ID: 1156447713

View in Genome Browser
Species Human (GRCh38)
Location 18:37249457-37249479
Sequence AGGTTTGTGCTGCAGTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156447713_1156447718 16 Left 1156447713 18:37249457-37249479 CCTGTGTACTGCAGCACAAACCT 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1156447718 18:37249496-37249518 CTGTCCCTAAAGCTCAATCTAGG 0: 1
1: 0
2: 0
3: 9
4: 119
1156447713_1156447719 17 Left 1156447713 18:37249457-37249479 CCTGTGTACTGCAGCACAAACCT 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1156447719 18:37249497-37249519 TGTCCCTAAAGCTCAATCTAGGG 0: 1
1: 0
2: 1
3: 9
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156447713 Original CRISPR AGGTTTGTGCTGCAGTACAC AGG (reversed) Intronic
901100009 1:6712678-6712700 TGGTTTGTGCTGCGGGACCCAGG - Intergenic
901855321 1:12040902-12040924 AGCTGTGTGTTGCAGAACACTGG + Intergenic
902876825 1:19345398-19345420 CGGTTTGTGCTTCAGTTCCCAGG - Intronic
906127537 1:43436678-43436700 AGGGTAGTGTGGCAGTACACAGG - Intronic
906712801 1:47944121-47944143 AGGATGATGCTGCAGGACACGGG + Intronic
907296475 1:53459294-53459316 AGGTTCCTGCTGCAGTTCCCGGG + Intergenic
908842658 1:68294943-68294965 AGGTTTGAGCAGCAGGGCACTGG - Intergenic
917162527 1:172074048-172074070 AGATTTGTGATGGAGTAAACTGG - Intronic
922676944 1:227559134-227559156 AGCGTTCTGCTCCAGTACACAGG - Intergenic
1065753363 10:28908826-28908848 AGGTGTGAGCTGCCGTGCACTGG + Intergenic
1066149748 10:32603390-32603412 TGAATAGTGCTGCAGTACACAGG + Intronic
1067702513 10:48583939-48583961 AGGTTGGTGCTGCCCTTCACAGG + Intronic
1068619761 10:59168927-59168949 ATGTCTATCCTGCAGTACACAGG + Intergenic
1070873218 10:79776794-79776816 AGGTTGGTGCTGCAGCAAAGTGG - Intergenic
1071640143 10:87298944-87298966 AGGTTGGTGCTGCAGCAAAGTGG - Intergenic
1071655089 10:87439001-87439023 AGGTTGGTGCTGCAGCAAAGTGG + Intergenic
1073545747 10:104347352-104347374 AAGTTAGTGCTGCAGTAGTCTGG + Intergenic
1074634899 10:115304064-115304086 AGGTTTTTGCATCAGTCCACTGG + Intronic
1075182767 10:120226646-120226668 AGGTTTGGGCTCCAGAACTCTGG + Intergenic
1075669702 10:124256009-124256031 AGCCTTGTGCAGCAGGACACTGG + Intergenic
1075884213 10:125883503-125883525 AGGTTTATGCTGCTGTGGACTGG - Intronic
1076928228 10:133506518-133506540 TGGTTTATGGTGCAGTACCCAGG - Intergenic
1081919090 11:46756104-46756126 AGTGTTCTGTTGCAGTACACTGG + Intronic
1086339266 11:85830771-85830793 AAGTTTCTGCTGCAGGAAACTGG - Intergenic
1086400148 11:86454704-86454726 AGGTTAGTGCTTAAGCACACAGG - Intronic
1088556317 11:111064978-111065000 GGGCTTGTGCTGCAGTTCAATGG + Intergenic
1089002953 11:115067494-115067516 ATGTTTGTGCTGCTGTATTCAGG - Intergenic
1093184349 12:16002882-16002904 AGCTTTGTGCTGAAATACCCTGG + Intronic
1095859442 12:46900109-46900131 AGTTTTGTGATCCAGGACACTGG + Intergenic
1096542742 12:52317396-52317418 GGGTCTATGCTGCAGTCCACTGG + Intronic
1097372752 12:58804235-58804257 AGGTTTGTGTTCCAGGACATTGG - Intronic
1101210568 12:102531535-102531557 AGGTTTGAGGAGCAGTACAGAGG + Intergenic
1102572377 12:113834834-113834856 TGGTTTGTGCTTCAGTAAAATGG + Intronic
1104207970 12:126658940-126658962 AGCTTTGGTCTGCATTACACAGG - Intergenic
1109228716 13:59729049-59729071 ATGTTTCTGGTGAAGTACACTGG + Intronic
1109710379 13:66151546-66151568 AAATTTGTACTGCAGTATACAGG - Intergenic
1110103888 13:71645569-71645591 AAAGTTGTGCTACAGTACACAGG + Intronic
1110482694 13:75999132-75999154 AGGCATATGCAGCAGTACACAGG - Intergenic
1112895653 13:104296837-104296859 AGGTTTGAGCTGATGAACACAGG - Intergenic
1113004268 13:105680687-105680709 AAGTTTATGCTACAGTACAAGGG + Intergenic
1115152621 14:30302844-30302866 AGTGTTCTGCTGCAGTCCACAGG + Intergenic
1124230041 15:27936669-27936691 TGCTGTGTGCTGCAGGACACAGG + Intronic
1127460026 15:59190253-59190275 AGGATTGTGCTGCAGTAGGGAGG + Intronic
1128813056 15:70585964-70585986 AGGTTGAGGCTGCAGTAAACAGG - Intergenic
1130439069 15:83933138-83933160 AGTTATGTGCTGGAGTAAACAGG + Intronic
1130637109 15:85633408-85633430 AGTTTTGTATTGCAGTACAGTGG + Intronic
1130697220 15:86142722-86142744 TGGTTTGTGCTGCGTTCCACTGG + Intronic
1137030322 16:35517998-35518020 AGAATTGTGCTGCCGGACACAGG + Intergenic
1140856335 16:78981144-78981166 AGGAAAGTGCTGCAGTACAACGG - Intronic
1143376250 17:6469339-6469361 AGGTTTGGGCTGGAGCACCCTGG + Intronic
1148875095 17:50682511-50682533 AGGTGTGTTCTGGAGCACACTGG - Intronic
1150670298 17:67190300-67190322 GGGAATGTGCTGAAGTACACTGG + Exonic
1153060922 18:994446-994468 AGGCATGGGCTGCAGTAGACAGG - Intergenic
1155979030 18:32161811-32161833 AGGTTTGTGCTGCAGTTGGCTGG - Intronic
1156447713 18:37249457-37249479 AGGTTTGTGCTGCAGTACACAGG - Intronic
1158528334 18:58235144-58235166 AGGTTGATGCTTAAGTACACAGG + Intronic
1159238415 18:65707982-65708004 AGGTTTATTCTCCAGTACATTGG - Intergenic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
932400707 2:71479255-71479277 AGCTTTGTTCTGCAGTGCCCTGG - Intronic
933451853 2:82463827-82463849 AGGTTTTTGCTGCAATAGAAAGG - Intergenic
938276939 2:130035133-130035155 GTGTGTGTGCTGCAGTTCACAGG - Intergenic
939235927 2:139492872-139492894 AGATTTGTACTTCAGTCCACGGG - Intergenic
940845098 2:158631866-158631888 TGGTTTGGGCTGCGGTACACTGG - Exonic
940945207 2:159608303-159608325 AGGTTGAAGCTGCAGTAAACTGG + Intronic
945249604 2:207753131-207753153 AGGTGTGTGCTGGACTATACTGG - Intronic
947907790 2:233778127-233778149 ATGTGTGTGCTGAAGTACAGGGG - Intronic
948640663 2:239374170-239374192 AGTTTTGTTCTGCTGTTCACCGG - Intronic
1169508658 20:6240556-6240578 AGAATTGTGCTGAAGTTCACGGG - Intergenic
1172182360 20:33011180-33011202 AGGTGGGTGCTTCAGTCCACCGG + Intronic
1175780571 20:61679778-61679800 AGGTTTCTGCTGCAGGCCAGCGG - Intronic
1180959830 22:19757495-19757517 AGGTGTGTGCAGATGTACACAGG + Intronic
1182380985 22:29887527-29887549 AGGTTTCTGCTTCTGTACTCTGG + Intronic
961743290 3:129047005-129047027 AGGTGGGGGCTGCAGTCCACGGG - Intergenic
964856377 3:161150398-161150420 AGGTTTTTGCAGCAGTAGAAAGG + Intronic
966118695 3:176497161-176497183 AGGTTTTTGTTGCTGAACACTGG - Intergenic
968026809 3:195449533-195449555 TGATTTGTGCTGGAGTGCACTGG + Intergenic
973909923 4:55569249-55569271 AGGTGCATGCTGAAGTACACAGG + Intronic
974946796 4:68538260-68538282 AGGCTTTTGCTCCATTACACAGG + Intronic
974956508 4:68647740-68647762 AGGCTTTTGCTCCATTACACAGG + Intronic
975463999 4:74688591-74688613 AGGGTTGGGCTGAAGTACAGTGG + Intergenic
979439340 4:120733148-120733170 AGGTTTGTGTTTCAGTAAAGAGG + Intronic
981004201 4:139858628-139858650 GGCTTTGTGCTTCAGAACACAGG - Intronic
983969516 4:173854445-173854467 ATGTTTGTTATGCAGTCCACTGG + Intergenic
984213706 4:176881519-176881541 AGGTCTCTGTTGCAGTACACTGG + Intergenic
994519657 5:100816830-100816852 AGATTTGTGCTGCATTCCACTGG + Intronic
998747818 5:145281364-145281386 AGGTTTCTGCAGAAGTACAGTGG + Intergenic
999128860 5:149267240-149267262 AGGTTTCTGCTCCAGGGCACGGG - Intergenic
1003131275 6:3397106-3397128 AGGTTTGAGCAGCAGGGCACTGG + Intronic
1003151091 6:3549512-3549534 AGGAGTGTGCAGCAGTACCCAGG - Intergenic
1003668479 6:8133213-8133235 AGGCTTTTGCTGGAGTGCACTGG + Intergenic
1004018841 6:11758057-11758079 AGATTTGAGCTGCAGTTCAAAGG - Intronic
1006818644 6:36872564-36872586 AGGTATGTGCTGGAGTAGAGGGG - Intronic
1010735524 6:79439566-79439588 AGGTTTGTTCTTGAGTACATTGG - Intergenic
1011840414 6:91490881-91490903 TGGTTTGTCCTTCAGAACACAGG + Intergenic
1013178859 6:107701183-107701205 TGGTTTCTTCTGCAGTAAACCGG + Intergenic
1017486260 6:154904338-154904360 CAGTTTGTGCTGCAGAAAACTGG + Intronic
1017647224 6:156550690-156550712 AGGGTTGTGCTGGAGGACATGGG - Intergenic
1018629191 6:165807496-165807518 AGGTTCGTCCTGCAGTAGAAAGG + Intronic
1019356785 7:584369-584391 AGGTTTGGGGTGCAACACACAGG - Intronic
1020067955 7:5204102-5204124 AGGTTTGTACTTCAGTTTACTGG + Intronic
1022413810 7:30160962-30160984 AGGTTTTCGTTGAAGTACACTGG - Exonic
1027160381 7:75798097-75798119 AGGTTTGAGCTGCTGTGCCCAGG + Intergenic
1030970226 7:116046733-116046755 AGTTTTGTGGTGAAGTACAGTGG - Intronic
1031439441 7:121775205-121775227 AGGTATGTGCAGGACTACACAGG + Intergenic
1031724761 7:125223966-125223988 ATCATTGTCCTGCAGTACACTGG + Intergenic
1032869751 7:135971698-135971720 AGGATTGTGATGCAGTATACAGG - Intronic
1033638850 7:143240777-143240799 AGGTTTGTGCTGCAGAAATGAGG - Intergenic
1036431519 8:8696154-8696176 ATGTTTGCCCTGCAGTAGACAGG + Intergenic
1043172803 8:76986526-76986548 AGGTTTGTGTTTTAGAACACTGG - Intronic
1051257469 9:15229521-15229543 AGGTTTGTTATGCACAACACTGG - Intronic
1058044056 9:100336803-100336825 TGATTTGTGCTGCTGTTCACAGG + Intronic
1060264994 9:122106639-122106661 AGGCTTGTGCAGCAGTAAGCTGG + Intergenic
1060957429 9:127652669-127652691 AGCTTTCTGCTGCAGTACAGGGG - Intronic
1187682719 X:21784117-21784139 AGATTTGTGCTGCATTCCATCGG + Intergenic
1196064292 X:111445661-111445683 ATGTTTGTGCTGAAGCACCCTGG + Intergenic
1198484323 X:137071496-137071518 AGGTCTCTGCTGTAGTACAAAGG + Intergenic
1199966951 X:152828516-152828538 AGGTTTGTAATGCATCACACTGG - Exonic
1201930880 Y:19345584-19345606 AGGTTTGTGGTGTAGTTCTCAGG + Intergenic