ID: 1156449022

View in Genome Browser
Species Human (GRCh38)
Location 18:37256096-37256118
Sequence GGCACTGTCTCCCAAGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 362}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156449009_1156449022 17 Left 1156449009 18:37256056-37256078 CCCTCCCCTGCAGACTGGAGGCC 0: 1
1: 0
2: 4
3: 38
4: 345
Right 1156449022 18:37256096-37256118 GGCACTGTCTCCCAAGTTCATGG 0: 1
1: 0
2: 1
3: 21
4: 362
1156449011_1156449022 13 Left 1156449011 18:37256060-37256082 CCCCTGCAGACTGGAGGCCCCTG 0: 1
1: 0
2: 2
3: 53
4: 352
Right 1156449022 18:37256096-37256118 GGCACTGTCTCCCAAGTTCATGG 0: 1
1: 0
2: 1
3: 21
4: 362
1156449021_1156449022 -6 Left 1156449021 18:37256079-37256101 CCTGTGGCAGGGCTCTGGGCACT 0: 1
1: 0
2: 2
3: 43
4: 303
Right 1156449022 18:37256096-37256118 GGCACTGTCTCCCAAGTTCATGG 0: 1
1: 0
2: 1
3: 21
4: 362
1156449012_1156449022 12 Left 1156449012 18:37256061-37256083 CCCTGCAGACTGGAGGCCCCTGT 0: 1
1: 0
2: 2
3: 27
4: 229
Right 1156449022 18:37256096-37256118 GGCACTGTCTCCCAAGTTCATGG 0: 1
1: 0
2: 1
3: 21
4: 362
1156449013_1156449022 11 Left 1156449013 18:37256062-37256084 CCTGCAGACTGGAGGCCCCTGTG 0: 1
1: 0
2: 3
3: 33
4: 288
Right 1156449022 18:37256096-37256118 GGCACTGTCTCCCAAGTTCATGG 0: 1
1: 0
2: 1
3: 21
4: 362
1156449019_1156449022 -4 Left 1156449019 18:37256077-37256099 CCCCTGTGGCAGGGCTCTGGGCA 0: 1
1: 1
2: 7
3: 49
4: 394
Right 1156449022 18:37256096-37256118 GGCACTGTCTCCCAAGTTCATGG 0: 1
1: 0
2: 1
3: 21
4: 362
1156449010_1156449022 16 Left 1156449010 18:37256057-37256079 CCTCCCCTGCAGACTGGAGGCCC 0: 1
1: 0
2: 2
3: 39
4: 372
Right 1156449022 18:37256096-37256118 GGCACTGTCTCCCAAGTTCATGG 0: 1
1: 0
2: 1
3: 21
4: 362
1156449020_1156449022 -5 Left 1156449020 18:37256078-37256100 CCCTGTGGCAGGGCTCTGGGCAC 0: 1
1: 0
2: 4
3: 31
4: 315
Right 1156449022 18:37256096-37256118 GGCACTGTCTCCCAAGTTCATGG 0: 1
1: 0
2: 1
3: 21
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156449022 Original CRISPR GGCACTGTCTCCCAAGTTCA TGG Intronic
900268027 1:1769643-1769665 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
900610656 1:3543265-3543287 GGCAGTGTGTGCCAAGTTGATGG - Intronic
900720773 1:4174510-4174532 CCCACTGTGCCCCAAGTTCATGG - Intergenic
900956404 1:5888759-5888781 GGCACTGTGTCCCATGTCCTTGG - Intronic
901100132 1:6713494-6713516 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
901473924 1:9476082-9476104 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
902081145 1:13821543-13821565 ACCTCTGTCTCCCAGGTTCAAGG + Intronic
902463004 1:16593381-16593403 AGAACAGTCTCCCAAGTTCCAGG - Intronic
902919582 1:19657930-19657952 CGCACTGTGCCCCAAGTTCTAGG + Exonic
903074854 1:20756485-20756507 GCCTCTATCTCCCAGGTTCAAGG - Intronic
903158510 1:21467347-21467369 AGAACAGTCTCCCAAGTTCCAGG + Intronic
903750458 1:25617632-25617654 GGGACTGTCCCCGAAGTTCAGGG - Exonic
904523783 1:31116374-31116396 GGCACTGTCATCCAATTCCATGG + Intergenic
905100322 1:35515227-35515249 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
905216042 1:36408293-36408315 ACCTCTGCCTCCCAAGTTCAAGG - Intergenic
905710067 1:40094539-40094561 GGCACTCACTCTCAAATTCAGGG - Intronic
906055895 1:42916833-42916855 AGCACTCTGTCTCAAGTTCAGGG - Intergenic
910410193 1:86934811-86934833 GGCTCTGTCTCCCAAGTAGCTGG - Intronic
913543699 1:119845841-119845863 CGAACAGTCTCCCAAGTTCCAGG - Intergenic
914798725 1:150943591-150943613 ACCACTGCCTCCCAGGTTCAAGG - Intronic
914864969 1:151419245-151419267 GCCTCAGTCTCCCAAGTTCCTGG - Intronic
915695366 1:157736012-157736034 GCCTCTGTCTCCCAAGTAGATGG + Intergenic
917965314 1:180175072-180175094 AGCTCTGCCTCCCAGGTTCAAGG - Intronic
919733588 1:200930106-200930128 GGGAGTGTCTCCAAAGCTCAAGG + Intergenic
921132184 1:212229437-212229459 AGCTCTGCCTCCCAGGTTCACGG + Intergenic
922571772 1:226638544-226638566 GCCACTGTGCCCCAAGTGCACGG - Intronic
923539617 1:234878501-234878523 GGCAGTGGCTCCCAAGGCCACGG + Intergenic
1063378801 10:5571344-5571366 GGGACTGGATCCCAAGATCATGG + Intergenic
1064582100 10:16805122-16805144 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1064862212 10:19839101-19839123 GCCCCTGCTTCCCAAGTTCAAGG - Intronic
1065294482 10:24261411-24261433 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1065727398 10:28678894-28678916 CGAACTGTCTCCGAATTTCAAGG + Intronic
1065960762 10:30732405-30732427 GGCAGTGTTTGCCAAGCTCAGGG - Intergenic
1066336710 10:34485253-34485275 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1067059594 10:43071108-43071130 GGGACAGTCTCCCAAACTCAAGG - Intergenic
1067382023 10:45783542-45783564 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1067889721 10:50124185-50124207 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1068259586 10:54562071-54562093 ACCTCTGCCTCCCAAGTTCAAGG + Intronic
1070593298 10:77815576-77815598 ATCTCTGCCTCCCAAGTTCAAGG - Intronic
1071333751 10:84585364-84585386 GGCACTGTCGTCCAAGGGCAGGG + Intergenic
1072541168 10:96398952-96398974 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1072583651 10:96762300-96762322 ATCTCTGTCTCCCAGGTTCAAGG - Intergenic
1072591390 10:96831969-96831991 CGCACTGTCCCCCAAGGCCACGG - Intergenic
1072691031 10:97572549-97572571 GGCACTGTGTCCCAAGAGCAGGG - Exonic
1072794163 10:98341718-98341740 ACCTCTGCCTCCCAAGTTCAAGG + Intergenic
1073005050 10:100317003-100317025 GCCACTGCCTCCCAGGCTCAAGG - Intronic
1073406019 10:103298720-103298742 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1073608642 10:104921388-104921410 TGCACTGTCTCCAAAGTTGCAGG - Intronic
1073676091 10:105648409-105648431 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1073928630 10:108547210-108547232 TGCACTGTCTCCCAGGCTGAAGG + Intergenic
1074551631 10:114448694-114448716 ACCTCTGTCTCCCAGGTTCAAGG + Intronic
1075708277 10:124516022-124516044 AGCTTTGTCTCCCCAGTTCAGGG + Intronic
1077421716 11:2453547-2453569 GGCACCTTCTCACATGTTCAAGG - Intronic
1078037324 11:7821035-7821057 AGCTCTGCCTCCCAGGTTCACGG + Intergenic
1078265713 11:9755203-9755225 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
1079254601 11:18817356-18817378 AGCTCTGCCTCCCAGGTTCACGG + Intergenic
1080128649 11:28767111-28767133 GGCTCTGTCTCCCAAATGGATGG + Intergenic
1081662459 11:44896459-44896481 AGCACTGTACCCCAAGTGCACGG + Intronic
1082043271 11:47704398-47704420 ACCTCTGTCTCCCAGGTTCAAGG - Intronic
1082087748 11:48064152-48064174 GGCAGGGTCTCCAAAGTACACGG + Intronic
1082819461 11:57534778-57534800 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
1083377043 11:62232404-62232426 GCAACTGTCACCCAATTTCAGGG - Intergenic
1083645392 11:64169465-64169487 GCCTCTGTCCCCCAGGTTCAAGG + Intergenic
1083783395 11:64930087-64930109 GCCACTGAGTCCCAAGCTCAAGG - Intronic
1083917507 11:65758299-65758321 AGCTCTGTCTCCCGGGTTCACGG + Intergenic
1084168033 11:67385907-67385929 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1084357174 11:68647675-68647697 GCCACAGTCTTCCAAGCTCAAGG - Intergenic
1084795877 11:71503849-71503871 GGCAATGTCTCCCCAGTTACTGG + Intronic
1085314844 11:75538545-75538567 GACAGTGTCATCCAAGTTCAAGG - Intergenic
1086476299 11:87178506-87178528 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1087551994 11:99663383-99663405 ACCTCTGTCTCCCAGGTTCAAGG - Intronic
1088556649 11:111068420-111068442 GGAAATGTATCCCATGTTCATGG - Intergenic
1089503712 11:118948936-118948958 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1093238712 12:16642280-16642302 ACCTCTGTCTCCCAGGTTCAAGG + Intergenic
1094577371 12:31699528-31699550 GGCAGTGTATCCCAACTCCATGG + Intronic
1094602180 12:31918796-31918818 ACCTCTGCCTCCCAAGTTCAAGG - Intergenic
1096082850 12:48844359-48844381 GCCTCTGCCTCCCGAGTTCAAGG + Intronic
1096723843 12:53545417-53545439 ATCTCTGCCTCCCAAGTTCAAGG + Intronic
1097532600 12:60823898-60823920 ACCTCTGTCTCCCAGGTTCAAGG + Intergenic
1097602331 12:61708688-61708710 TCCACTGTCTCATAAGTTCATGG - Exonic
1098462747 12:70750987-70751009 GCCTCTGCCTCCCAAGTGCAGGG + Intronic
1099224656 12:79955696-79955718 GGGACTGTCTCCTAGGATCATGG + Intergenic
1099735149 12:86557750-86557772 GTCACTGTTTCCCAATTTAATGG - Intronic
1100836469 12:98571481-98571503 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
1101369910 12:104117490-104117512 GGCTCTGCCTCCCAGGTTCAAGG + Exonic
1102088155 12:110161221-110161243 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1102941459 12:116946377-116946399 AGCAGTGTCTCTCTAGTTCAGGG + Intronic
1103202693 12:119101272-119101294 GAGACTGTCACCCAAGTTCCTGG - Intronic
1103654227 12:122457465-122457487 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1103898586 12:124291335-124291357 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1104287873 12:127441602-127441624 ACCTCTGTCTCCCAGGTTCAAGG - Intergenic
1104561611 12:129850391-129850413 GGCACTTAGTTCCAAGTTCACGG + Intronic
1104612940 12:130244284-130244306 GACTCTGTCTCCCAGGGTCACGG + Intergenic
1104660315 12:130607423-130607445 GGCACTGTGTGGCAAATTCAAGG - Intronic
1105020833 12:132815814-132815836 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1105221976 13:18338729-18338751 AGCTCTGTCTCCCAGGTTCACGG - Intergenic
1105712971 13:23030786-23030808 ACCTCTGTCTCCCAAGTTCAAGG - Intergenic
1106398786 13:29407558-29407580 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1107197307 13:37667950-37667972 GGCACTGTCTTCGGGGTTCATGG + Intronic
1111356599 13:87114242-87114264 GGCACTGGCTTACAATTTCAGGG - Intergenic
1112798958 13:103089371-103089393 ACCTCTGTCTCCCAAGTTCAAGG - Intergenic
1113319300 13:109216578-109216600 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
1113528753 13:111004395-111004417 GGAACTGGCTCCCATGATCACGG + Intergenic
1113532208 13:111036525-111036547 AGCCCTGCCTCCCAGGTTCAAGG + Intergenic
1114101386 14:19385050-19385072 GGCACTGTGGCCCAACTTTAGGG - Intergenic
1114328640 14:21614623-21614645 GGCCCAATCTCCCAGGTTCAAGG + Intergenic
1115216878 14:31022295-31022317 AGCTCTGCCTCCCAGGTTCACGG - Intronic
1116812964 14:49556720-49556742 ACCTCTGCCTCCCAAGTTCAAGG - Intergenic
1117376353 14:55121621-55121643 AACTCTGTCTCCCAGGTTCAAGG + Intergenic
1120203342 14:81562288-81562310 ACCTCTGTCTCCCAGGTTCAAGG + Intergenic
1120305918 14:82770607-82770629 GGCTCGGTCTCCCAAGTAGATGG + Intergenic
1120438709 14:84509729-84509751 ACCTCTGCCTCCCAAGTTCAAGG + Intergenic
1123028439 14:105439474-105439496 GGCTCTGTCTCCCGAGCTGATGG - Intronic
1123939539 15:25210171-25210193 GGCACTGTTTCCCAGGGGCAGGG + Intergenic
1126153957 15:45547933-45547955 ACCACTGCCTCCCAGGTTCAAGG + Intergenic
1126178886 15:45765546-45765568 GGCACTGTCTCCCGAGTAGAAGG - Intergenic
1126766468 15:52015971-52015993 AGCTCTGCCTCCCAGGTTCAAGG - Intronic
1128334559 15:66777759-66777781 GGCCATGTCTCCCAAATTCAGGG - Intronic
1128964472 15:72044321-72044343 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1129078163 15:73015436-73015458 ACCTCTGTCTCCCAGGTTCAAGG + Intergenic
1129195121 15:73959870-73959892 GGCACTGTTTCCCAAGTTTTCGG - Intergenic
1129808540 15:78486290-78486312 GTTACTTTCTCCAAAGTTCAGGG - Intronic
1130323732 15:82861922-82861944 ACCTCTGCCTCCCAAGTTCAAGG - Intronic
1131931789 15:97450552-97450574 GTCACATTCTCCCACGTTCAAGG - Intergenic
1133214009 16:4279759-4279781 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1133827016 16:9287111-9287133 AGCACTGGCTCCAAAGTCCAGGG + Intergenic
1134011937 16:10860276-10860298 GGCTCTATTTCCCCAGTTCACGG - Intergenic
1134090494 16:11389002-11389024 ACCTCTGCCTCCCAAGTTCAAGG - Intronic
1134625081 16:15717711-15717733 ACCTCTGCCTCCCAAGTTCAAGG - Intronic
1135587639 16:23683071-23683093 AGCTCTGCCTCCCAGGTTCATGG + Intronic
1136161000 16:28418710-28418732 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
1136201964 16:28696281-28696303 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1136290625 16:29269259-29269281 GGCACTGTCTCTAAAGCCCAGGG + Intergenic
1136390899 16:29963506-29963528 TGGACCGTCTCCGAAGTTCAAGG - Exonic
1137802388 16:51273268-51273290 ACCTCTGTCTCCCAAGCTCAGGG + Intergenic
1137880295 16:52039065-52039087 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1139097978 16:63728609-63728631 GGCCTTGTCTCCCCAATTCAGGG + Intergenic
1141421733 16:83922109-83922131 TCCACTGTGTCCCAGGTTCAAGG + Exonic
1142096505 16:88242779-88242801 GGCACTGTCTCTAAAGCCCAGGG + Intergenic
1142119437 16:88378664-88378686 GCCACCCTCTCCCTAGTTCAGGG - Intergenic
1142550271 17:733849-733871 CTCACTTTCTCCCAAGTTGAAGG + Intronic
1143506986 17:7372096-7372118 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1143781104 17:9230235-9230257 GGGGCTGTCCCCCAAGGTCAGGG + Intronic
1143854661 17:9839726-9839748 AGCACTCTCCCCCACGTTCAGGG + Intronic
1145326925 17:21839976-21839998 TGCACTGGCTCCCAGGTTCTTGG - Intergenic
1146212348 17:30952456-30952478 ACCTCTGCCTCCCAAGTTCAAGG + Intronic
1146279331 17:31535167-31535189 GCCACTGCCTCCCAAGTGCTAGG - Exonic
1147010747 17:37445346-37445368 ACCTCTGTCTCCCAGGTTCAAGG + Intronic
1147361913 17:39936146-39936168 GGCCCTGGCTCCCAAGTTCAGGG - Intergenic
1147653208 17:42073522-42073544 GGCACTGTCTCTGGAGGTCAGGG + Intergenic
1147735182 17:42632573-42632595 ACCTCTGTCTCCCAGGTTCAAGG - Intergenic
1147929489 17:43969023-43969045 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1148638522 17:49167690-49167712 GCCTCTGTCTCCCAGGTTCAAGG + Intronic
1149636788 17:58177304-58177326 GCCACAGCCTCCCAAGTTGAGGG + Intergenic
1150591177 17:66564159-66564181 GGCTCTGCCTCCCGGGTTCAAGG + Intronic
1150667097 17:67151009-67151031 GACACAGTCTCACAAGTTTAGGG - Intronic
1150736614 17:67745629-67745651 TGCTCTGCCTCCCAGGTTCAAGG + Intergenic
1151185250 17:72359450-72359472 GGCACTGTCTTCCATTTCCAAGG - Intergenic
1151600705 17:75104500-75104522 ACCTCTGCCTCCCAAGTTCAAGG + Intronic
1151850604 17:76687595-76687617 GGCAGTGTCTCCCCTGTTCTCGG + Intronic
1152018333 17:77766674-77766696 GGCACATTCACCCACGTTCAGGG - Intergenic
1154985334 18:21545488-21545510 GCCTCTGCCTCCCAGGTTCAGGG - Intronic
1156449022 18:37256096-37256118 GGCACTGTCTCCCAAGTTCATGG + Intronic
1156508606 18:37616108-37616130 GTCACTGTATCCCAAGGTAATGG - Intergenic
1158595468 18:58812068-58812090 AGCTCTGCCTCCCAGGTTCACGG + Intergenic
1161068433 19:2249220-2249242 GGCACTGTCCCCCAAGGTCGCGG + Intergenic
1161180099 19:2874659-2874681 GCCACTGCCTCCCGAGTTCAAGG - Intronic
1161198790 19:3002779-3002801 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1161271052 19:3389487-3389509 GGCACCGTCACCCGAGCTCATGG - Intronic
1161440665 19:4289956-4289978 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1161645745 19:5452247-5452269 AGCTCTGCCTCCCAGGTTCACGG - Intergenic
1162257885 19:9507347-9507369 ACCTCTGCCTCCCAAGTTCAAGG + Intergenic
1162266367 19:9578309-9578331 ACCTCTGTCTCCCAGGTTCAAGG - Intronic
1162942009 19:14016527-14016549 ACCTCTGTCTCCCAGGTTCAAGG - Intergenic
1163315655 19:16538890-16538912 GCAACTGGCGCCCAAGTTCATGG + Intronic
1163344007 19:16728365-16728387 ACCTCTGTCTCCCAGGTTCAAGG + Intronic
1164116225 19:22221666-22221688 ACCTCTGCCTCCCAAGTTCAAGG - Intergenic
1164606445 19:29601907-29601929 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1165038281 19:33050166-33050188 GTCACAGCCTCCCAGGTTCAAGG - Intronic
1166547539 19:43642227-43642249 ACCTCTGCCTCCCAAGTTCAGGG - Intergenic
1166645071 19:44525523-44525545 ATCACTGCCTCCCAGGTTCAAGG + Intronic
1166729196 19:45048901-45048923 ACCTCTGCCTCCCAAGTTCAAGG - Intronic
1167367626 19:49063398-49063420 AGCTCCGCCTCCCAAGTTCATGG + Intronic
1167656640 19:50768983-50769005 GCCCCTGCCTCCCAGGTTCAAGG + Intergenic
1167878094 19:52430931-52430953 ACCTCTGCCTCCCAAGTTCAAGG + Intronic
1168024163 19:53631675-53631697 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1168054420 19:53854090-53854112 ACCTCTGTCTCCCAGGTTCAAGG + Intergenic
1168310657 19:55458609-55458631 AGCTCTGCCTCCCAGGTTCAAGG + Intronic
1168686391 19:58351876-58351898 AGCTCTGCCTCCCAGGTTCAAGG + Intronic
1202678665 1_KI270711v1_random:30813-30835 AGAACAGTCTCCCAAGTTCCAGG - Intergenic
925635580 2:5938471-5938493 AGCCCTGTCCCCCAAGCTCATGG - Intergenic
926207772 2:10846138-10846160 GGCATGCACTCCCAAGTTCATGG + Intergenic
927133133 2:20077551-20077573 GGCACTGTCTCTATAGTCCAAGG - Intergenic
927157483 2:20229462-20229484 ACCTCTGTCTCCCAGGTTCAAGG - Intergenic
928183684 2:29090332-29090354 ACCTCTGCCTCCCAAGTTCAAGG + Intergenic
928558870 2:32457004-32457026 GCCCCTGTCTCCCAAGTACCTGG + Intronic
929017396 2:37512567-37512589 ACCTCTGTCTCCCAGGTTCAAGG + Intergenic
929376496 2:41292477-41292499 GCCTGTGCCTCCCAAGTTCAAGG - Intergenic
929989348 2:46772216-46772238 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
931620043 2:64200664-64200686 ACCTCTGTGTCCCAAGTTCAAGG + Intergenic
931879629 2:66554596-66554618 GACACTGTCGCCCAAATCCAAGG - Intronic
932555238 2:72818175-72818197 CGCACTGTCTCCCAGGCTCGAGG + Intronic
932619806 2:73258779-73258801 GGCACTGCCTCCCCAGTACAGGG - Exonic
932720440 2:74134910-74134932 GTGACTTGCTCCCAAGTTCAGGG + Intronic
933084271 2:78035683-78035705 GGCAGTGTCTCCACATTTCAGGG - Intergenic
934182055 2:89633665-89633687 AGCTCTGTCTCCCAGGTTCACGG + Intergenic
934681311 2:96285932-96285954 GGCACTGTTTCCTCAGTCCATGG - Intronic
935360457 2:102242389-102242411 AGAACTGTCTCCCATGATCATGG + Intergenic
936269404 2:111037267-111037289 GGGACAAGCTCCCAAGTTCAGGG - Intronic
936702787 2:115033978-115034000 ACCTCTGTCTCCCAGGTTCAAGG + Intronic
937185294 2:120034748-120034770 GGCTCAGTCTCCCAAGTTGCTGG - Intronic
937666470 2:124493587-124493609 GCCTCTGCCTCCCAAGTTCTGGG + Intronic
938332071 2:130454974-130454996 GGCACTGTGGCCCACCTTCAGGG - Intergenic
938357739 2:130665694-130665716 GGCACTGTGGCCCACCTTCAGGG + Intergenic
939044748 2:137237026-137237048 AGCTCTGCCTCCCAGGTTCAAGG - Intronic
940335847 2:152526433-152526455 AGCCCTGTTTCCCAAGTTCCAGG + Intronic
940350667 2:152683110-152683132 GTCACTGTCTCCCAACTAGATGG + Intronic
944570442 2:201039274-201039296 GGCACTGTATCCCAAGTGACAGG + Intronic
945062762 2:205923466-205923488 GGCAATGTCTCCCAAGTGGCAGG - Intergenic
946435906 2:219653345-219653367 ACCTCTGTGTCCCAAGTTCAAGG - Intergenic
946673565 2:222132698-222132720 GGCACTTTCCCACAAATTCATGG + Intergenic
947221468 2:227796963-227796985 ACCTCTGCCTCCCAAGTTCAAGG + Intergenic
948739218 2:240031920-240031942 GCCATTGTCTAACAAGTTCAGGG - Intergenic
1169964428 20:11199038-11199060 GCTACTGTGTCCCCAGTTCAGGG + Intergenic
1170699273 20:18688800-18688822 GGCATTTTCTCCCAGGTACACGG - Intronic
1170831817 20:19849388-19849410 GACACAGGCTCCCAAGGTCAGGG + Intergenic
1173027856 20:39325940-39325962 GGCAATGTCTGCCATGATCAAGG - Intergenic
1173254640 20:41385729-41385751 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
1173303596 20:41827018-41827040 GACAATGTCTCCCACCTTCAAGG - Intergenic
1173647366 20:44641848-44641870 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1174147807 20:48464294-48464316 GGCACTGTGGCCCAGGGTCATGG - Intergenic
1174355012 20:49991630-49991652 ACCTCTGCCTCCCAAGTTCAAGG - Intergenic
1174775460 20:53339461-53339483 GGAGCTGTCTCCCAAGTTTGAGG - Intronic
1176730420 21:10489577-10489599 AGCTCTGTCTCCCAGGTTCACGG - Intergenic
1177762541 21:25418405-25418427 GGCACTGTCTCCTTATTTCCAGG - Intergenic
1178188576 21:30254189-30254211 ACCTCTGCCTCCCAAGTTCAAGG - Intergenic
1178254690 21:31041419-31041441 GGCTGTGTCTTCCAAATTCAAGG - Intergenic
1179766352 21:43576033-43576055 ACCTCTGCCTCCCAAGTTCAAGG - Intronic
1180224365 21:46381092-46381114 ACCTCTGTCTCCCAGGTTCACGG - Intronic
1181136862 22:20773467-20773489 AGCAGTGCCTCCCAAATTCAGGG - Intronic
1183636945 22:39069762-39069784 ACCTCTGTCTCCCAGGTTCAAGG - Intronic
1183707859 22:39485704-39485726 GCCCCTGCCTCCCAGGTTCAAGG - Intronic
1184038291 22:41928824-41928846 GGCACTGTGGCCCACGTCCAGGG + Intergenic
1184134851 22:42541889-42541911 AGCTCTGCCTCCCAGGTTCATGG + Intergenic
951492794 3:23291587-23291609 GGCAGTGGTTCCCAAATTCATGG + Intronic
953264132 3:41369709-41369731 AGCTCTGCCTCCCGAGTTCAAGG - Intronic
954105496 3:48407671-48407693 GGCACTGTCCCCCATGAGCAGGG + Intronic
954141219 3:48607122-48607144 AGCTCTGCCTCCCAGGTTCATGG + Intronic
954671755 3:52294754-52294776 GGCACTGGGTTCCAAGTTCCAGG + Intergenic
956321064 3:67996714-67996736 ACCTCTGCCTCCCAAGTTCAGGG - Intergenic
958800626 3:98751122-98751144 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
959942479 3:112094075-112094097 ACCTCTGCCTCCCAAGTTCAAGG + Intronic
961091932 3:124120218-124120240 GGCTCTGACTCCTGAGTTCATGG + Intronic
961683573 3:128614862-128614884 ACCACCGTCTCCCAGGTTCAAGG - Intergenic
962507948 3:136067497-136067519 GGCTCTGTCTCCTAAACTCAAGG - Intronic
966410414 3:179641330-179641352 GGCTCAGTCTCCCAAGTACCTGG + Intergenic
968075368 3:195813210-195813232 GGCGCTGTCTCCGAGGGTCACGG + Intergenic
968438832 4:611200-611222 GCCACTGTCCCCCAGGTTCCTGG - Intergenic
969759864 4:9174023-9174045 GGCACTGCCTCCTAAGGACATGG + Intronic
972842235 4:42944976-42944998 GAAAGTGTCTCCCAAGGTCATGG + Intronic
973614748 4:52667133-52667155 GTCACAGCCTCCCAAGTACATGG - Intergenic
974185600 4:58441554-58441576 GCCTCTGTCTCCCAAGTAAATGG + Intergenic
978250722 4:106628487-106628509 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
979923509 4:126530120-126530142 GGCCCTGTTTCCTCAGTTCAGGG - Intergenic
980557486 4:134428764-134428786 AGCTCTGCCTCCCATGTTCACGG + Intergenic
982439835 4:155422633-155422655 GGCTCTGCCTCCCGGGTTCACGG - Intergenic
982755172 4:159209392-159209414 GCCACTGCCTCGCAAGGTCAGGG - Intronic
983747719 4:171222463-171222485 CTCACTGTCTACCAAGTTCCAGG + Intergenic
985328909 4:188805012-188805034 TGCCCTGTCTCCCAAGTATATGG - Intergenic
987075377 5:14377326-14377348 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
987933711 5:24435421-24435443 ACCTCTGTCTCCCGAGTTCAAGG - Intergenic
988322626 5:29718622-29718644 AGCTCTGCCTCCCAGGTTCAAGG - Intergenic
990193495 5:53288103-53288125 AGCTCTGCCTCCCAGGTTCATGG + Intergenic
990247685 5:53879410-53879432 GGCTCTGTCTCCCAAGCTGGAGG - Intergenic
993851806 5:93019448-93019470 GGAACTGTTTTCAAAGTTCATGG + Intergenic
993886953 5:93426128-93426150 ACCTCTGTCTCCCAGGTTCAAGG + Intergenic
993997911 5:94744584-94744606 ACCTCTGTCTCCCAGGTTCAAGG + Intronic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
997728993 5:136150972-136150994 GACTCAGTCTCCCAAGTTGATGG - Intronic
997946882 5:138210441-138210463 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
998363506 5:141611982-141612004 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
998841169 5:146255936-146255958 ACCTCTGCCTCCCAAGTTCAAGG + Intronic
999341210 5:150775008-150775030 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
999755633 5:154662506-154662528 GCCTCTGCCTCCCAAGTTCAAGG + Intergenic
1000704681 5:164496065-164496087 ACCTCTGACTCCCAAGTTCAGGG - Intergenic
1000871089 5:166578624-166578646 GGCATTGTTTCCCCAGTTCTTGG - Intergenic
1002892582 6:1348438-1348460 CCCACTGTCTCCCAAGCTCCAGG - Intergenic
1003017245 6:2478107-2478129 GGCACTGTCTCCCACCTCCCAGG + Intergenic
1004201652 6:13554389-13554411 AGAACTGTCCCCCAAGTTCCTGG + Intergenic
1004214203 6:13686366-13686388 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1004993392 6:21163866-21163888 GCCTCCGTCTCCCAGGTTCAAGG - Intronic
1005249446 6:23927772-23927794 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1005832526 6:29681931-29681953 GGCAATGTCTCCCAAGTAGCTGG - Intergenic
1007669613 6:43540394-43540416 AGCTCTGCCTCCCAGGTTCACGG - Intronic
1010145522 6:72664570-72664592 AGCTCTGCCTCCCAGGTTCAAGG - Intronic
1010146187 6:72672196-72672218 ACCTCTGCCTCCCAAGTTCAAGG + Intronic
1013090612 6:106897139-106897161 GCCACTGTCTCCCTGGCTCAAGG - Intergenic
1013348697 6:109287137-109287159 GGCAATGTCTGCCATGCTCAAGG + Intergenic
1013586287 6:111581893-111581915 GCCTCTGCCTCCCAAGTTCAAGG - Intronic
1015171079 6:130254274-130254296 AGCTCTGCCTCCCAGGTTCAAGG + Intronic
1015922921 6:138282966-138282988 ACCTCTGTCTCCCAGGTTCAAGG - Intronic
1015984751 6:138873709-138873731 ACCTCTGCCTCCCAAGTTCAAGG - Intronic
1017015644 6:150097445-150097467 GACCCTGTCTCCCTGGTTCATGG + Intergenic
1017959404 6:159208730-159208752 GTCACATTCTCCCAAGTTCTGGG - Intronic
1020056977 7:5124409-5124431 ACCTCTGCCTCCCAAGTTCAAGG - Intergenic
1020182861 7:5935677-5935699 GCCTCTGCCTCCCAGGTTCAGGG - Intronic
1020287380 7:6695004-6695026 AGCTCTGCCTCCCAGGTTCAAGG + Intronic
1020300051 7:6789080-6789102 GCCTCTGCCTCCCAGGTTCAGGG + Intronic
1021509844 7:21424103-21424125 GCCCCTGACTCCCAGGTTCAAGG + Intergenic
1023877928 7:44300147-44300169 GGCTCAGTCTCCCAAGTAGATGG + Intronic
1024689639 7:51785472-51785494 CTCACTGTCTCCCAAGTCCTTGG + Intergenic
1024938849 7:54741072-54741094 GGACCTGTCTCAAAAGTTCAGGG + Intergenic
1025113331 7:56237504-56237526 TGCTCTGTTTCCCAAGTTGAAGG + Intergenic
1025212931 7:57031306-57031328 TGCACTGTCTCCCAGGCTGAGGG - Intergenic
1025659021 7:63545518-63545540 TGCACTGTCTCCCAGGCTGAGGG + Intergenic
1025938057 7:66052770-66052792 GCCTCTGTTTCCCAGGTTCAAGG - Intergenic
1026284040 7:68947586-68947608 CTCTCTGTCTCCCAAGTACATGG + Intergenic
1026518871 7:71097676-71097698 ACCTCTGTCTCCCAGGTTCAAGG - Intergenic
1028518496 7:91703184-91703206 ACCTCTGTCTCCCAGGTTCAAGG - Intronic
1028757929 7:94459368-94459390 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1029034084 7:97500308-97500330 ACCTCTGCCTCCCAAGTTCAAGG + Intergenic
1029150216 7:98475038-98475060 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1029370040 7:100144069-100144091 ACCTCTGTCTCCCAGGTTCAAGG + Intergenic
1033702188 7:143850802-143850824 GGCTGTTTCTCCCAAGTACAGGG + Intergenic
1033955957 7:146848853-146848875 ACCTCTGCCTCCCAAGTTCAAGG + Intronic
1034290747 7:149929343-149929365 ACCTCTGTCTCCCAGGTTCAAGG - Intergenic
1034442748 7:151095272-151095294 GGCACTGTCTGCTCAGCTCAGGG - Intronic
1034599158 7:152231960-152231982 AGCTCTGTCTCCCAGGTTCACGG + Intronic
1034607547 7:152331225-152331247 GCCTCTGGCTCCCAGGTTCAAGG - Intronic
1034660324 7:152763504-152763526 ACCTCTGTCTCCCAGGTTCAGGG + Intronic
1037666116 8:20971629-20971651 GCCCCTGCCTCCCAGGTTCAAGG - Intergenic
1038288405 8:26226725-26226747 GGAACTGAGTCCAAAGTTCAGGG - Intergenic
1039346161 8:36707954-36707976 GCCTCTGCCTCCCAAGTTCCTGG + Intergenic
1039840323 8:41288420-41288442 GCCTCAGTCTCCCAAGTACAGGG - Intronic
1039970208 8:42315743-42315765 ATCTCTGCCTCCCAAGTTCAAGG + Intronic
1040363977 8:46695264-46695286 AGCTCTGCCTCCCAGGTTCAAGG + Intergenic
1043728970 8:83650677-83650699 GGCAATGTCTGCCATGGTCAGGG + Intergenic
1044087781 8:87962052-87962074 GGCTCTGTCACCCAAGCTGAAGG + Intergenic
1044876476 8:96672693-96672715 GCCTCTGCCTCCCAAGTTAAAGG - Intronic
1045561611 8:103269517-103269539 GACACTGTATCACAGGTTCAAGG - Intergenic
1046147699 8:110182846-110182868 GTCTCAGTCTCCCAAGTTGATGG + Intergenic
1047612976 8:126539117-126539139 GCCTCTGTCTCCCAAGTGCTGGG - Intergenic
1047698932 8:127431260-127431282 TCCACTGTCTCTCAATTTCATGG - Intergenic
1049615552 8:143574371-143574393 GGCACTGCCCCCCAGGCTCAGGG - Intergenic
1050221786 9:3399359-3399381 ACCTCTGCCTCCCAAGTTCAAGG - Intronic
1050856014 9:10356760-10356782 ACCTCTGTCTCCCAAGTTCAAGG + Intronic
1051491853 9:17675202-17675224 TGCACTGTCTCCTAAGTGAAGGG - Intronic
1053043415 9:34893516-34893538 AGCTCCGTCTCCCAGGTTCAAGG - Intergenic
1053764781 9:41380703-41380725 AGCTCTGCCTCCCAAGTTCACGG - Intergenic
1055040719 9:71868769-71868791 ATCTCTGTCTCCCAGGTTCAAGG + Intronic
1056139754 9:83664489-83664511 GGCACTGTGTCCCAACTACTGGG + Intronic
1056394513 9:86169195-86169217 GGCACTGTCTCCTACAATCAAGG + Intergenic
1057058527 9:91982753-91982775 GCCTCAGTCTCCCAAGTACATGG + Intergenic
1057280192 9:93704503-93704525 GGCTCTGTCTCCCAAGTAGCTGG + Intergenic
1057518885 9:95745060-95745082 GTTGCTGTCTACCAAGTTCATGG - Intergenic
1058714414 9:107710967-107710989 GGAACTATCTCCCAAATGCATGG - Intergenic
1058888853 9:109343804-109343826 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
1059059499 9:111020389-111020411 GGGACTTTGTCCCAAGGTCATGG + Intronic
1059147194 9:111910826-111910848 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1059300898 9:113312498-113312520 GCCTCTGTCTCCTAGGTTCAAGG + Intergenic
1059490305 9:114661115-114661137 GCCTCTGTCTCCCAAGTTGCTGG + Intergenic
1060002745 9:119973372-119973394 GTTACTGCCTCCCAAGCTCATGG + Intergenic
1060211449 9:121712997-121713019 GGCACTGTCCTCCAAGGGCAGGG - Intronic
1060354674 9:122894174-122894196 AGCTCTGCCTCCCAGGTTCACGG - Intronic
1060707590 9:125818916-125818938 GCCTCCGTCTCCCAGGTTCAAGG + Intronic
1203583866 Un_KI270746v1:44491-44513 AGCTCTGTCTCCCAGGTTCACGG + Intergenic
1203653963 Un_KI270752v1:5771-5793 GGCTCTGCCTCCCAAGTGCTGGG - Intergenic
1185673914 X:1833267-1833289 AGCTCTGCCTCCCAGGTTCAAGG + Intergenic
1185733101 X:2476917-2476939 GCCTCCGTCTCCCAGGTTCAAGG - Intronic
1185882301 X:3752098-3752120 TCCTCTGCCTCCCAAGTTCAAGG - Intergenic
1187464980 X:19519116-19519138 GGCTGTGTGTCCCAACTTCAGGG - Intergenic
1187527973 X:20071170-20071192 GGCACTGTTTCCCACCTTAATGG + Intronic
1187688913 X:21844025-21844047 ACCTCTGCCTCCCAAGTTCAAGG - Intronic
1191174772 X:57486842-57486864 GGGGCTATCTCCCAAATTCAGGG + Intronic
1192110767 X:68361395-68361417 ACCTCTGCCTCCCAAGTTCAAGG - Intronic
1194474237 X:94338126-94338148 AACTCTGCCTCCCAAGTTCAAGG + Intergenic
1195144731 X:102001641-102001663 GCCTCTGGCTCCCAGGTTCAAGG - Intergenic
1195257230 X:103102429-103102451 GCCTCTGCCTCCCAGGTTCAGGG - Intergenic
1195314744 X:103666441-103666463 TGCACTGTCTCCTAAGAGCAGGG - Intergenic
1196040221 X:111194695-111194717 ATCACTGTTTCCCATGTTCACGG - Intronic
1196438974 X:115701359-115701381 AGCTCTGCCTCCCAGGTTCAAGG - Intergenic
1197899684 X:131356894-131356916 GCCACTGTCTGCCAAAGTCAGGG - Intronic
1199634082 X:149798865-149798887 GCCTCTGCCTCCCATGTTCAAGG - Intergenic
1201262838 Y:12177125-12177147 ACCTCTGCCTCCCAAGTTCAAGG - Intergenic
1201408903 Y:13678340-13678362 GGAAATGTATCCCATGTTCATGG + Intergenic