ID: 1156448272

View in Genome Browser
Species Human (GRCh38)
Location 18:37252799-37252821
Sequence GCTACTGTGTTAGGTACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 149}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156448272_1156448278 7 Left 1156448272 18:37252799-37252821 CCCCAAGTACCTAACACAGTAGC 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1156448278 18:37252829-37252851 CAATACTGCTGAATAAATGGAGG 0: 1
1: 0
2: 0
3: 17
4: 157
1156448272_1156448281 19 Left 1156448272 18:37252799-37252821 CCCCAAGTACCTAACACAGTAGC 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1156448281 18:37252841-37252863 ATAAATGGAGGAACATGGGCAGG 0: 1
1: 0
2: 3
3: 32
4: 321
1156448272_1156448283 23 Left 1156448272 18:37252799-37252821 CCCCAAGTACCTAACACAGTAGC 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1156448283 18:37252845-37252867 ATGGAGGAACATGGGCAGGGAGG 0: 1
1: 0
2: 4
3: 48
4: 464
1156448272_1156448286 28 Left 1156448272 18:37252799-37252821 CCCCAAGTACCTAACACAGTAGC 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1156448286 18:37252850-37252872 GGAACATGGGCAGGGAGGGGCGG 0: 1
1: 0
2: 4
3: 122
4: 1130
1156448272_1156448285 25 Left 1156448272 18:37252799-37252821 CCCCAAGTACCTAACACAGTAGC 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1156448285 18:37252847-37252869 GGAGGAACATGGGCAGGGAGGGG 0: 1
1: 0
2: 10
3: 104
4: 1017
1156448272_1156448284 24 Left 1156448272 18:37252799-37252821 CCCCAAGTACCTAACACAGTAGC 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1156448284 18:37252846-37252868 TGGAGGAACATGGGCAGGGAGGG 0: 1
1: 0
2: 2
3: 93
4: 654
1156448272_1156448280 15 Left 1156448272 18:37252799-37252821 CCCCAAGTACCTAACACAGTAGC 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1156448280 18:37252837-37252859 CTGAATAAATGGAGGAACATGGG 0: 1
1: 0
2: 0
3: 31
4: 279
1156448272_1156448282 20 Left 1156448272 18:37252799-37252821 CCCCAAGTACCTAACACAGTAGC 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1156448282 18:37252842-37252864 TAAATGGAGGAACATGGGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 287
1156448272_1156448279 14 Left 1156448272 18:37252799-37252821 CCCCAAGTACCTAACACAGTAGC 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1156448279 18:37252836-37252858 GCTGAATAAATGGAGGAACATGG 0: 1
1: 0
2: 1
3: 44
4: 380
1156448272_1156448277 4 Left 1156448272 18:37252799-37252821 CCCCAAGTACCTAACACAGTAGC 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1156448277 18:37252826-37252848 ACACAATACTGCTGAATAAATGG 0: 1
1: 0
2: 3
3: 24
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156448272 Original CRISPR GCTACTGTGTTAGGTACTTG GGG (reversed) Intronic
901195082 1:7435912-7435934 GATACTGTCTTAGGTACAAGAGG + Intronic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
904557752 1:31376339-31376361 CCTACTGAGTTAGTTACCTGAGG + Intronic
907215905 1:52863669-52863691 GCTACTGTGACAGGTACTGCAGG - Intronic
910749843 1:90616993-90617015 GGTATTGTGCCAGGTACTTGAGG - Intergenic
912394607 1:109332265-109332287 GGCACTGTTTTAGGTACTTAAGG + Intronic
913587089 1:120286439-120286461 GCTACTGTGCTAGATTCTGGTGG + Intergenic
913621096 1:120611931-120611953 GCTACTGTGCTAGATTCTGGTGG - Intergenic
914569104 1:148898324-148898346 GCTACTGTGCTAGATTCTGGTGG + Intronic
914603723 1:149231932-149231954 GCTACTGTGCTAGATTCTGGTGG - Intergenic
914782248 1:150796175-150796197 GATACTGTGTTAGGTGCTGGAGG - Intergenic
914995369 1:152538669-152538691 GCTTGTGTGTTAGGTAGTTTGGG + Intronic
917952551 1:180055422-180055444 GCTACTGTGTTAGATGATTTAGG + Intronic
921491228 1:215778490-215778512 GCTTATGTGTTAGGGAATTGTGG + Intronic
921876370 1:220201131-220201153 CTTACTGTGTTAGGTACTGAGGG - Intronic
922718293 1:227887896-227887918 GCCACTGTGTGTGGTCCTTGTGG + Intergenic
924267606 1:242298988-242299010 TCTACTGTGTTAGCTCTTTGGGG - Intronic
1063786374 10:9389521-9389543 GCTACAGTGTTAGTTTTTTGAGG + Intergenic
1065760479 10:28977480-28977502 GTTTCTGTTTTAGGTCCTTGAGG - Intergenic
1066717282 10:38299857-38299879 TCTACTGTGTTAGCTCTTTGGGG + Intergenic
1069885837 10:71623042-71623064 GCCACTGTGCTAGGTCCTGGGGG + Intronic
1070694536 10:78552186-78552208 GCTGCTGTGTTTGGTAATTCAGG - Intergenic
1070811011 10:79298164-79298186 GCTCCTGTGTCAGGTGCCTGTGG - Intronic
1072326937 10:94307989-94308011 GCTCATGTGTTACGTACATGGGG - Intronic
1072571100 10:96658167-96658189 CCAAATATGTTAGGTACTTGAGG + Intronic
1073716680 10:106115309-106115331 ACTACTGTGTAAGGTACATTGGG - Intergenic
1074067614 10:110031337-110031359 GGTACAGTGCTAGGTACTTTAGG + Intronic
1075273287 10:121071659-121071681 GATAATGGGTTAGGTACTGGAGG - Intergenic
1075310079 10:121406466-121406488 GCTAAAGTGTCAGGTACTTGGGG + Intergenic
1076966733 11:94439-94461 GCTTCTGTGTTGGCTCCTTGAGG - Intergenic
1081354724 11:42098430-42098452 GCCACTGTGGTAGGTAGTCGAGG - Intergenic
1082677587 11:56126555-56126577 GGTACTGTTCTAGGTACTGGGGG - Intergenic
1082680303 11:56159882-56159904 GCGACTGTGTCATGTACTGGTGG - Exonic
1085296706 11:75435467-75435489 GCTTCTGTGTCAGGTACAGGTGG + Exonic
1085469807 11:76750374-76750396 GGTCCTGTGTTAGGCACTAGAGG + Intergenic
1089703963 11:120263950-120263972 CCTACTGTTTTAGACACTTGGGG + Intronic
1091671982 12:2458392-2458414 GCCACTGTGTTCAGTACCTGGGG - Intronic
1091768348 12:3136436-3136458 GCCCCTGTGTCAGGTACTGGGGG + Intronic
1092893746 12:12993567-12993589 GCCACTGTGTTAGATACTTTGGG + Intronic
1095842086 12:46704205-46704227 GCAAGTATGTTAGGTTCTTGAGG + Intergenic
1099845900 12:88028173-88028195 GCCACTCTGCTAAGTACTTGGGG + Intronic
1100420431 12:94427031-94427053 GCCATTGTATTAGTTACTTGTGG - Intronic
1100939153 12:99706511-99706533 GCTTCTGTGTTAGGGACCTATGG + Intronic
1101057830 12:100937506-100937528 GGTACTGTGCTAGGTGCTTATGG - Intronic
1104068976 12:125328405-125328427 GCTACTGTGTTAGTCTCCTGGGG + Intronic
1104077697 12:125405060-125405082 GCCACTGTGTTAGCTTCCTGGGG + Intronic
1105051112 12:133051938-133051960 GTTACTGTGCTAGGTACTATGGG + Intronic
1105605060 13:21920440-21920462 GCTACTCTGGTGGGGACTTGGGG - Intergenic
1106929100 13:34644539-34644561 GATACTCTGCTAGGTATTTGTGG + Intergenic
1110234965 13:73207438-73207460 GCTTCTGTCTTAGCAACTTGTGG - Intergenic
1116905383 14:50398123-50398145 GCTTCTGTGTTAGATACATATGG - Intronic
1117280018 14:54230561-54230583 AGTACTATGTTAGGTACTTGAGG + Intergenic
1118191136 14:63581408-63581430 ACTACTGTGCTAGTTACTTGGGG + Intergenic
1120908474 14:89642890-89642912 GGCACTGTGCTAGGTACTGGGGG - Intergenic
1122574988 14:102736363-102736385 GCTACGGTTTTAGGTGCTTCTGG - Intergenic
1124086649 15:26557153-26557175 GCTCCTGTGTTAGTTACCTTAGG - Intronic
1124430346 15:29602229-29602251 GGTACTGTAGTAGGTGCTTGGGG - Intergenic
1134425766 16:14142571-14142593 GCTACTGTCTAAGGTAAATGTGG - Intronic
1135663550 16:24316777-24316799 GCCACTGTGTCAGGAACTTGGGG - Intronic
1136485731 16:30570889-30570911 TCAACTGTGTTGGGTACTAGAGG - Intronic
1144357490 17:14459960-14459982 GTTACTGTGGTAGGTCCTTAGGG - Intergenic
1146098686 17:29957591-29957613 GCTCCTGTGTTAGTTTGTTGAGG + Intronic
1146466826 17:33092828-33092850 GCTACTGTGCTAGGGACATTAGG - Intronic
1147773355 17:42883140-42883162 GGTACTGTGCTAGGTGCTGGCGG + Intergenic
1147891992 17:43723852-43723874 GGCTCTGTTTTAGGTACTTGGGG - Intergenic
1149536125 17:57434905-57434927 GGTGCTGTGTTAGGCACTGGGGG + Intronic
1151584562 17:75001334-75001356 GCTGCTTGGTTAGGTACTGGGGG - Exonic
1155099834 18:22599751-22599773 GCTGCTATGTGAGGCACTTGGGG - Intergenic
1156280856 18:35636643-35636665 GATACTGTGTCAGGTACTGTAGG - Intronic
1156448272 18:37252799-37252821 GCTACTGTGTTAGGTACTTGGGG - Intronic
1160643536 19:164062-164084 GCTTCTGTGTTGGCTCCTTGAGG - Intergenic
1166848787 19:45747328-45747350 TCTCCTGTGTTAGAGACTTGGGG + Intronic
927097155 2:19756175-19756197 ACCACTGTATTAGGTTCTTGGGG - Intergenic
929379190 2:41329944-41329966 TATACTGGGTTAGTTACTTGTGG + Intergenic
932082972 2:68732188-68732210 GCTGCTGTGTTGGGCCCTTGTGG + Intronic
932689274 2:73898659-73898681 GGTACTGTGTGTGGTTCTTGGGG - Intronic
933466752 2:82661156-82661178 TCTATTTTGTTAGGTATTTGGGG - Intergenic
933611402 2:84439817-84439839 GCTACTTGGTTAGTTCCTTGAGG - Intronic
935151709 2:100442840-100442862 GGTATTGTGTTAGGCATTTGTGG - Intergenic
937013065 2:118578785-118578807 GATACTGTGTAAGCAACTTGTGG + Intergenic
940994259 2:160130137-160130159 GTTACTGTGCTGGGTACTGGAGG + Intronic
943702840 2:191005181-191005203 GAAACTGTGATAGGTACATGGGG - Intronic
945692936 2:213064521-213064543 GCTACTGTGTTAGCTAATAAAGG - Intronic
1172386192 20:34535772-34535794 GCAACTGAGTTAGGTGTTTGTGG - Intronic
1179016509 21:37598319-37598341 GCTTCTGTGTGAGGAACCTGTGG + Intergenic
1179193579 21:39144021-39144043 GCTGCTGTTCTAGGTGCTTGAGG - Intergenic
1180582955 22:16858838-16858860 GATGCTGTGTTAAGTGCTTGGGG + Intergenic
1182608981 22:31530540-31530562 GACACTGTGCTAGGTACTGGAGG + Intronic
953451122 3:43007235-43007257 GCCATTGTGTTGGATACTTGGGG + Intronic
955919721 3:63942982-63943004 GGTACTGTGCTATGTACTTGTGG + Intronic
957941655 3:87013515-87013537 GCAACTTTATTAGGTACCTGTGG - Intergenic
960003724 3:112760548-112760570 GATCCTGTGTTAGTTTCTTGTGG + Intronic
960097084 3:113699113-113699135 ACTACTGTGTGCGGTACCTGGGG + Intergenic
960632061 3:119742388-119742410 AGTACTGTGTTACGTAATTGGGG - Intronic
961826817 3:129603512-129603534 GCAACTGTGTTTGGCACTGGGGG - Intronic
962528928 3:136260613-136260635 GACACTGAGCTAGGTACTTGGGG + Intronic
963470031 3:145728787-145728809 GCTACATTCTGAGGTACTTGGGG + Intergenic
964055452 3:152450733-152450755 GCTACTGTGTTAGGTTGTGCGGG - Intronic
965009296 3:163065073-163065095 GTCATTGTGTTAGGTAATTGTGG - Intergenic
968218922 3:196919003-196919025 GCTCCAGTGTTAGGTATGTGTGG - Intronic
969854769 4:9990365-9990387 GCTGCTGTGTTGGGTGCTAGGGG + Intronic
970954327 4:21792998-21793020 GCTACTGCCTTAGGTGTTTGGGG + Intronic
973801586 4:54483690-54483712 GTCACTGTGCTAGGTGCTTGGGG + Intergenic
975868774 4:78754332-78754354 GGCACTGTGTTATGTACTTGAGG - Intergenic
976708951 4:88048521-88048543 GCTTCTGTGTTAGGCATTTCCGG + Intronic
979830420 4:125293743-125293765 GCTCCTGTGTTAGTTTGTTGAGG - Intergenic
981515712 4:145607174-145607196 CCTAATGTATTAGGTATTTGTGG + Intergenic
982403029 4:154989527-154989549 GCTACTGTGTTCGTTTCCTGTGG + Intergenic
984309511 4:178038900-178038922 GCTACTGATTTAGTTAATTGAGG + Intergenic
984821613 4:183887463-183887485 GGTACTGTGTGAGCTACTGGAGG + Intronic
984886648 4:184455547-184455569 GCTACTGTGCTCGGTATTTTGGG - Intronic
985794697 5:1953318-1953340 TCTACTGTGTTAGGAAATTCTGG + Intergenic
987658580 5:20841537-20841559 GATACTGTGTTTAGTACCTGAGG + Intergenic
988765104 5:34364397-34364419 GATACTGTGTTTAGTACCTGAGG - Intergenic
989459198 5:41677768-41677790 ACCACTGTGTTAGATATTTGGGG - Intergenic
989997779 5:50856007-50856029 GGTACTGTGCTAGGCACTGGGGG + Intergenic
992423091 5:76626598-76626620 ACTACATTGTTAGGTCCTTGAGG + Intronic
994614647 5:102089259-102089281 GCTCCGGTGTTGGGTCCTTGTGG + Intergenic
994676867 5:102834379-102834401 GGCACTGTGCTAGGTACTGGTGG + Intronic
1001335945 5:170796788-170796810 AGCACTGTGCTAGGTACTTGGGG - Intronic
1002751154 6:113389-113411 GCTTCTGTGTTGGCTCCTTGAGG - Intergenic
1004511806 6:16289301-16289323 GCTACTGTGTTCGGAACTGGTGG - Intronic
1012559646 6:100564672-100564694 CCTACTATGTTAGGTACAAGAGG - Intronic
1012893197 6:104920187-104920209 GCTATTGTGTTAGGAAATTTTGG - Intergenic
1013768728 6:113602854-113602876 GCTACTATGTGAGGCACTGGTGG - Intergenic
1014739113 6:125126478-125126500 GCTACTCTGGTGGGGACTTGGGG + Intronic
1016820420 6:148341789-148341811 GCTCCTCTGTTAGGGCCTTGTGG - Intronic
1017979355 6:159386072-159386094 GCCACTGTGTTAGGAGGTTGTGG + Intergenic
1018307959 6:162478082-162478104 GAGACTGTGGTAGGTACTAGGGG - Intronic
1021085035 7:16412661-16412683 GACACTGTGTGAGGTACTTAAGG - Intronic
1022431884 7:30332468-30332490 GGTACTATGTTTGCTACTTGGGG - Intronic
1023249304 7:38240449-38240471 GCTGATGTGTTAGGTAGTTGTGG + Intergenic
1023250950 7:38260513-38260535 GCTGATGTGTTAGGTAGTTGTGG + Intergenic
1024602551 7:50996676-50996698 GGTACTGTGCTAGGTACCTGGGG - Intergenic
1026193655 7:68152576-68152598 CCTACTGTATTAGTTACCTGTGG - Intergenic
1027343454 7:77234074-77234096 ACTACTGGGTAAGGTAATTGTGG - Intronic
1030272980 7:107689973-107689995 TTTACCGTGATAGGTACTTGGGG - Intronic
1033414267 7:141148380-141148402 GGTTCTGTTTTAGGTCCTTGTGG - Intronic
1038074217 8:24051798-24051820 GTTCCTGTGTTAGTTACCTGAGG - Intergenic
1038456961 8:27679826-27679848 GCTGCTGTAACAGGTACTTGTGG - Intergenic
1039707596 8:40023290-40023312 GGTACTGTGATAGGACCTTGAGG - Intergenic
1041783396 8:61603710-61603732 TCTAATGTGTGAAGTACTTGGGG - Intronic
1042504883 8:69549388-69549410 CCTACTGTGATAGATAATTGAGG + Intronic
1043583859 8:81744811-81744833 GGCACTGTGTTAGGCACTGGAGG - Intronic
1045184422 8:99822561-99822583 GCTACTTTGTTAGGTGCTAGAGG - Intronic
1046256821 8:111710255-111710277 GCTACTCTGTTAAGTGCTTTAGG - Intergenic
1047484334 8:125315223-125315245 ACTACTCTGTTTGGTACTTGGGG - Intronic
1048018382 8:130517463-130517485 GCTACTGTGCTAGGCCCTTTGGG + Intergenic
1048121440 8:131585971-131585993 GATACTGTATTAGGTCCTGGAGG + Intergenic
1052374073 9:27698040-27698062 GGTACTGATGTAGGTACTTGAGG - Intergenic
1052376576 9:27724307-27724329 GCTACTTTGTTAAGTGCTTGGGG - Intergenic
1056301160 9:85243333-85243355 GCTGCTGTGTGAGCTTCTTGAGG - Intergenic
1056863416 9:90207980-90208002 GCTCCTGTGTTAGTTTGTTGAGG + Intergenic
1058291461 9:103245908-103245930 TCTAGTGAGTTATGTACTTGAGG + Intergenic
1059686152 9:116638376-116638398 TCTCCTATGTTAGTTACTTGTGG - Intronic
1062757791 9:138313041-138313063 GCTTCTGTGTTGGCTCCTTGAGG + Intergenic
1186641595 X:11461499-11461521 GCAAGTGTGTTAGGCACTTGGGG - Intronic
1187069244 X:15871778-15871800 GCTTGTGTGTTAGGTGCTTTGGG - Intergenic
1187257023 X:17652989-17653011 GGTACTGTGCTGGGTGCTTGTGG - Intronic
1188554616 X:31398070-31398092 TGTACTGTGTTATGTACATGAGG + Intronic
1190738376 X:53270698-53270720 GGCACTGTGTTAGGCACTAGGGG - Intronic
1193663181 X:84281913-84281935 CCTTCTGTGTTAGGTGTTTGAGG - Intergenic
1195608879 X:106841113-106841135 GATACTCTGCTAGGTACTTAAGG + Intronic
1198523110 X:137472686-137472708 GCTCCAGTGTTGGGTTCTTGAGG - Intergenic
1198620955 X:138509119-138509141 GCTCCTGTGTTAGTTTGTTGAGG - Intergenic
1199901342 X:152175425-152175447 GGTTCTGTGCTAGGTGCTTGGGG + Intronic