ID: 1156449291

View in Genome Browser
Species Human (GRCh38)
Location 18:37257867-37257889
Sequence AAGGAGAAGGATGAGGAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2896
Summary {0: 1, 1: 4, 2: 27, 3: 359, 4: 2505}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156449287_1156449291 -7 Left 1156449287 18:37257851-37257873 CCAGAAGGAACGGATGAAGGAGA 0: 1
1: 0
2: 2
3: 21
4: 230
Right 1156449291 18:37257867-37257889 AAGGAGAAGGATGAGGAGGTCGG 0: 1
1: 4
2: 27
3: 359
4: 2505
1156449281_1156449291 19 Left 1156449281 18:37257825-37257847 CCTCATGACTTACGAAAGGGTCT 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1156449291 18:37257867-37257889 AAGGAGAAGGATGAGGAGGTCGG 0: 1
1: 4
2: 27
3: 359
4: 2505
1156449286_1156449291 -6 Left 1156449286 18:37257850-37257872 CCCAGAAGGAACGGATGAAGGAG 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1156449291 18:37257867-37257889 AAGGAGAAGGATGAGGAGGTCGG 0: 1
1: 4
2: 27
3: 359
4: 2505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156449291 Original CRISPR AAGGAGAAGGATGAGGAGGT CGG Intronic
Too many off-targets to display for this crispr