ID: 1156447104

View in Genome Browser
Species Human (GRCh38)
Location 18:37245260-37245282
Sequence CCCCTGAGGCAGGTTCCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 114}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156447104_1156447113 -2 Left 1156447104 18:37245260-37245282 CCAATAGGAACCTGCCTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1156447113 18:37245281-37245303 GGCTAGGATGGGAGCTCTAGGGG 0: 1
1: 0
2: 0
3: 14
4: 89
1156447104_1156447112 -3 Left 1156447104 18:37245260-37245282 CCAATAGGAACCTGCCTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1156447112 18:37245280-37245302 GGGCTAGGATGGGAGCTCTAGGG 0: 1
1: 0
2: 1
3: 15
4: 187
1156447104_1156447114 2 Left 1156447104 18:37245260-37245282 CCAATAGGAACCTGCCTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1156447114 18:37245285-37245307 AGGATGGGAGCTCTAGGGGATGG 0: 1
1: 0
2: 2
3: 33
4: 367
1156447104_1156447115 5 Left 1156447104 18:37245260-37245282 CCAATAGGAACCTGCCTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1156447115 18:37245288-37245310 ATGGGAGCTCTAGGGGATGGTGG 0: 1
1: 0
2: 3
3: 25
4: 269
1156447104_1156447117 9 Left 1156447104 18:37245260-37245282 CCAATAGGAACCTGCCTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1156447117 18:37245292-37245314 GAGCTCTAGGGGATGGTGGGAGG 0: 1
1: 0
2: 0
3: 31
4: 348
1156447104_1156447119 14 Left 1156447104 18:37245260-37245282 CCAATAGGAACCTGCCTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1156447119 18:37245297-37245319 CTAGGGGATGGTGGGAGGGAAGG 0: 1
1: 0
2: 17
3: 131
4: 1319
1156447104_1156447118 10 Left 1156447104 18:37245260-37245282 CCAATAGGAACCTGCCTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1156447118 18:37245293-37245315 AGCTCTAGGGGATGGTGGGAGGG 0: 1
1: 0
2: 3
3: 36
4: 355
1156447104_1156447116 6 Left 1156447104 18:37245260-37245282 CCAATAGGAACCTGCCTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1156447116 18:37245289-37245311 TGGGAGCTCTAGGGGATGGTGGG 0: 1
1: 0
2: 2
3: 21
4: 257
1156447104_1156447111 -4 Left 1156447104 18:37245260-37245282 CCAATAGGAACCTGCCTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1156447111 18:37245279-37245301 GGGGCTAGGATGGGAGCTCTAGG 0: 1
1: 0
2: 1
3: 29
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156447104 Original CRISPR CCCCTGAGGCAGGTTCCTAT TGG (reversed) Intronic
902451894 1:16501509-16501531 ACCCTGCGGCAGGGTCCTATGGG - Intergenic
902501058 1:16912154-16912176 ACCCTGCGGCAGGGTCCTGTGGG + Intronic
903388072 1:22942830-22942852 CCTCTGAGACAGGTCCCTGTTGG - Intergenic
912028288 1:105206008-105206030 CACCTGTGCCAAGTTCCTATGGG - Intergenic
913269093 1:117075495-117075517 CCCCTGAGGCAGGCTTTTCTGGG - Exonic
915939437 1:160109483-160109505 CCCCTGAGGCAGGTTTGCTTTGG - Intergenic
916620406 1:166490418-166490440 CCCCTTAGGGAAGTTCCTATTGG + Intergenic
919522697 1:198608539-198608561 CCCCTGAAGCACGTGGCTATTGG - Intergenic
919807568 1:201389352-201389374 CTCCCGAGGCAGGCTCCTCTAGG + Intronic
921712157 1:218383737-218383759 CCCATGAGTCAGGTTTCGATGGG + Intronic
923956810 1:239031546-239031568 CCCCTAAGGCAGGTTCGAAATGG + Intergenic
924533818 1:244917161-244917183 CCCATGAGGCAGGGTCCCACAGG + Intergenic
1063688544 10:8261553-8261575 CCGCTTAGGCAGGTTGTTATGGG - Intergenic
1065588978 10:27246917-27246939 CTCCTGAGGCAGATTCCGCTGGG - Intergenic
1069622335 10:69845610-69845632 CACCTGAAGCTGGTTCCCATTGG - Intronic
1069819243 10:71217440-71217462 TCCCTGAGGCAGGATCTTTTTGG + Intronic
1069981151 10:72253676-72253698 GCCCTGAGCCAGGTGGCTATAGG + Intergenic
1077996221 11:7454612-7454634 CCCCGTAGGCAGTTTCCTATTGG - Intronic
1078927310 11:15886363-15886385 CTCCTGAAGCAGCTTCCTAGTGG - Intergenic
1080424876 11:32146232-32146254 CCCCTCAGGCAGGTGCCTGATGG + Intergenic
1083882445 11:65555235-65555257 TGCCTGAGGCAGGTTTCTCTGGG - Intronic
1084062945 11:66687632-66687654 CCCCTGAGCCAGGTCCCTGGGGG + Exonic
1092362341 12:7847713-7847735 CCCCAGAGAGAGGTTGCTATGGG + Intronic
1092378662 12:7977005-7977027 CCCCAGAGAGAGGTTGCTATGGG + Intergenic
1096528712 12:52230155-52230177 CCCCTGAGGCTGATCCCTACTGG - Intergenic
1096537683 12:52286016-52286038 CTCCTGAGGCCCCTTCCTATGGG + Exonic
1101518219 12:105457129-105457151 CTCCTGGGCCAGGTTCCTCTAGG + Intergenic
1101804916 12:108055317-108055339 CTCCAGAAGCAGATTCCTATAGG - Intergenic
1101870702 12:108562991-108563013 CCCAGGAGGCAGGGTCCTGTTGG + Intronic
1104381949 12:128315040-128315062 ACCCAGAGGCAGGTTGCGATGGG + Intronic
1104801268 12:131556539-131556561 GTCCTGGGGCAGGTTCCTTTTGG - Intergenic
1104801282 12:131556585-131556607 GTCCTGGGGCAGGTTCCTGTTGG - Intergenic
1104801294 12:131556631-131556653 GTCCTGGGGCAGGTTCCTGTTGG - Intergenic
1114228216 14:20757751-20757773 CCACTTAGGCAGATGCCTATGGG + Intergenic
1115728020 14:36238483-36238505 CCTCTGAGGCAGTTTGCAATGGG + Intergenic
1121598260 14:95182794-95182816 CATCTGAGGCAGTTTCCTAAGGG - Exonic
1123492780 15:20795942-20795964 TCCCTGAGGCACATTCCTGTTGG + Intergenic
1123549281 15:21365038-21365060 TCCCTGAGGCACATTCCTGTTGG + Intergenic
1125475424 15:40044926-40044948 CCTCTGAGGCAGGTTCCCTGTGG - Intergenic
1125831671 15:42721288-42721310 CCCCTGACTCAGATTCCCATAGG - Intergenic
1127920890 15:63493289-63493311 CTCCTCAGCCACGTTCCTATGGG - Intergenic
1128833957 15:70794362-70794384 CCCCTGAGGTAGGTTCACAGGGG + Intergenic
1202957617 15_KI270727v1_random:92254-92276 TCCCTGAGGCACATTCCTGTTGG + Intergenic
1132478576 16:154343-154365 CGCCTGGGACAAGTTCCTATCGG + Exonic
1132480754 16:165099-165121 CGCCTGGGCCAAGTTCCTATCGG + Intronic
1132815485 16:1824371-1824393 CCCCTGTGGCAGAGTCCTTTGGG - Intronic
1135990105 16:27213500-27213522 CCCCTGACACAGGTTCCTGGTGG + Intronic
1140482307 16:75268078-75268100 CCCCAGAGGCTGTTCCCTATAGG - Intergenic
1140770353 16:78198146-78198168 CTCCTGGGGCAGGTGCCTCTGGG + Intronic
1146008656 17:29178037-29178059 CCCCAGAGGCAGGTACCTAAAGG - Intronic
1146170967 17:30632954-30632976 CTCCTGAGGCAGTTTCCGCTGGG + Intergenic
1146344420 17:32048958-32048980 CTCCTGAGGCAGTTTCCGCTGGG + Intronic
1148170351 17:45514269-45514291 CTCCTGAGGCAGATTCCGCTGGG - Intergenic
1148170828 17:45518262-45518284 CTCCTGAGGCAGATTCCGCTGGG - Intergenic
1148278854 17:46331542-46331564 CTCCTGAGGCAGATTCCGCTGGG + Exonic
1148365197 17:47050293-47050315 CTCCTGAGGCAGATTCCGCTGGG + Intergenic
1148539915 17:48472194-48472216 CCTATGAGGCAGGTTCCCACTGG - Intergenic
1148690153 17:49522539-49522561 CCACTGCGTGAGGTTCCTATGGG + Intergenic
1149355268 17:55832955-55832977 CCTCTGGGGCAGTTTCCTCTTGG + Intronic
1150401443 17:64859859-64859881 CTCCTGAGGCAGATTCCGCTGGG - Exonic
1154450325 18:14470479-14470501 TCCCTGAGGCACATTCCTGTTGG + Intergenic
1156313483 18:35946612-35946634 CCCCAGAAGCAGGGTCCTGTGGG - Intergenic
1156447104 18:37245260-37245282 CCCCTGAGGCAGGTTCCTATTGG - Intronic
1165798944 19:38536097-38536119 CCCCTGAGACATCTTCCTTTGGG + Intronic
1166369476 19:42293058-42293080 CCTTTGAGGCAGGTGCCTCTGGG + Exonic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
926414163 2:12632744-12632766 CCCCTTGGGCAGTTTCCTATGGG + Intergenic
928382166 2:30827792-30827814 CCCCTCAGGAAAGTTCCTCTTGG + Intergenic
937050326 2:118883100-118883122 CCCCGGGGGCAGTTTCCTGTTGG + Intergenic
937094211 2:119224989-119225011 CCCCAGTGGTAGGTTCCTCTGGG - Intronic
938375022 2:130799282-130799304 CCTCTTAGGCAGGGTCCTTTTGG - Intergenic
938382872 2:130846493-130846515 CCCCGCAGGCAGGTTCCTGAGGG - Intronic
941864278 2:170317710-170317732 CCCATGAGGCAGCTTACTATAGG + Intronic
943757668 2:191573760-191573782 CCACTAAGGCAGGTGCCCATTGG - Intergenic
946978908 2:225184916-225184938 CCCTTGAGTGAGGTTCCTCTGGG + Intergenic
1170264281 20:14447536-14447558 CCTCTGAGGCCTCTTCCTATAGG - Intronic
1170803220 20:19607467-19607489 CTTCTGAGGCAGGCTCCAATTGG + Intronic
1175330722 20:58162024-58162046 CCCCTCTGGCATGTTCCTAAAGG + Intergenic
1175768769 20:61609536-61609558 CCCCTGAGGGAGGGACCTCTTGG + Intronic
1176445863 21:6819892-6819914 TCCCTGAGGCACATTCCTGTTGG - Intergenic
1176824031 21:13684925-13684947 TCCCTGAGGCACATTCCTGTTGG - Intergenic
1179250056 21:39664725-39664747 CCCCTGTGGCTGGGTCCTGTGGG + Exonic
1180482316 22:15765885-15765907 TCCCTGAGGCACATTCCTGTTGG - Intergenic
1181581679 22:23832251-23832273 CCACTGAGGGAGCTTCCTAGGGG - Intronic
1182277669 22:29200717-29200739 CCCCTCTGCCAGGCTCCTATGGG + Intergenic
1183019833 22:35018306-35018328 ACCCTTACCCAGGTTCCTATTGG + Intergenic
1183923712 22:41190087-41190109 CTCCTGAGGCAGATTCCACTGGG - Intergenic
1185255522 22:49828668-49828690 GCCCTGAGGCAGGAGGCTATTGG + Intergenic
950876409 3:16278800-16278822 CCCCTGGGGCAGATGCCTTTGGG + Intronic
953129132 3:40121139-40121161 CCACTGAGGCAGGTCCCGCTAGG + Intronic
956872285 3:73429898-73429920 CTCCTGAGAAAGGTTCCTACGGG - Intronic
962700954 3:137999382-137999404 CTCCTGAGTCCTGTTCCTATGGG - Intronic
964380103 3:156090038-156090060 CCCCTGAGCCAGCTTTCTACTGG - Intronic
973774510 4:54231863-54231885 CCCCTGGGCCAGTTTCCTCTCGG + Intronic
974739749 4:65991446-65991468 TCCCTGAAGCTGTTTCCTATTGG - Intergenic
980389490 4:132124389-132124411 CCCCTTAGGGAAGTCCCTATTGG + Intergenic
986017114 5:3767062-3767084 CCCCAGAGGCAGGCGCCTGTCGG - Intergenic
986487077 5:8248557-8248579 CCCATGAGGCAGCTCTCTATAGG + Intergenic
989111691 5:37913047-37913069 CCCATGAGACAGACTCCTATAGG - Intergenic
995374747 5:111461559-111461581 CACTTGAGGCAGCTGCCTATGGG - Intronic
1000354447 5:160380224-160380246 CCCCTGAGGCAGGTGCCTTGGGG + Intergenic
1000371934 5:160545118-160545140 CCCTTGAGGCAGGTTTTTCTGGG + Intergenic
1001720174 5:173850728-173850750 CCCCTGTGGCAGTTTCCTCTCGG + Intergenic
1002800125 6:514684-514706 CCCCTGGGGCAGATGTCTATGGG + Intronic
1003554669 6:7129136-7129158 ACCCTGAGCCAAGTTCCCATGGG + Intronic
1006815311 6:36845860-36845882 GCCCTGAGGCAGGTGCCTGCAGG - Intergenic
1009413422 6:63392400-63392422 CCCCTGAGACAGGGTCCCTTTGG - Intergenic
1010685680 6:78852873-78852895 CCTCTGAGACAGGCTCCTGTGGG + Intergenic
1013261104 6:108443364-108443386 CACTTGAGGCAGCTTCTTATTGG - Intronic
1027044888 7:74984653-74984675 CCCTTGACTCAGGTTCCTATGGG + Intronic
1027437417 7:78179025-78179047 CCCCTGAGGAAGGTGCCAAGGGG - Intronic
1029387968 7:100256268-100256290 CCCTTGACTCAGGTTCCTATGGG - Intronic
1032803867 7:135337477-135337499 CCCTTGAGGCAGGTACCTTGAGG - Intergenic
1045017692 8:98013088-98013110 CCACTGAAGCATTTTCCTATAGG + Intronic
1047333978 8:123919002-123919024 CCCCTGGGGCAGGATCCCACTGG - Intronic
1047779598 8:128100520-128100542 TCCCTGCAGCAGGTTCCTTTAGG - Intergenic
1051440800 9:17080610-17080632 CACCTGAGGCAGGCTCCAAAAGG + Intergenic
1051931590 9:22392820-22392842 CCACTGAGGCAGATACATATGGG - Intergenic
1056822423 9:89852991-89853013 CCTCTAAGAGAGGTTCCTATCGG + Intergenic
1057446898 9:95122797-95122819 CCCCAGAGGCCCGTTCCTAATGG + Intronic
1058800626 9:108541360-108541382 CCCCTCAGGCAGCCTCCTGTGGG - Intergenic
1061633081 9:131885918-131885940 CCCCCAAGGCAGGTTCCCAGAGG - Intronic
1203523330 Un_GL000213v1:64633-64655 TCCCTGAGGCACATTCCTGTTGG + Intergenic
1189490192 X:41465449-41465471 CTCCTGAGGCATGGTCCTTTGGG + Intronic
1190036318 X:47028371-47028393 CCCCTGGGGCAGGGGCCTAGGGG - Intronic
1192476635 X:71449652-71449674 GCCATGAGGCAGGTCCCTATAGG + Intronic