ID: 1156455030

View in Genome Browser
Species Human (GRCh38)
Location 18:37288243-37288265
Sequence TGAGGTCCTCCCTTCCTGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156455025_1156455030 2 Left 1156455025 18:37288218-37288240 CCTCTCAAGCCTCCACTGCACCT 0: 1
1: 0
2: 1
3: 21
4: 266
Right 1156455030 18:37288243-37288265 TGAGGTCCTCCCTTCCTGCGCGG 0: 1
1: 0
2: 2
3: 6
4: 130
1156455028_1156455030 -10 Left 1156455028 18:37288230-37288252 CCACTGCACCTAATGAGGTCCTC 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1156455030 18:37288243-37288265 TGAGGTCCTCCCTTCCTGCGCGG 0: 1
1: 0
2: 2
3: 6
4: 130
1156455024_1156455030 23 Left 1156455024 18:37288197-37288219 CCTACTGGCAGGCTGAAATGACC 0: 1
1: 0
2: 0
3: 15
4: 96
Right 1156455030 18:37288243-37288265 TGAGGTCCTCCCTTCCTGCGCGG 0: 1
1: 0
2: 2
3: 6
4: 130
1156455023_1156455030 29 Left 1156455023 18:37288191-37288213 CCTGAACCTACTGGCAGGCTGAA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1156455030 18:37288243-37288265 TGAGGTCCTCCCTTCCTGCGCGG 0: 1
1: 0
2: 2
3: 6
4: 130
1156455027_1156455030 -7 Left 1156455027 18:37288227-37288249 CCTCCACTGCACCTAATGAGGTC 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1156455030 18:37288243-37288265 TGAGGTCCTCCCTTCCTGCGCGG 0: 1
1: 0
2: 2
3: 6
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156455030 Original CRISPR TGAGGTCCTCCCTTCCTGCG CGG Intronic
900525117 1:3124757-3124779 AGAGGTCCCCCCATCCTGCTGGG - Intronic
901763758 1:11487311-11487333 GGATGTCCTCCCTTCCTGAGGGG + Intronic
903003636 1:20284007-20284029 AGAGGTCCTCCCTGGCTTCGGGG - Intergenic
905395689 1:37665049-37665071 TGAGGTCCTTCCTTCCTGCAGGG + Intergenic
907420250 1:54342365-54342387 TGTGGCCCTCCCTCCCTGGGAGG + Intronic
908045563 1:60164233-60164255 TGAGGTCATACCTTCTTGCGTGG - Intergenic
910122767 1:83808762-83808784 TGATGTCCTCTCTTTCTGAGTGG - Intergenic
910241214 1:85088041-85088063 TGATGTCCTCCTTCCCTGCCAGG - Intronic
924474256 1:244369409-244369431 TGTGGTCAGCCCATCCTGCGTGG + Intronic
1063155554 10:3375999-3376021 TGAGGACCTGAGTTCCTGCGAGG - Intergenic
1065078449 10:22103957-22103979 TGTGCTCCTCCCTTTCTGGGTGG - Intergenic
1066236023 10:33485523-33485545 TCAGGTTCTCACTTCCTGCCTGG - Intergenic
1066290145 10:34006717-34006739 TTAGATCCTGCCTTCCTGCCAGG + Intergenic
1069412290 10:68166286-68166308 TGAGGTCCTCATTTCCTGAAAGG - Exonic
1069811601 10:71164233-71164255 TGACGTCCTCTCTTCCTACTTGG - Intergenic
1071664609 10:87542419-87542441 TGAGGTCCTAGCTACCTGGGAGG - Intronic
1072862828 10:99023960-99023982 TGAGGTCATGTCTTCCTGGGTGG - Intronic
1073346106 10:102784173-102784195 TGAGATCCTCTCCTCCTGGGGGG - Intronic
1076761158 10:132606360-132606382 TGATGGCCTCCCCTCCTGCTGGG + Intronic
1077433365 11:2526802-2526824 TGAGATCCTGCCATCCTGAGTGG - Intronic
1077434229 11:2531074-2531096 TCAGGTCCTCACTTCCTAGGTGG + Intronic
1077462597 11:2718129-2718151 TGAGGCCCTCCCTGCCCTCGGGG + Intronic
1078042235 11:7878544-7878566 TAAGGGACTCCCTTCCTGCATGG - Intergenic
1078099835 11:8323532-8323554 AGAAGTCCTCCCTTCCAGGGAGG - Intergenic
1082139500 11:48591732-48591754 TCTGGTCCTCCCTTCATGCATGG + Intergenic
1084216475 11:67649291-67649313 GGAGGCCCTTCCTTCCTGAGAGG - Intronic
1088816240 11:113422898-113422920 TGAGGCCATCCCTGCCTGAGAGG - Intronic
1088971146 11:114775652-114775674 TGAAAGCCTCCCTTCCTGTGGGG + Intergenic
1095967309 12:47877721-47877743 TGAGGTCCACACATCCTGCAGGG - Intronic
1096572016 12:52528911-52528933 TGAGGCCCTCCCTTCCAGGATGG - Intergenic
1101023049 12:100573192-100573214 TGAGGACCCCCATTCCTGCTGGG + Intergenic
1101199340 12:102418300-102418322 TGAGATCCTTGCTTCCTGCCTGG + Intronic
1102077745 12:110073546-110073568 TTACAGCCTCCCTTCCTGCGCGG + Intronic
1102101431 12:110281519-110281541 GGAGGCCCTCCCTTCTGGCGAGG + Intronic
1103461541 12:121108682-121108704 TGAGGTCATGTTTTCCTGCGTGG - Intergenic
1103464730 12:121132946-121132968 TGACAGCCTCCCTCCCTGCGCGG - Exonic
1104177765 12:126349569-126349591 TGACTTCCTTCCATCCTGCGTGG - Intergenic
1104276519 12:127333587-127333609 TGAGGTCCACACTTGCTGGGAGG - Intergenic
1104873440 12:132016739-132016761 TGAGCTCCTCACGTCCGGCGTGG + Intronic
1106303364 13:28489082-28489104 TCATGTCCTCCCCTCCTGTGTGG - Intronic
1108095523 13:46896897-46896919 TGGGTTCCTCCCTCCCTGTGCGG + Exonic
1111365083 13:87233519-87233541 TGAGGTCATGTCTTCCTGGGTGG + Intergenic
1113957124 13:114104965-114104987 TGGGGGCCACCCTTCCTGTGAGG - Intronic
1119521990 14:75293584-75293606 TGAGGGCCTCCGTGCCTGCAAGG - Intergenic
1121860327 14:97311588-97311610 TGAGGTCCTCCTAGCCTGAGAGG + Intergenic
1202852595 14_GL000225v1_random:30735-30757 TGAGGTCCCCTCTGCCGGCGCGG - Intergenic
1135830501 16:25768691-25768713 TGAGGTCCTCCCTGTCTCAGTGG + Intronic
1139576997 16:67847785-67847807 TGAAGTCATCCTGTCCTGCGGGG - Intronic
1140302443 16:73771535-73771557 TGAGGTCTTACCTTCCTCTGAGG + Intergenic
1141201283 16:81900455-81900477 TGAGGTCCTCTCCTTCTGGGAGG + Intronic
1142280416 16:89145015-89145037 TGGGGTCTGCCCTTCCTGTGGGG - Intronic
1142505058 17:357963-357985 TCAGATCCACCCTTCCTGGGTGG + Intronic
1144698604 17:17322354-17322376 GGAGGTGCTCCCTTCGTGTGAGG + Intronic
1146933316 17:36793380-36793402 TGAAGTCCTGCCTTCCAGCCTGG - Intergenic
1147335193 17:39723469-39723491 TGAAGTCCTCCCAGCCCGCGTGG + Intronic
1149992513 17:61390842-61390864 TGAGGTCCTGCACTCCTGGGTGG + Intronic
1152829036 17:82486091-82486113 TGAGGGGCTCCCTTGTTGCGTGG + Intronic
1153424764 18:4950217-4950239 TGATGTCCTCTCTTCCTACTCGG - Intergenic
1154038816 18:10833590-10833612 TGAGGTCCTCACAGCTTGCGTGG - Intronic
1155349659 18:24894125-24894147 TGAGATCCTGCCTTTCTGCAGGG - Intergenic
1156455030 18:37288243-37288265 TGAGGTCCTCCCTTCCTGCGCGG + Intronic
1156790181 18:40963116-40963138 TGACTTCCTCTCTTCCTGCTTGG - Intergenic
1158441238 18:57476095-57476117 TGGAGTCCTCCCTGCCTTCGTGG + Intronic
1161438954 19:4279791-4279813 CGAGGTCCCCCCTTCCCCCGCGG + Exonic
1164225477 19:23241917-23241939 TGATTTCCTCCCTTCCTGTTTGG - Intronic
1164410670 19:28002188-28002210 TGAGCTCCTCCCTCCCTGGGTGG - Intergenic
1165991841 19:39819759-39819781 TGGTGTCCTCCCTTTCTGTGAGG + Intergenic
1166239349 19:41479173-41479195 TGAGCTCCTCCCTTTCCTCGGGG - Intergenic
1167416975 19:49379333-49379355 TGTGGTCCTGCCTACCTGGGAGG - Intergenic
1167860209 19:52277069-52277091 TGAGGTCTTCCCTGCGTGTGTGG + Intronic
1167874670 19:52401862-52401884 TGAGGTCTTCCCTTTGTGTGTGG + Intronic
925269580 2:2592704-2592726 TGAGGTCCTGTTTTCCTGCATGG - Intergenic
927990483 2:27443503-27443525 TGAAGTCCGTCCTTCCTGCAGGG - Exonic
932416681 2:71577814-71577836 TAAGGTCCTCCCTGCCTCCTGGG + Intronic
935019574 2:99216663-99216685 TGTGCTCCTCTCTTCCTGCAGGG - Intronic
938619471 2:133033478-133033500 TGAGGTCATGCTTTCCTGGGTGG - Intronic
940307659 2:152243942-152243964 TGAAGTCCTCTCTTCCAGAGTGG - Intergenic
944139121 2:196436035-196436057 TGAGGTCCTCACTGCCTACAAGG - Intronic
948393737 2:237629839-237629861 TGAGGTCCTCCCTCCCACCGAGG + Intronic
1168890614 20:1293537-1293559 TCAGGTCCTCCCTCCCTTCTAGG - Intronic
1173530675 20:43767014-43767036 TGGGGTCCTCACTACCTGCTAGG + Intergenic
1174116548 20:48230397-48230419 TGAGAATCTCCCTTCCTGCTCGG + Intergenic
1175303874 20:57962547-57962569 TGACGTCCTGCCTTTCTGCAAGG + Intergenic
1177254322 21:18640576-18640598 TGTGGTCCTCCCTTTCTTCTTGG + Intergenic
1177970137 21:27778639-27778661 TGAGGTCCTGCTTTCCTGTATGG - Intergenic
1178170421 21:30034031-30034053 TGAGAACCTCCCTTCCTGTTTGG - Intergenic
1179222659 21:39423032-39423054 TGAGTTCTTCCCTTTCTGCAAGG + Exonic
1180006731 21:45026116-45026138 TGAGGTCCTCTCTCCCTGCGGGG + Intergenic
1182207789 22:28646105-28646127 TGACCTCCTCCCTTCCTACTTGG - Intronic
1184347892 22:43924366-43924388 TGAGGGTCTCCCTTCATGCACGG - Intronic
1184451133 22:44583546-44583568 TGAGGTCCTTCCAGCCTGCCTGG - Intergenic
950606416 3:14085046-14085068 TGTGGTCCTACCTTCTTGGGAGG + Intergenic
954073749 3:48161585-48161607 TGTGGTCCTAGCTTCCTGGGAGG + Intronic
954714328 3:52519453-52519475 TGGGATCCTCCCTTCCCGCCTGG + Intronic
955778843 3:62462464-62462486 TGAGCGCCTCCTTTCCTGGGTGG - Intronic
956120516 3:65961346-65961368 TCAGCCCCTCCCTTCCTGGGTGG + Intronic
960993655 3:123327570-123327592 TGAGGGGCTCCCTTCCTCCAGGG - Intronic
963235389 3:142950882-142950904 TGTGGTCCTCCATTCCAGTGGGG - Intronic
964539068 3:157758761-157758783 TGAGTTTCTCCCTTTCTGAGCGG + Intergenic
966897473 3:184456618-184456640 TGAGCTCCTCCTGTCCTGAGAGG + Intronic
969362555 4:6673986-6674008 TGCGGTTCTCGCTTGCTGCGTGG + Intergenic
969486509 4:7475235-7475257 CCAGGTCCTTCCTTCCTGCCTGG - Intronic
982601729 4:157459777-157459799 TGAGGGACTCCTTTCCTGGGAGG - Intergenic
986273485 5:6253869-6253891 TGAGTTCATGCCATCCTGCGGGG - Intergenic
991974670 5:72174513-72174535 TCAGGTCCTCCCATTCTGTGAGG + Intronic
1002612947 5:180433332-180433354 TTAGGTCCACCCTCCTTGCGTGG + Intergenic
1005726267 6:28651819-28651841 TGAGATACTCCCTTTCTGAGTGG - Intergenic
1006336896 6:33425702-33425724 GGAGGCCCGCCCTTCCTGGGAGG + Intronic
1006447777 6:34089550-34089572 TGAGGGCCTGGCTTCCTGCTTGG - Intronic
1007691965 6:43708246-43708268 GCAGCTCCTCCCTTCCTGCCTGG + Intergenic
1012518917 6:100096951-100096973 TGAGGTCCTCACTTCCTTACTGG + Intergenic
1017194432 6:151684729-151684751 TCTGGTTCTTCCTTCCTGCGGGG + Intronic
1017754632 6:157518880-157518902 TGAGATCCTCTCTTCGTGTGGGG + Intronic
1018934253 6:168263034-168263056 GGAGGCCCTCCCTTCCTGCAAGG - Intergenic
1019453010 7:1109436-1109458 TGAGGCCCCCCATTCCTGCGTGG + Intronic
1023723783 7:43121076-43121098 TGGGGTTCTTCCTTCCTGCCTGG + Intronic
1026082436 7:67233936-67233958 TGAGGTCCTAACTCCCAGCGTGG + Intronic
1030983350 7:116211180-116211202 TGATCTCCTCCCTTCCGGCTGGG + Intronic
1032161507 7:129514344-129514366 TGAGCCCCATCCTTCCTGCGAGG - Intergenic
1035056680 7:156040600-156040622 CCAGCTCCTCCCTTCCTGGGAGG + Intergenic
1035236173 7:157498943-157498965 TGAGAGCCTCCCTCCCTGCCCGG - Intergenic
1035341145 7:158162980-158163002 CAGGGTCCTCCCTTCCTGCTCGG + Intronic
1038047323 8:23776614-23776636 TCAGGTCTCCCCTTCCTGGGGGG + Intergenic
1050367211 9:4883717-4883739 TGAGGTTCTAGCTTCCTGCAAGG - Intronic
1056453014 9:86734831-86734853 TGAGATCCCCTCTTCCTGCTGGG + Intergenic
1058952441 9:109916332-109916354 TGAGAGCCTACCTTCCTGCAAGG - Intronic
1062030996 9:134361976-134361998 TCCGGTCCTCCCCTCCTGCTGGG + Intronic
1062633308 9:137477110-137477132 CGATGTCCTCCCTTCCTTTGGGG + Intronic
1186224115 X:7378981-7379003 TGAGGTCCCCCTTTCCTGATTGG + Intergenic
1188859886 X:35244155-35244177 TGAGGTCCTACCTTCAGGCCAGG - Intergenic
1189495671 X:41506174-41506196 TGAGGTTCACCCTTCCTCCTAGG + Intergenic
1189522970 X:41789495-41789517 TCACATCCTCCCCTCCTGCGGGG - Intronic
1192430133 X:71106242-71106264 TGAGGAACTCCCTTCTTGCCAGG + Intronic
1193986385 X:88245928-88245950 TGAGGTCCTCCTTTCCTTGCTGG + Intergenic
1194097834 X:89665640-89665662 TGAGGTCCTGCCCACCTGCTTGG - Intergenic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1199182098 X:144869820-144869842 TGACTTCCTCTCTTCCTGCTTGG + Intergenic
1200450854 Y:3327028-3327050 TGAGGTCCTGCCCACCTGCTTGG - Intergenic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic