ID: 1156447013

View in Genome Browser
Species Human (GRCh38)
Location 18:37244631-37244653
Sequence CTGTTTCAAGAACAGCCATG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 300}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156447013 Original CRISPR CTGTTTCAAGAACAGCCATG AGG Exonic
901259367 1:7860374-7860396 CTGTTTGAGGAACAGCCAGGAGG + Intergenic
901517066 1:9755006-9755028 CTATTTCAAAAACAGTCTTGGGG + Intronic
901896471 1:12317195-12317217 CTATTTCAAGAAGATCAATGAGG - Intronic
902103135 1:14010569-14010591 CAGTTTCAAGCTGAGCCATGGGG - Intergenic
903385525 1:22923891-22923913 CTGCTTTATGAACAGCCATAAGG - Intergenic
904485328 1:30821106-30821128 CTGTTTCAAAAAAAGAAATGAGG - Intergenic
905847368 1:41243495-41243517 CTGTCTCATGAAGAGCCCTGAGG + Intergenic
905958990 1:42027558-42027580 CTGTGTGAAGAACAGCAAGGAGG - Intronic
906238842 1:44229165-44229187 CAGGCTCAAGAACAGACATGGGG + Intronic
907434668 1:54437072-54437094 CTGTCTCAATGACATCCATGAGG - Intergenic
907615422 1:55919689-55919711 CTGTCACAAGAACAGCACTGGGG - Intergenic
908266269 1:62382201-62382223 GTGCATCAAGAACACCCATGGGG - Intergenic
909678226 1:78261885-78261907 CTGGTACAAAAACAGACATGTGG + Intergenic
909688009 1:78372598-78372620 CTGTTACAAGACCAGCCAGGGGG + Intronic
909731778 1:78900598-78900620 CTGTCACAAGAACAGCAAAGGGG - Intronic
910203701 1:84725965-84725987 CTGTCACAAGAACAGCAAGGGGG - Intergenic
911540493 1:99151815-99151837 CTATTACAAGAACAGCAAAGGGG + Intergenic
916699098 1:167272667-167272689 CTATTACAAGAACAGCAAGGGGG + Intronic
917152656 1:171961311-171961333 CAGTGACAAGAGCAGCCATGAGG + Intronic
917758129 1:178124087-178124109 ATGTCTCAGGAACACCCATGGGG - Intronic
920256882 1:204661582-204661604 CTGTCTCAAGATCACCCTTGGGG - Intronic
924695612 1:246396691-246396713 CTGTCACAAGAACAGCAAGGGGG - Intronic
1063056603 10:2511373-2511395 CTCTTACAAGAACAGCAATGGGG + Intergenic
1065211378 10:23406727-23406749 CTATCTCAAGAACAGCAATGGGG + Intergenic
1066684380 10:37966650-37966672 CTATCTCAAGAACAGCAAGGGGG + Intronic
1067168029 10:43880829-43880851 CTGTTTCTAAAATAGCCAGGAGG - Intergenic
1068305061 10:55198363-55198385 CTGTCACAAGAACAGCAAGGGGG - Intronic
1068604356 10:58989121-58989143 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1069071852 10:63997829-63997851 CTTATTCAAAAACAGACATGGGG + Intergenic
1070640427 10:78164969-78164991 CTGTTTCATGAATACCCATCGGG - Intergenic
1071710066 10:88041377-88041399 CTGTTGCATGATTAGCCATGAGG - Intergenic
1072307624 10:94122513-94122535 CTGTTCCATTTACAGCCATGGGG + Intronic
1073234016 10:101997849-101997871 CTGTTTCCACCACCGCCATGAGG - Intronic
1073911825 10:108354399-108354421 CTGATTAAAGAAAAGTCATGAGG + Intergenic
1074056220 10:109924514-109924536 CTTTTTCAAGGAGAGCCAGGAGG - Intergenic
1074440091 10:113470660-113470682 CTGTTTCAAGTAAAGCAAGGTGG + Intergenic
1075196934 10:120367997-120368019 TTGGTCCAAGGACAGCCATGTGG - Intergenic
1075229741 10:120665479-120665501 ATGCTTCAAGAACTACCATGTGG - Intergenic
1076460372 10:130640162-130640184 CTGTTTTGAGAACAGCAAGGGGG + Intergenic
1078155325 11:8794995-8795017 CTGTTTCAGGGACAGCCAGCAGG - Intronic
1079769850 11:24445271-24445293 CTATTACAAGAACAGCAAGGGGG - Intergenic
1079992032 11:27256339-27256361 CTGTCACAAGAAAAGCAATGGGG + Intergenic
1080634279 11:34109893-34109915 TTGTTTCAGGCCCAGCCATGTGG + Intronic
1080990425 11:37528549-37528571 CTATCACAAGAACAGCAATGGGG + Intergenic
1086131274 11:83404998-83405020 CTATCTCAAGAACAGCCTGGGGG - Intergenic
1086277190 11:85145534-85145556 CTGTATAAAAAACAGCCATGGGG - Intronic
1087847850 11:102993477-102993499 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1088875469 11:113932634-113932656 CTGTTTCCAAAACAACTATGGGG - Intronic
1090806108 11:130203303-130203325 ATGTTTCAGGAACACCCAGGAGG - Intronic
1091427778 12:406411-406433 ACGTTTGAAGAACAGCCAAGAGG + Intronic
1093778710 12:23108666-23108688 CTGCTTCAACAACAGACAGGTGG - Intergenic
1095501657 12:42846557-42846579 CACTTTCAAGCACTGCCATGAGG - Intergenic
1096811312 12:54172292-54172314 GTGTTGGAAGAACAGCAATGAGG - Intronic
1097145036 12:56934204-56934226 CTGGTTCAAGAACTGCAATCTGG - Exonic
1097403645 12:59161167-59161189 CTATCGCAAGAACAGCAATGGGG + Intergenic
1098437109 12:70479600-70479622 CTGTCACAGGAACAGCTATGGGG - Intergenic
1099793531 12:87365687-87365709 CTCTTTCAAGAATAGGCAGGTGG + Intergenic
1100062574 12:90599661-90599683 CTATCACAAGAACAGCAATGGGG + Intergenic
1101064932 12:101011068-101011090 CTCTTTGAAGATGAGCCATGTGG - Intronic
1101139717 12:101782809-101782831 ATGTTTGAAGAAAAGCCAGGAGG - Intronic
1103535462 12:121630670-121630692 CTGTTCCTAGAACTGCCGTGTGG - Intronic
1104985741 12:132596025-132596047 CTGTAACCAGAACAGCCATGAGG - Intergenic
1105914454 13:24900262-24900284 GTGTTCAAAGAACAGCCAGGAGG + Intronic
1107199212 13:37693553-37693575 TTGCTTCAAGGACAGCCATATGG - Intronic
1107447655 13:40482846-40482868 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1108156676 13:47592324-47592346 CTGTGTCCAGAAAAGCCATTGGG - Intergenic
1108558698 13:51621784-51621806 CTGGTTCTGGAGCAGCCATGTGG + Intronic
1108739368 13:53319783-53319805 GAATTTCAAGAACAGGCATGAGG + Intergenic
1108985559 13:56582127-56582149 CTGATACAACAACAGCAATGAGG + Intergenic
1109159013 13:58949034-58949056 CTATCACAAGAACAGCAATGGGG + Intergenic
1109313122 13:60718652-60718674 CTGTTTCACGAAAAGCACTGAGG - Intergenic
1110064894 13:71091271-71091293 ATGTTTCAAGGAAAGCCATACGG - Intergenic
1111246379 13:85547338-85547360 CTGTCACAAGAACAGCAAAGGGG + Intergenic
1112896938 13:104310978-104311000 CTGTATCCAGATCAGCCTTGAGG + Intergenic
1112971983 13:105272892-105272914 CTATTACAAGAACAGCAAAGGGG + Intergenic
1113085382 13:106564885-106564907 ATGTTTCAGTAACAACCATGTGG - Intronic
1113570250 13:111348709-111348731 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1114581627 14:23765680-23765702 CTGTTTTAAGAAGAGGCAAGAGG + Intergenic
1116549121 14:46211614-46211636 CTGTTATAAGAACAGCAAGGGGG - Intergenic
1116662870 14:47734513-47734535 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1116902677 14:50377051-50377073 GTGTTTCTAGAACAGCAAGGAGG + Intronic
1117846157 14:59913820-59913842 CTGTGTCCAGCAAAGCCATGGGG + Intergenic
1118985292 14:70749327-70749349 CTGATTCAAGAACAGACAATGGG + Intronic
1118990146 14:70790485-70790507 CAGTGTCAAGGACAGCCCTGGGG + Intronic
1119989783 14:79183226-79183248 CTGCTTCAAGCAGAGCAATGAGG - Intronic
1120241834 14:81958928-81958950 CTATTACAAGAACAGCATTGGGG - Intergenic
1120326683 14:83038240-83038262 CTATTACAAGAACAGCAAGGAGG + Intergenic
1120410183 14:84144599-84144621 CTGTTTCAAACACAACCATGTGG + Intergenic
1120664568 14:87290864-87290886 CTATCTCAAGAACAGCAAGGAGG - Intergenic
1120831470 14:89001001-89001023 CTAGTTCAAGCACAGCCCTGAGG - Intergenic
1121906248 14:97749063-97749085 CTGTTTGAAGTTCATCCATGGGG + Intergenic
1125206693 15:37161487-37161509 CTATTTCAAGAACAGCATGGGGG - Intergenic
1125413354 15:39427845-39427867 CAGCTCCAAGAACAGCCCTGGGG + Intergenic
1126203695 15:46018750-46018772 CTGTCACAAGAACAGCACTGAGG - Intergenic
1126336191 15:47588615-47588637 CAGTTTGAAGACCAGCCATCTGG + Intronic
1126358420 15:47820619-47820641 CTTTTTCAAGCCTAGCCATGGGG - Intergenic
1126824931 15:52539596-52539618 CTGTTGCAAGAACAGCATGGGGG + Intergenic
1128527289 15:68421301-68421323 GTGTTTGAAGAACAGCCCGGAGG + Intronic
1130922012 15:88355238-88355260 CTGTTTCAGAAACAGGAATGGGG - Intergenic
1131570930 15:93535396-93535418 CTGTTTCAAGAGTAGCAGTGGGG - Intergenic
1132349590 15:101131285-101131307 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1132798884 16:1741733-1741755 CTGTTGTGACAACAGCCATGAGG - Intronic
1133873598 16:9712412-9712434 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1135089190 16:19499216-19499238 CAGTGTTAAGAACAGCCACGTGG - Intergenic
1137532703 16:49291289-49291311 CTGGTTCAAAAACAGGCAAGTGG - Intergenic
1138880094 16:61002734-61002756 TTGTTTCAACAAAAGCCCTGGGG + Intergenic
1139113000 16:63915459-63915481 TTGTTCCAAGAAGAGACATGTGG - Intergenic
1140121331 16:72085390-72085412 CTGTTTCAATAACCACCACGAGG + Exonic
1141914238 16:87083335-87083357 CTGTTTTAAGAACAGGCTTTAGG - Intergenic
1144442419 17:15295283-15295305 CTCTATCTAGAACACCCATGGGG + Intergenic
1147543560 17:41381058-41381080 CTGCTTGAAGAAGAACCATGAGG - Exonic
1150829250 17:68504459-68504481 CTGTCTCAAAAAAAGACATGTGG + Intergenic
1153186709 18:2494458-2494480 CTGTTTCAATAAGGGTCATGAGG + Intergenic
1153408609 18:4768465-4768487 TTGCTTCTATAACAGCCATGAGG + Intergenic
1153440959 18:5118399-5118421 CTATTACAAGAACAGCAAGGGGG - Intergenic
1153457902 18:5298635-5298657 CTGTTTCAAAACCAGCCAGAGGG - Intergenic
1156447013 18:37244631-37244653 CTGTTTCAAGAACAGCCATGAGG + Exonic
1156457083 18:37300898-37300920 AAGTTTGAGGAACAGCCATGAGG + Intronic
1156955520 18:42958170-42958192 CTCTTTCAAGATCAGCAATTTGG + Intronic
1157605969 18:48926178-48926200 CAGCTCCAAGAACAGCCATGGGG + Intronic
1157663292 18:49464476-49464498 CTGTTCCAAGAACAGCACTCAGG + Intergenic
1158963005 18:62601823-62601845 GTGTTTCTAGAACAGCAAAGGGG + Intergenic
1159677445 18:71303547-71303569 CTATTACAAGAACAGCGAGGGGG - Intergenic
1159943422 18:74426143-74426165 CTGTGTCGAGAACAGGCCTGGGG - Intergenic
1160252257 18:77212823-77212845 CTGTTAAAAGAACAGTCCTGTGG + Intergenic
1161506342 19:4645892-4645914 TTGTTACAGGAACAGCCAGGAGG - Intronic
1163518587 19:17779211-17779233 CTGTCTGAAGAACAGCAAGGAGG + Intronic
1166561704 19:43736943-43736965 CTGCAGGAAGAACAGCCATGAGG + Intronic
1167567369 19:50265135-50265157 CTTTTGCAAAAACAGCCATCTGG - Intronic
1168477571 19:56687970-56687992 CTGTTTCACGCACAGTCATGTGG - Intergenic
925369704 2:3335701-3335723 CTGTCACAAGAACAGCAAGGGGG - Intronic
925513443 2:4653091-4653113 CTGTTTCAAGGCCAGCAAAGGGG - Intergenic
929100872 2:38312311-38312333 CTGTTAAAAGAACAGCAAGGGGG - Intronic
929111722 2:38410465-38410487 CGTTTTCAACAACATCCATGAGG - Intergenic
929927944 2:46230794-46230816 CAGTTTGGAGAGCAGCCATGGGG + Intergenic
932084625 2:68747038-68747060 CTGTGTCAAGAAGATACATGGGG - Intronic
932235665 2:70119286-70119308 GTGTTTTAAGAACAGCAAGGAGG + Intergenic
933671208 2:85009149-85009171 CTATCTCAAGAACAGCAAGGGGG - Intronic
934918483 2:98321054-98321076 CTGTTTCAGCTTCAGCCATGAGG + Intergenic
935979562 2:108613573-108613595 CTGTTCCATGGACTGCCATGTGG + Intronic
936472245 2:112809626-112809648 CTATCTCAAGAACAGCAAGGGGG - Intergenic
939665479 2:144946178-144946200 CTGTTCAAAGAACAGTCATTGGG - Intergenic
940102313 2:150055346-150055368 CTATCACAAGAACAGCAATGGGG - Intergenic
941597999 2:167502662-167502684 CTATTACAAGAACAGCAAGGGGG + Intergenic
943112711 2:183625397-183625419 CTGTCACAAGAACAGCAAGGGGG - Intergenic
945074015 2:206019076-206019098 CTGTTCCAAGAACAGAAAGGAGG + Intronic
945964396 2:216170543-216170565 CTGTCACAAGAACAGCAAAGGGG + Intronic
947474284 2:230428785-230428807 CTGTCACAAGAACAGCAAGGGGG + Intronic
1168772438 20:423949-423971 AGGTTCCAAGAGCAGCCATGGGG + Intronic
1169201177 20:3710919-3710941 CTGTTTCCAGAACAGTTATCTGG - Intergenic
1169611882 20:7390208-7390230 CTGTTTCCGCCACAGCCATGAGG + Intergenic
1169780969 20:9310210-9310232 TTGGTACATGAACAGCCATGAGG + Intronic
1170319670 20:15081492-15081514 TTGGTTCAAGAATAGCCATGTGG - Intronic
1171363334 20:24606186-24606208 GTGTCTCCAGAACAGGCATGTGG + Intronic
1171505298 20:25628204-25628226 CTATCTCAAGAACAGCAAGGGGG + Intergenic
1172485194 20:35293741-35293763 GTGTTGCAAGCACAGCCATCTGG - Intergenic
1172581450 20:36051588-36051610 CTGTTCCAGGAACAGCAAAGAGG + Intergenic
1173258300 20:41410815-41410837 ATGTCTCAGGAAGAGCCATGTGG - Intronic
1173705210 20:45105181-45105203 TTGTTTCTAGAACTGCCCTGTGG + Intergenic
1173890995 20:46510228-46510250 CAGTGTGAAGAACAGCCTTGAGG + Intronic
1173975513 20:47183835-47183857 CTTTTCCAAGAACAGAGATGTGG - Intronic
1174112703 20:48207182-48207204 GTGTTTGAGGAACAGCAATGAGG - Intergenic
1174586033 20:51609108-51609130 ATGTCTGAAGAACAGCCATAAGG + Intronic
1175759821 20:61554380-61554402 ATGTTTCAAGGGCAGCCCTGTGG - Intronic
1175772076 20:61630267-61630289 GTGTATCAGGTACAGCCATGAGG - Intronic
1176166545 20:63677200-63677222 GTATTTCAAGACCCGCCATGCGG + Intronic
1176264822 20:64203649-64203671 CTGGCTCAACAGCAGCCATGGGG - Intronic
1177022262 21:15876620-15876642 CTGTCACAAGAACAGCACTGGGG + Intronic
1177312109 21:19411690-19411712 CTATTACAAGAACAGCAAGGGGG - Intergenic
1180203788 21:46244454-46244476 CTGTTTTCAGAACAGACAAGGGG - Intronic
1180657275 22:17433448-17433470 CTGTTTAAAGAACAACAATAAGG - Intronic
1184881456 22:47306975-47306997 CTCTCACGAGAACAGCCATGGGG - Intergenic
950872342 3:16240580-16240602 CTTTTTCAAACACTGCCATGGGG + Intergenic
950981631 3:17313681-17313703 CTGTTGGAAGAACTGACATGAGG + Intronic
951038506 3:17962111-17962133 CTGTGTTGAGAACAGGCATGGGG + Intronic
951249298 3:20375606-20375628 CTGTTTCACAATCAGCCCTGGGG - Intergenic
953625018 3:44563615-44563637 CTATTACAAGAACAGCAAGGGGG + Intronic
955217288 3:56994884-56994906 CTGTCACAAGAACAGCAAGGGGG - Intronic
956267512 3:67413691-67413713 CAGTTCCTAGAAAAGCCATGTGG - Intronic
956384379 3:68701368-68701390 CTGTTACTAGAACAGCAAGGGGG - Intergenic
957746420 3:84348670-84348692 CTGTCACAAGAACAGCAAGGGGG + Intergenic
958836701 3:99155091-99155113 CTGTTACAAGAATAGCGAGGAGG + Intergenic
959248836 3:103912735-103912757 CTGCTTCTAGTAGAGCCATGAGG + Intergenic
959713911 3:109412353-109412375 CTGTTTAAAGAATAGAGATGAGG + Intergenic
960498812 3:118410124-118410146 CTGTTACAAGAACAGCAAGGGGG - Intergenic
960896165 3:122507897-122507919 CTGTTTTAAGAACACTTATGAGG + Intronic
962075370 3:132076269-132076291 CTTTTTTAAGAACACCCACGTGG + Intronic
962689458 3:137879247-137879269 AGGTGTCAAGAACACCCATGGGG + Intergenic
963256085 3:143146210-143146232 CTTGTTGAAGAACAACCATGTGG + Intergenic
964154263 3:153565177-153565199 CTGTCACAAGAACAGCAAGGGGG - Intergenic
964384434 3:156132092-156132114 CTGTTTCAAGCACAGCTCTGTGG - Intronic
964466720 3:157000893-157000915 CTATTACAAGAACAGCATTGGGG - Intronic
964534376 3:157703452-157703474 CTATGTCAAAAACACCCATGGGG + Intergenic
966197002 3:177323780-177323802 CAGTTTCTAGCATAGCCATGAGG - Intergenic
967209767 3:187158023-187158045 CTATCTCAAGAACAGCAAGGGGG - Intronic
968555224 4:1243509-1243531 CTGTCTCAGAAACAGCCCTGGGG + Intronic
969492159 4:7505583-7505605 CTGTCTCCAGAACACCCATGAGG - Intronic
971255383 4:25009265-25009287 CTGTTTGAAGAACATCCAGGGGG - Intronic
971896557 4:32604702-32604724 CTGTCACAAGAACAGCAAAGGGG + Intergenic
971945538 4:33271455-33271477 CTGTCACAAGAACAGCAAGGGGG + Intergenic
972688513 4:41373861-41373883 CTATCTCAAGAACAGCAAGGGGG - Intronic
974125810 4:57693867-57693889 CTGTCACAAGAACAGCCTGGGGG - Intergenic
974311167 4:60211163-60211185 CTGTCACAAGAACAGCAAGGGGG + Intergenic
974506251 4:62776704-62776726 CTATTACAAGAACAGCAACGGGG - Intergenic
975626873 4:76359021-76359043 CTGTCACAAGAACAGCAAGGGGG - Intronic
977282718 4:95061900-95061922 CTGTCACAAGAACAGCAAGGGGG - Intronic
978145000 4:105362275-105362297 TTGTTCCAAGAACAGCAAGGAGG - Intergenic
978700639 4:111640491-111640513 CAGTTTCAAGAACAACTAAGAGG + Intergenic
981254496 4:142645576-142645598 CTTTTAGAAAAACAGCCATGAGG + Intronic
982363778 4:154552320-154552342 CTGCTTTAAGGACAGCCCTGAGG - Intergenic
982853262 4:160346059-160346081 CTGTGTTCAGAACTGCCATGTGG - Intergenic
983118167 4:163845934-163845956 CTGTTTCCATAACAACCATTGGG + Intronic
983415428 4:167446598-167446620 ATGTTTCATGAACTGCTATGGGG + Intergenic
985670665 5:1204985-1205007 CTTTTTCAAGGACAGACAGGAGG + Intronic
985979266 5:3448843-3448865 CTGTTTCCAGTACAGTCCTGTGG - Intergenic
986457377 5:7932791-7932813 CTGTTACATGAACCGTCATGTGG + Intergenic
988689084 5:33554256-33554278 CTGTTCCCAGACAAGCCATGTGG - Intronic
988901851 5:35741422-35741444 GTGTTTGAAGAACAGCAAGGAGG + Intronic
991381685 5:66034585-66034607 AGGATTCAAGAACAGCTATGAGG - Intronic
993005572 5:82425203-82425225 CTTTTACAAGAACAGCAGTGAGG + Intergenic
993302778 5:86232679-86232701 GTGTTTTAAGAATAGCCTTGGGG - Intergenic
993588805 5:89767499-89767521 CTGTTACCAGAACAGCATTGGGG - Intergenic
995303113 5:110609328-110609350 GTGTTTCAAGAAGTGGCATGTGG - Intronic
996029632 5:118690664-118690686 CTTTTTCAAAAACAGGCATCAGG + Intergenic
997182443 5:131844138-131844160 CTGTCACAAGAACAGCAAGGGGG + Intronic
998720937 5:144948179-144948201 TTGTTTTAAGGACAGCCATCAGG - Intergenic
999448073 5:151657289-151657311 CTGTTTCAGGAACAGAAAGGAGG + Intergenic
999873962 5:155781911-155781933 CTGTTTCAAGACAAACCATAAGG - Intergenic
1000557683 5:162746768-162746790 CTGTTTGATGAACAGGTATGAGG - Intergenic
1003191188 6:3876295-3876317 CTGTTTCCAGTAAAGCAATGGGG + Intergenic
1003640912 6:7874319-7874341 CTATTCCAGGAACAACCATGTGG - Intronic
1003798142 6:9629470-9629492 CTATCACAAGAACAGCCAGGGGG - Intronic
1003800813 6:9664895-9664917 CTGTTACAAGAACAGCATGGGGG - Intronic
1005496904 6:26395808-26395830 TTGTGTGAAGAACAGCAATGAGG + Intergenic
1006019800 6:31111430-31111452 ATGTTCCAAGAAGAGCCAGGAGG + Exonic
1006290214 6:33129201-33129223 CTGTTTCAACCTCAGCCCTGGGG + Intergenic
1006333068 6:33405901-33405923 CTGGTTGAGGAACAGCCAGGAGG - Intronic
1007785815 6:44278583-44278605 CTGTCTCAGGAACAGGCCTGAGG - Exonic
1008584362 6:52935494-52935516 CTGTTTAAAAAATAGACATGTGG + Intergenic
1008674895 6:53808703-53808725 CTGCTTCAAGGTCAGACATGGGG + Intronic
1012864324 6:104599420-104599442 CTGTTTCAAGAAAGGCAGTGAGG + Intergenic
1013455806 6:110328535-110328557 CTGCAACAAGCACAGCCATGAGG + Intronic
1014918485 6:127183251-127183273 CTGTTTCAAGAAATGGCATTAGG - Intronic
1014996789 6:128156552-128156574 CTATCACAAGAACAGCAATGGGG + Intronic
1015212389 6:130713093-130713115 CTGTTTTCTGAACAGCCTTGGGG - Intergenic
1016157251 6:140825971-140825993 CTGTCTTGAGAACAGCCAGGGGG + Intergenic
1016264435 6:142214485-142214507 CTGTCACAAGAACAGCAAGGGGG + Intronic
1016292301 6:142538879-142538901 CTGTTTCAAGTGCGGCAATGAGG + Intergenic
1016469205 6:144357485-144357507 CTGTTTCTAGAACACCGAAGAGG - Intronic
1017005391 6:150025199-150025221 CTGGGGCAAGAACAGCCTTGGGG + Intronic
1017379343 6:153810384-153810406 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1018145128 6:160878842-160878864 CTATCACAAGAACAGACATGGGG - Intergenic
1019096590 6:169586312-169586334 CTGTTATAGGAAAAGCCATGCGG - Intronic
1020988638 7:15168400-15168422 CTGTTTCAAAAGCATTCATGAGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1021890904 7:25185389-25185411 TTGTTTCAAGAAAAGACCTGGGG - Intergenic
1022110858 7:27230588-27230610 TTGTTTCAAAAATAGGCATGAGG - Intergenic
1022161299 7:27713792-27713814 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1022512635 7:30950411-30950433 CTGTTTGCAGAAAAGCCATGAGG + Intronic
1022770102 7:33461287-33461309 CTTTTTGAGGAACAGCCAAGTGG + Intronic
1023558426 7:41447449-41447471 CAGTCTCCAGAGCAGCCATGTGG - Intergenic
1023706912 7:42950584-42950606 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1024218648 7:47269590-47269612 CTGTGTCCAGCAAAGCCATGTGG - Intergenic
1026536551 7:71243103-71243125 CTATCACAAGAACAGCCTTGAGG - Intronic
1027775412 7:82458674-82458696 CTGTCTCAAGAACAGCAAGGGGG + Intergenic
1028443544 7:90892379-90892401 GTGGTGCAACAACAGCCATGAGG - Intronic
1029136760 7:98378430-98378452 CTGTTTGGAGAACAGCCCGGAGG - Intronic
1030301230 7:107976739-107976761 TGGTTTCAAGAACATCCTTGCGG + Intronic
1030712905 7:112773391-112773413 CTGTTTCAAGAACATCTGGGTGG + Intronic
1030993074 7:116324877-116324899 CTATTACAAGAACAGCAAGGGGG + Intronic
1031265708 7:119577499-119577521 CTATCTCAAGAACAGCAAGGGGG + Intergenic
1032423454 7:131801620-131801642 CTGTCACAAGAACAGCAAAGGGG - Intergenic
1033307774 7:140237812-140237834 CTTTTTCAAGAAAAGCCATAAGG + Intergenic
1034137482 7:148784246-148784268 CTGTTTGAAAAACAGCCAGTGGG - Intronic
1034476533 7:151287599-151287621 CTGTTAGAGGAACAGCAATGTGG + Intergenic
1035007583 7:155678840-155678862 CTGTTTACAGAACATCCATATGG - Intronic
1036115848 8:5960164-5960186 ATGTTGCAAGAACAGCCAATTGG - Intergenic
1036576432 8:10031815-10031837 CTGTGTCCAGCAAAGCCATGGGG - Intergenic
1038928553 8:32167865-32167887 CTGTTTCAAAAAGAGCAAGGTGG - Intronic
1039496971 8:37987647-37987669 CTGTGACAAGAACAGCAAGGGGG + Intergenic
1040402481 8:47065380-47065402 CTATTTCAAGCATAGCCAGGGGG - Intergenic
1041201655 8:55455317-55455339 CATTTTCAAGAACAGCCAGGCGG - Intronic
1041476146 8:58268698-58268720 CTGGTCCAAAAACAGACATGTGG + Intergenic
1042674059 8:71299082-71299104 CAGCTTCAAGAACCGCCATCTGG - Exonic
1042983411 8:74555845-74555867 CTGTCACAAGAACAGCACTGTGG - Intergenic
1043300055 8:78716818-78716840 CTATCACAAGAACAGCAATGGGG - Intronic
1043992917 8:86778155-86778177 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1046373220 8:113339390-113339412 ATGTTTCAAAAACATCCATTTGG - Intronic
1046708689 8:117485497-117485519 CTGATTCAAAAAAAGCTATGAGG - Intergenic
1047144356 8:122180356-122180378 CTGTTTGGAAAACAGCCATGTGG - Intergenic
1047413666 8:124645540-124645562 CTGATTTGAGAACAGCTATGCGG + Intronic
1048375853 8:133821929-133821951 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1048930068 8:139307852-139307874 CTATTTCAAAAACAGCACTGTGG - Intergenic
1049934897 9:492089-492111 GTGTTCCAGGAACAGCCAGGAGG + Intronic
1051793135 9:20831344-20831366 CTGTTGCAACAACAAACATGAGG + Intronic
1051809908 9:21036996-21037018 CTGCTACAAGAACAGAGATGTGG - Intergenic
1053083538 9:35197686-35197708 CTGTCACAAGAACAGCAAGGGGG - Intronic
1053337340 9:37287032-37287054 CTGTTTCAACAACAGCAGAGAGG - Intronic
1053519588 9:38764275-38764297 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1053753860 9:41282732-41282754 CAGTTTCATAAATAGCCATGTGG - Intergenic
1054259380 9:62847092-62847114 CAGTTTCATAAATAGCCATGTGG - Intergenic
1054332396 9:63772946-63772968 CAGTTTCATAAATAGCCATGTGG + Intergenic
1055417825 9:76103217-76103239 CTGTTTCAGACACAGCTATGGGG - Intronic
1056129557 9:83570539-83570561 ATTGTTGAAGAACAGCCATGAGG + Intergenic
1056376869 9:86023189-86023211 GTTATTCAAGAACAGCCATTAGG + Intergenic
1057746080 9:97752418-97752440 CTGTTTCAGGAGCAGCAGTGCGG - Intergenic
1059786649 9:117593531-117593553 CTATTACAAGAACAGCAAGGGGG - Intergenic
1060385820 9:123227370-123227392 CTGTTTGAAGAAGAGCAAGGAGG + Intronic
1060612851 9:124984199-124984221 ATGTTTCAGGAACAGCAAGGGGG + Intronic
1185592239 X:1285239-1285261 CTTTTTCAGAAACAGCCAGGGGG + Intronic
1188590680 X:31830823-31830845 TTGTTTCAAACACGGCCATGGGG - Intronic
1189104471 X:38221597-38221619 CTGTCTCACCCACAGCCATGGGG + Intronic
1190366649 X:49700939-49700961 CTGTTACAGGAACAGCAAGGGGG - Intergenic
1191674620 X:63781857-63781879 TTGTTTAAAGAACAGCAAGGAGG - Intronic
1191833098 X:65436201-65436223 CTGTCACAAGAACAGCAAGGGGG + Intronic
1193272292 X:79543836-79543858 CTGTTCCTAGAATATCCATGAGG - Intergenic
1194450582 X:94040617-94040639 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1195945444 X:110205619-110205641 CTGTTTGAAGTACAGCCAGGTGG + Intronic
1196021635 X:110997109-110997131 ATGTTTGAAGAACAGCAAGGGGG + Intronic
1196706558 X:118722322-118722344 TTGTGTGAAGAACAGCCAGGTGG + Intergenic
1197966517 X:132068893-132068915 ATGTTTGAGGAACAACCATGAGG - Intergenic