ID: 1156448392

View in Genome Browser
Species Human (GRCh38)
Location 18:37253376-37253398
Sequence CGGGCGGCTGCAGCTCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156448384_1156448392 1 Left 1156448384 18:37253352-37253374 CCGGGGGTCTGGGAGCAGGCCCC 0: 1
1: 0
2: 2
3: 61
4: 413
Right 1156448392 18:37253376-37253398 CGGGCGGCTGCAGCTCTTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 139
1156448376_1156448392 26 Left 1156448376 18:37253327-37253349 CCTGGAAGAACTGGGGAGGAGAG 0: 1
1: 0
2: 2
3: 50
4: 460
Right 1156448392 18:37253376-37253398 CGGGCGGCTGCAGCTCTTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 139
1156448375_1156448392 29 Left 1156448375 18:37253324-37253346 CCTCCTGGAAGAACTGGGGAGGA 0: 1
1: 0
2: 1
3: 24
4: 229
Right 1156448392 18:37253376-37253398 CGGGCGGCTGCAGCTCTTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 139
1156448373_1156448392 30 Left 1156448373 18:37253323-37253345 CCCTCCTGGAAGAACTGGGGAGG 0: 1
1: 0
2: 1
3: 30
4: 265
Right 1156448392 18:37253376-37253398 CGGGCGGCTGCAGCTCTTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156448392 Original CRISPR CGGGCGGCTGCAGCTCTTCT GGG Intronic
900712782 1:4125020-4125042 CAGGTGGCTGCAGGTGTTCTGGG + Intergenic
901319401 1:8330398-8330420 CGGGAGGCTGGGGCTCTTCATGG - Exonic
903743771 1:25573409-25573431 CTGGCGGCTGCTGCTCCTGTAGG + Intergenic
905779047 1:40691831-40691853 GGGGCGGCTCCTGCTCTTCCTGG + Exonic
907419125 1:54335016-54335038 CTGGGGGTTGCAGCTCTTCCCGG - Intronic
910759408 1:90719649-90719671 CGGGCAGCTCTCGCTCTTCTCGG + Intergenic
915017119 1:152744459-152744481 GGGGCTGCTGCAGCTCTGATTGG + Intronic
915367339 1:155323562-155323584 CGGGCAGCAGCTGCTCCTCTGGG - Intronic
916168260 1:161982271-161982293 AGGCCGGCTGCAGCTTGTCTGGG - Intergenic
917426747 1:174922387-174922409 CATGTGGCTGCAGCTCTTTTTGG + Intronic
919607008 1:199695355-199695377 TGGGCTGCTTCAGCTCTTTTTGG + Intergenic
923040127 1:230313967-230313989 CGGGCAGTTGCAGCTCTCCTGGG + Intergenic
923986388 1:239387032-239387054 GGGGCCGCAGCAGCGCTTCTGGG + Intronic
1062909479 10:1203523-1203545 CCGGCGTCTGCAGCTCTGCAGGG + Intronic
1062938157 10:1403039-1403061 CGTGCGCCTGGAGCTCTGCTGGG + Intronic
1065215015 10:23439958-23439980 CGGGCCGCAGCAGCTCCTCCAGG - Exonic
1066703312 10:38152460-38152482 ATGGTGGCTGCAGCTCTCCTAGG + Intergenic
1066987471 10:42480756-42480778 ATGGTGGCTGCAGCTCTCCTAGG - Intergenic
1067062834 10:43086796-43086818 CAGGCCGCTGCAGCTGGTCTGGG + Intronic
1068134666 10:52940083-52940105 CTGGCGGCCCCAGCTCTCCTCGG - Intergenic
1070728425 10:78808214-78808236 CGGAGGGCTGGAGCTCGTCTCGG - Intergenic
1072335666 10:94395797-94395819 TGGGTGGCTGCAGCTCTGCTGGG + Intergenic
1076242029 10:128915783-128915805 GAAGCGGCTGCAGCTCTTCTGGG + Intergenic
1078190741 11:9091271-9091293 CTGGCGGCTGCAGCTCCGCGGGG - Intronic
1078303214 11:10156016-10156038 TGGGCGGCTGCAGCTGTGCCTGG - Intronic
1079472442 11:20790752-20790774 TGGGCGGCTGCAGCTATGCCTGG + Intronic
1081429040 11:42955992-42956014 AGGGTGGCTGCTGCGCTTCTGGG - Intergenic
1081668111 11:44928232-44928254 CAGGCAGCTGCAGCCCTTCCCGG - Intronic
1082765363 11:57163444-57163466 AGGAAGGCTGCAGCTATTCTAGG + Intergenic
1086381674 11:86261461-86261483 CGGGTGCCTGCAGCTCTTGCAGG + Intronic
1090205303 11:124880487-124880509 CGGCCGGCAGCAACTCTTCCAGG + Exonic
1091403671 12:196106-196128 CCGGCGGCCGCAGCTCACCTCGG + Exonic
1099109437 12:78538990-78539012 AGGGAAGCTGCACCTCTTCTGGG + Intergenic
1100565427 12:95790276-95790298 CGCGCGGCTGCTGCTGCTCTGGG - Exonic
1101764096 12:107682610-107682632 CGGGCGGCTGCAGCTGCACCTGG + Intergenic
1102601914 12:114037705-114037727 CTGGCGGCTGCAGCTGCCCTGGG + Intergenic
1102884068 12:116508501-116508523 CGGGGGGCTGCTGCGCTGCTCGG + Intergenic
1103318287 12:120074556-120074578 GGAGTCGCTGCAGCTCTTCTAGG - Intronic
1105954602 13:25268814-25268836 TGGGCGGCTGCAGCTGTGCCCGG - Intronic
1106246441 13:27954085-27954107 CGGGCGGCTGCAGCTTTGACGGG + Intergenic
1107699932 13:43036991-43037013 TGGGCGGCTGCAGCTGCTCCTGG + Intronic
1109345772 13:61113393-61113415 TGGGTGGCTGCAGCTGTTCCTGG - Intergenic
1110025793 13:70537846-70537868 CGGGGAGCTGCAGTTCTTTTTGG - Intergenic
1111119143 13:83823572-83823594 TGGGCAGCTGCAGCTGTGCTGGG - Intergenic
1112562838 13:100529127-100529149 CGGGCCACTTCTGCTCTTCTTGG - Intronic
1114643889 14:24242729-24242751 CGGGCAGCTACAGCTCCGCTGGG - Intergenic
1114651440 14:24287211-24287233 CTGGCACCTGCAGCCCTTCTTGG + Intergenic
1116258421 14:42587995-42588017 CTGGTGCCTGCTGCTCTTCTGGG + Intergenic
1117158108 14:52960857-52960879 CAGGTGGCAGCAGCACTTCTAGG - Intergenic
1118887724 14:69880188-69880210 GGGGCGGGTGCAGCTCTGCCTGG + Intronic
1122220838 14:100238557-100238579 CGCGCGGCTGCCGCCCTTCGCGG - Intronic
1122977307 14:105176128-105176150 GGGGTGGCTCCAGCTCTCCTGGG - Intronic
1123123134 14:105927269-105927291 CTGCAGGCTGCAGCTTTTCTGGG - Intronic
1124462442 15:29904931-29904953 CTGGCGGCTGCAGTTCCTATTGG - Intronic
1128938393 15:71768232-71768254 CGGGGGGCTGCCTCTCTTTTGGG - Intronic
1128965167 15:72051472-72051494 TGGGCGGCTGCAGCTGTGCCTGG - Intronic
1129130302 15:73487677-73487699 TGGGTGCCTGCAGCTCTTCCAGG + Intronic
1131423205 15:92324701-92324723 CGAGCTGCTGCACCTCCTCTGGG - Intergenic
1132648921 16:1011792-1011814 GGGGCAGCTGCAGCCCTTGTGGG - Intergenic
1132652298 16:1027011-1027033 CTGGCGGCTGCCGCTGTCCTGGG - Intergenic
1133040571 16:3058233-3058255 CGCACGGCTGCACCGCTTCTGGG + Exonic
1133100440 16:3476043-3476065 GGGGCGACTGCAGCGCCTCTTGG + Intronic
1136227311 16:28867557-28867579 CCTGGGGCTGCAGCTTTTCTGGG + Intronic
1139095819 16:63703646-63703668 CGAGCGGCCGCAGCTCTTCATGG - Intergenic
1139812722 16:69636307-69636329 TGAGTGGCTGCAGCTTTTCTAGG + Intronic
1142810122 17:2392090-2392112 CGGGCGGCGGGATCTGTTCTGGG - Intronic
1143319919 17:6061573-6061595 AGGCCAGCTGCAGCTCCTCTCGG - Intronic
1145034887 17:19534032-19534054 AGAGCGCCCGCAGCTCTTCTCGG - Exonic
1145217213 17:21061339-21061361 TGGGCTGCTGCAGCTGTGCTTGG + Intergenic
1151180028 17:72320600-72320622 CAGGGAGCTGCAGCTCATCTAGG + Intergenic
1151632131 17:75318356-75318378 CAGGAGGCGGCAGCTCTTCTGGG - Exonic
1152198265 17:78930119-78930141 CGGGAGGATGCTGCTCTTCTCGG + Intergenic
1152324932 17:79630432-79630454 GAGGCGGCTTGAGCTCTTCTCGG + Intergenic
1152381067 17:79942473-79942495 CGGGCTGCTGCTGCTCTCCTGGG + Intronic
1152680461 17:81665308-81665330 CAGGCTGCTGCAGCACTTCCAGG - Exonic
1156448392 18:37253376-37253398 CGGGCGGCTGCAGCTCTTCTGGG + Intronic
1157140803 18:45104162-45104184 AGGGAGACTGCTGCTCTTCTAGG + Intergenic
1160894865 19:1397603-1397625 TGGGCGGCTGCAGCTCCCGTGGG + Intronic
1161774215 19:6249622-6249644 CTGGGGGCTCCAGCTCTTCAAGG - Intronic
1165834139 19:38744081-38744103 CGGGCGCCTGCAGCTTTTTCGGG - Exonic
1166685180 19:44792382-44792404 GGAGCAGCTGCAGCTCTACTGGG + Exonic
1167638649 19:50668579-50668601 CGGGAGGCCGCCGCCCTTCTGGG + Exonic
1168423051 19:56217670-56217692 CTGGCGCCTGCGGATCTTCTGGG + Intergenic
927997201 2:27494758-27494780 CGGGGGGCAGCAGCTCTCCTGGG + Intronic
931386257 2:61800408-61800430 CAGGCTGCTGCAGCTGCTCTAGG + Intergenic
932501707 2:72188032-72188054 TGGGTGGCTGCAGCTGTGCTGGG + Intronic
934164094 2:89278634-89278656 CTGGTGGCTGCAGCTTTCCTTGG - Intergenic
934203180 2:89903890-89903912 CTGGTGGCTGCAGCTTTCCTTGG + Intergenic
934690194 2:96352641-96352663 CAGGAGGGGGCAGCTCTTCTGGG - Intronic
937271373 2:120655001-120655023 GGGGGGGCTTCAGCCCTTCTCGG + Intergenic
1170639394 20:18138200-18138222 CGGCCGGCGGCCGCTCTGCTGGG + Intronic
1172183885 20:33019672-33019694 CCTGCGGCTGCAGCCCTTCGTGG + Exonic
1174753431 20:53135246-53135268 TGGAGGGCTGGAGCTCTTCTGGG - Intronic
1175806207 20:61830555-61830577 GGGGCCGCTGCAGATCTCCTGGG - Intronic
1175916666 20:62429144-62429166 CGTGAGGCTGCAGCTCTGCTGGG + Intergenic
1175953362 20:62595750-62595772 GTGGAGGCTGCAGCTCTACTGGG - Intergenic
1179720896 21:43315563-43315585 GGGGCCCCTGCAGCTCTTCAAGG - Intergenic
1179923457 21:44520129-44520151 TGGGCGCCTGCGGCTCATCTGGG + Intronic
1183465370 22:37977728-37977750 TGGGCCCCTGCAGCTCTGCTGGG + Intronic
1184657366 22:45948497-45948519 CCGGCAGCTGCGGCTCTGCTCGG + Intronic
1184822239 22:46917999-46918021 AGGCCGCCTGCAGCTCTTCAGGG - Intronic
952416207 3:33093408-33093430 CGGACGGCTGTCGCTCCTCTGGG - Exonic
961453046 3:127011131-127011153 CTTCCGGCTGCAGCTGTTCTGGG + Intronic
964623332 3:158736267-158736289 AAGGCTCCTGCAGCTCTTCTGGG - Intronic
965087138 3:164113726-164113748 TGGGCAGCTGCAGCTGTTCAGGG - Intergenic
968278173 3:197456703-197456725 CGGGCTGCTGCAGCGGTTCCGGG - Intergenic
973534632 4:51868226-51868248 TGGGCGGCTGCAGCTGTTCCTGG + Intronic
975668141 4:76754335-76754357 AGAGCGGCAGCATCTCTTCTTGG - Exonic
978248676 4:106604764-106604786 CAGGTGGCTGCAGCTTTGCTTGG + Intergenic
981260103 4:142708891-142708913 TGAGTGGCTGCAGCTTTTCTAGG - Intronic
981285879 4:143019090-143019112 CAAGCGGCTGCAGCTGTGCTGGG + Intergenic
981654776 4:147100889-147100911 CAGGTTGCTGCTGCTCTTCTTGG - Intergenic
984923477 4:184786102-184786124 TGGGCGGCTGGAGCCCATCTGGG - Intronic
985064072 4:186104777-186104799 CGGGCGGCGGCCGCGCTTCCCGG + Intronic
985544979 5:504911-504933 CAGGCGTCTGCTGCTCTTCCAGG - Intronic
989730561 5:44642312-44642334 TGGGCAGCTGCAGCTGTGCTTGG + Intergenic
995047885 5:107671004-107671026 CGGGCGGCTGCAGCGCGGGTCGG + Intergenic
996117651 5:119635317-119635339 GGAGGTGCTGCAGCTCTTCTAGG + Intronic
999887298 5:155937177-155937199 TGGGTGGCTGCAGCTGTGCTTGG + Intronic
1000157273 5:158564069-158564091 GGGGCAGATGCAGCTCCTCTAGG - Intergenic
1000269789 5:159672999-159673021 TGAGAGGCTGCAGCTTTTCTAGG - Intergenic
1005594623 6:27367814-27367836 TGGGCAGCTGCAGCTGTTCCTGG - Intergenic
1007236027 6:40392075-40392097 CGGGCGGCTACAGTCCTCCTCGG - Exonic
1011366946 6:86593063-86593085 GGGTAGGCTGCAGCTTTTCTTGG - Intergenic
1013149098 6:107426581-107426603 TGAGTGGCTGCAGCTTTTCTGGG - Intronic
1017311555 6:152982705-152982727 CGGGCGGCGGCAGCGGTTCCTGG - Intronic
1019716487 7:2541717-2541739 CCAGCGGCTGCAGCTCCTCCAGG + Exonic
1020276310 7:6626755-6626777 CTGGGGGCTGCATCTCTGCTTGG + Intergenic
1021451032 7:20784319-20784341 CGGGGGGCTGCAGCAGCTCTGGG + Exonic
1022943785 7:35262256-35262278 CGGCCAGCTGCAGCTTTTCTGGG + Intergenic
1023353120 7:39339927-39339949 CGGGGGGCTGGAGCTCTGCTGGG - Exonic
1023829613 7:44031090-44031112 CTGGGGGCAGCAGCTCCTCTTGG + Intergenic
1029739921 7:102485348-102485370 CTGGGGGCAGCAGCTCCTCTTGG + Intronic
1029775856 7:102683588-102683610 CTGGGGGCAGCAGCTCCTCTTGG + Intergenic
1030304304 7:108003243-108003265 CGGGCGGCCGCAACTCTGCGAGG + Exonic
1032515256 7:132502080-132502102 CTGGCTTCTGCAGGTCTTCTTGG - Intronic
1034150466 7:148911075-148911097 GGGGCTGCAGTAGCTCTTCTGGG + Intergenic
1035745233 8:1957206-1957228 CGGTCGGCGCCAGCTCTTCCTGG - Exonic
1037777307 8:21844165-21844187 CTGGACTCTGCAGCTCTTCTAGG - Intergenic
1038445095 8:27598168-27598190 TGGGGGGCTGCAGCTCATCTTGG + Exonic
1038663146 8:29514328-29514350 CAGGCGGATGCAGCTCTTGTAGG + Intergenic
1041734518 8:61095523-61095545 AGGGTGCCTGCAGCCCTTCTTGG + Intronic
1044726854 8:95201394-95201416 CTGACGGCTGCAGCGTTTCTTGG + Intergenic
1048303295 8:133266810-133266832 CGGGGGGCTGCAGTTCCTCTGGG + Intronic
1049162685 8:141107518-141107540 GTGATGGCTGCAGCTCTTCTGGG + Intergenic
1049762522 8:144337667-144337689 CGCGCGGCTGCAGCTCCCCACGG + Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056488805 9:87085177-87085199 AGGGCGGCTCCTGCTCTTCCTGG - Intergenic
1061061733 9:128254025-128254047 CGGGGGGCTGCAGGTCTCGTAGG - Intronic
1061884251 9:133583668-133583690 CGCCTGGCTGCAGCTCCTCTGGG + Intronic
1062296028 9:135827468-135827490 CGGGGGGCTGCAGCTCAGCCAGG + Exonic
1185453090 X:293195-293217 TGGGCGGCCGCAGCTCTTCATGG - Exonic
1186522655 X:10220077-10220099 AGGGGGGATGCAGCTTTTCTGGG + Intronic
1187969975 X:24649326-24649348 AGGGCTGCTGCTGCACTTCTTGG - Intronic
1197785159 X:130191158-130191180 GGGGCTGCTCCAGCTATTCTGGG - Intergenic
1197902911 X:131392877-131392899 GGGGCTGCTCCAGCTATTCTGGG - Intronic
1200073302 X:153539352-153539374 CGGACAGCTGCGGCTCTTCTGGG + Intronic