Intronic
1038401584 8:27288235-27288257 GTCCATGCAAGGAGTGGCCCAGG + Intronic
1042748265 8:72131278-72131300 GGCCCTGCAGTGATTGGGGCAGG + Intergenic
1044536215 8:93358998-93359020 GGCCTGGCAAAGAGTGGCCTGGG - Intergenic
1047125878 8:121960089-121960111 GGGCCACCAAAGAGTGAGCCTGG - Intergenic
1049300454 8:141866882-141866904 GGGCCTGCTGAGAGTCGGCCTGG - Intergenic
1051525295 9:18036245-18036267 GGCCCTGCAAAAAGAGAGGCAGG + Intergenic
1052974601 9:34401525-34401547 TGCCCTGCACAGGGTGGGCCTGG - Intronic
1053607760 9:39678662-39678684 GGCCCTGGAGAGAGAGGGTCAGG - Intergenic
1053865608 9:42435022-42435044 GGCCCTGGAGAGAGAGGGTCAGG - Intergenic
1053929994 9:43108475-43108497 GGGCCTGCAAAGAGAGTGCTGGG - Intergenic
1054245775 9:62663747-62663769 GGCCCTGGAGAGAGAGGGTCAGG + Intergenic
1054559900 9:66698278-66698300 GGCCCTGGAGAGAGAGGGTCAGG + Intergenic
1056824769 9:89869208-89869230 GGCCCTCCAAAGATCTGGCCTGG - Intergenic
1057570973 9:96204067-96204089 AGCCCTGCGAGGAGGGGGCCTGG + Intergenic
1057816867 9:98302447-98302469 GGCCGTGAAAAGAGAGGGCCCGG - Intronic
1059812161 9:117867491-117867513 GATCCTGCAAAGCGTGGCCCAGG + Intergenic
1060066320 9:120504286-120504308 TGCCCAGCAAAGACTAGGCCTGG + Intronic
1060213617 9:121725290-121725312 GTCCATGGAAAGATTGGGCCTGG + Intronic
1060455341 9:123788010-123788032 AGCCCTTTAAAGAGTGGTCCAGG - Intronic
1061262887 9:129489760-129489782 TGCCCTCCAACCAGTGGGCCTGG + Intergenic
1061287344 9:129631585-129631607 GGCCCAACAGAGAGTGGCCCGGG - Intronic
1061318568 9:129813711-129813733 AGCCCTGCGATGAGTGGGCTGGG + Exonic
1061412843 9:130430537-130430559 GGCCCTGAGCAGTGTGGGCCGGG + Exonic
1061747849 9:132753317-132753339 GGCCCTGCAGGATGTGGGCCTGG + Intronic
1061945924 9:133908139-133908161 GGCCCCCCAAAGAGTGGAACTGG + Intronic
1062025058 9:134336367-134336389 GCCCCTGCAGACAGTGGGCCTGG + Intronic
1062175479 9:135159749-135159771 GGCCCTGCAAAGAGGCACCCTGG - Intergenic
1062208221 9:135348836-135348858 GGACCTGCAAAGAGGGTGCTGGG + Intergenic
1203760454 EBV:10583-10605 TGCCCTGCAAGGCCTGGGCCCGG - Intergenic
1203769723 EBV:43368-43390 GGTCCTGCATCCAGTGGGCCAGG + Intergenic
1189713816 X:43844168-43844190 GGGCCTTCAAAGTGTGTGCCAGG + Intronic
1192334238 X:70204286-70204308 TGCCCTGCAAAGAGAGGGGCAGG - Exonic
1193085572 X:77446125-77446147 GGCGCTGCAAAGAGAGGGGATGG + Intergenic
1199858717 X:151780759-151780781 GGCCCTGCATAGACTGGGGGTGG + Intergenic
1200267976 X:154656062-154656084 CGCCCTGCACAGGGTGGGCCTGG + Intergenic