ID: 1156446488

View in Genome Browser
Species Human (GRCh38)
Location 18:37241004-37241026
Sequence GATTATGGAGAGAGAGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156446488_1156446492 18 Left 1156446488 18:37241004-37241026 CCCTGAGCTCTCTCTCCATAATC No data
Right 1156446492 18:37241045-37241067 TAGTTTCCAGCAAGTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156446488 Original CRISPR GATTATGGAGAGAGAGCTCA GGG (reversed) Intergenic
No off target data available for this crispr