ID: 1156456531

View in Genome Browser
Species Human (GRCh38)
Location 18:37297883-37297905
Sequence CTTGACGGCCAGAGGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156456531_1156456543 28 Left 1156456531 18:37297883-37297905 CCCTGTGCCCTCTGGCCGTCAAG 0: 1
1: 0
2: 1
3: 3
4: 150
Right 1156456543 18:37297934-37297956 GCAGAGACTGTTGGGTGTTTGGG 0: 1
1: 0
2: 1
3: 21
4: 250
1156456531_1156456537 -1 Left 1156456531 18:37297883-37297905 CCCTGTGCCCTCTGGCCGTCAAG 0: 1
1: 0
2: 1
3: 3
4: 150
Right 1156456537 18:37297905-37297927 GTTAGCAGGCTGCCTTCTCCAGG 0: 1
1: 0
2: 3
3: 20
4: 176
1156456531_1156456542 27 Left 1156456531 18:37297883-37297905 CCCTGTGCCCTCTGGCCGTCAAG 0: 1
1: 0
2: 1
3: 3
4: 150
Right 1156456542 18:37297933-37297955 AGCAGAGACTGTTGGGTGTTTGG 0: 1
1: 0
2: 1
3: 28
4: 403
1156456531_1156456540 19 Left 1156456531 18:37297883-37297905 CCCTGTGCCCTCTGGCCGTCAAG 0: 1
1: 0
2: 1
3: 3
4: 150
Right 1156456540 18:37297925-37297947 AGGCATTCAGCAGAGACTGTTGG 0: 1
1: 0
2: 3
3: 25
4: 244
1156456531_1156456541 20 Left 1156456531 18:37297883-37297905 CCCTGTGCCCTCTGGCCGTCAAG 0: 1
1: 0
2: 1
3: 3
4: 150
Right 1156456541 18:37297926-37297948 GGCATTCAGCAGAGACTGTTGGG 0: 1
1: 0
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156456531 Original CRISPR CTTGACGGCCAGAGGGCACA GGG (reversed) Intronic
900114748 1:1023711-1023733 CTCTAGGGTCAGAGGGCACATGG + Intronic
900114930 1:1024372-1024394 CTTGGCTACCAGAGGGCCCAGGG - Intronic
901483590 1:9542223-9542245 TCTGGCAGCCAGAGGGCACAGGG - Intronic
902933914 1:19750734-19750756 CTTGATGGCCAGGGGCCAGAAGG - Intronic
907395010 1:54183571-54183593 CCTGAGGGTCAGAGGGCATAAGG + Intronic
914847052 1:151289184-151289206 CTTGAAGGCCATGGGGCAGATGG - Exonic
914915890 1:151818964-151818986 CCTGACGGGGACAGGGCACATGG + Intronic
915012249 1:152698406-152698428 CCTGGGAGCCAGAGGGCACAGGG + Intronic
916677969 1:167080135-167080157 CATGACGGGCACAGGGCAAAGGG - Intronic
917207262 1:172590233-172590255 CTTGATTCCCAGAGGGCTCATGG + Intronic
917605699 1:176626758-176626780 CTTGATGTCCAGACAGCACAAGG + Intronic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
919299772 1:195745058-195745080 ATTGACTGCAAAAGGGCACAAGG - Intergenic
919513648 1:198495036-198495058 CCTCAGGGACAGAGGGCACAGGG + Intergenic
921076667 1:211705495-211705517 CTTGGTGGGCAGAGAGCACAGGG - Intergenic
922625134 1:227032723-227032745 CCTGACGACCAGAGACCACATGG + Intronic
924083030 1:240419610-240419632 CTCGAGGGCCACAGGACACAGGG - Intronic
1063976903 10:11424656-11424678 CATGACGTCCAGAGGGAACTGGG - Intergenic
1065038878 10:21670582-21670604 CTAGAGGGTCAGAGGGCAAAGGG + Exonic
1072036103 10:91564244-91564266 CTAGAAGGCCAGGCGGCACAGGG + Intergenic
1073069936 10:100787013-100787035 TATGAGGGCCAGAGGGAACATGG + Intronic
1074473955 10:113752829-113752851 TTTGACATCCACAGGGCACAGGG + Intronic
1076238765 10:128886428-128886450 CAGGACGGCCAGAGCGCCCACGG + Intergenic
1076462693 10:130657194-130657216 CTTGGGGGGCAGAGGGCTCAGGG + Intergenic
1076769367 10:132654604-132654626 TCTGACAGCCAGAGGGCACCTGG - Intronic
1077640797 11:3879769-3879791 CTTGAAGGCAAGAGGGGAAATGG - Intronic
1084651274 11:70490789-70490811 CTTGATGGTCACATGGCACATGG - Intronic
1088238559 11:107750565-107750587 CTGGACGTCCAGAGGACTCAAGG - Intergenic
1090628776 11:128628078-128628100 CTTGACGCACAGATGGGACATGG - Intergenic
1094824348 12:34257275-34257297 CTTGCCGGCCACAAGGGACATGG - Intergenic
1095086851 12:38066064-38066086 CTTGCCGGCCAGAAGGGACATGG + Intergenic
1096353474 12:50919077-50919099 CTTGGAGGCCAGAGGCAACATGG + Intergenic
1101049830 12:100849925-100849947 CTTGATGGCCCGAGCCCACAAGG - Intronic
1103889758 12:124229348-124229370 TTTGATTGCCAGGGGGCACAGGG - Intronic
1104670848 12:130678917-130678939 CGTGACGGCCAGAGGGGACAGGG + Intronic
1105284416 13:18992967-18992989 CCAGATGGCCAGAAGGCACAAGG + Intergenic
1105284975 13:18996189-18996211 CTAGAAGGCCAGAAGGCAGAGGG + Intergenic
1106970343 13:35132737-35132759 ATTAACTGCCAGTGGGCACAGGG + Intronic
1107321176 13:39190255-39190277 CCTTACGTCCAGAGAGCACATGG + Intergenic
1110132142 13:72022040-72022062 CTTGAGGGCTATATGGCACATGG - Intergenic
1111649201 13:91068042-91068064 CTTGAAGGCTAGAAGGGACAAGG + Intergenic
1121415344 14:93775417-93775439 CATGTCTCCCAGAGGGCACAGGG - Intronic
1122031551 14:98916031-98916053 CTCCAAGGCCAGTGGGCACAAGG - Intergenic
1122853206 14:104547748-104547770 CCTGAGGGCCTGTGGGCACATGG - Intronic
1122981525 14:105194322-105194344 CTTGAAGACCAGAGGCCCCAGGG - Intergenic
1123482710 15:20648411-20648433 ATTAACTGCCAGTGGGCACAGGG - Intergenic
1124700134 15:31905404-31905426 CTCTGCGGCCAGAGGGAACATGG - Intergenic
1126098221 15:45104201-45104223 CTTGTCAGCCAGAGAGAACATGG + Exonic
1126106004 15:45147575-45147597 CTTGTCAGCCAGAGAGAACATGG - Exonic
1127120643 15:55768989-55769011 CTTCCCAGCCTGAGGGCACATGG + Intergenic
1128609922 15:69065268-69065290 CTTTAGGGGCAGAGGGCAGAAGG + Intergenic
1132833498 16:1941241-1941263 CTTGAAGGTGAGAGGCCACAGGG - Exonic
1134046170 16:11102899-11102921 CCTGAGGGCCAGAGGGGAGACGG + Intronic
1134878243 16:17721381-17721403 GATGAAGGCTAGAGGGCACAGGG - Intergenic
1137967481 16:52950881-52950903 CATGAAGGCCAGTGGGGACATGG + Intergenic
1138491457 16:57379507-57379529 CTTGAAGGCCAGGGTGTACAGGG + Intronic
1142428195 16:90011774-90011796 CTCTCCGCCCAGAGGGCACAGGG + Intronic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1142901580 17:3015426-3015448 CCTGACGTCCAGAGAGCCCAGGG + Intronic
1143187738 17:5020694-5020716 CTAGACGGCCATGGGGCACGTGG - Intronic
1146286776 17:31579386-31579408 CTTTCTGGCCTGAGGGCACAGGG - Intergenic
1147540849 17:41358159-41358181 CATGACAGCCAGAGAGCAAAAGG + Intergenic
1148872545 17:50667350-50667372 CTTGTCAGGCAGAGGACACAGGG + Intronic
1150211478 17:63444231-63444253 CGTGAAGGCCAGAGGGCCAACGG + Intronic
1152304083 17:79511130-79511152 CTTGGCTGGCAGAGGGCTCACGG + Intronic
1152821629 17:82440520-82440542 GCTGACGGCCAGAGGGCAGGAGG - Intronic
1154364885 18:13698720-13698742 CTTGCTGGGCAAAGGGCACAAGG + Intronic
1156456531 18:37297883-37297905 CTTGACGGCCAGAGGGCACAGGG - Intronic
1160225018 18:77005728-77005750 CTTGAGGGGCAGAGGGGCCAGGG + Intronic
1165385043 19:35505386-35505408 ATTGACTCCTAGAGGGCACATGG - Intronic
1166441988 19:42823304-42823326 CTTGGAGGCCACAGGGCCCAGGG + Intronic
1166461410 19:42991591-42991613 CTTGTAGGCCACAGGGCCCAGGG + Intronic
1166478702 19:43151570-43151592 CTTGGAGGCCACAGGGCCCAGGG + Intronic
1166501374 19:43343906-43343928 CTTGGAGGCCACAGGGCCCAGGG + Intergenic
1166508736 19:43389542-43389564 CTTGGAGGCCACAGGGCCCAGGG - Intergenic
925754661 2:7121964-7121986 CTTCACGGCTAGAGGGAACTTGG + Intergenic
927351934 2:22126008-22126030 CTTGATGGCCTGAAGGCAAAAGG - Intergenic
929716015 2:44310459-44310481 CATGAAGGCCAGAGGGCAATGGG - Intronic
932773285 2:74513463-74513485 ATTCATGGCCAGAGGTCACAAGG + Intronic
934993818 2:98939300-98939322 CCTCACTGCCAGAGGCCACAGGG + Intergenic
947666068 2:231906241-231906263 CTTCACCACCAGAGGGCACCAGG + Intergenic
1172619169 20:36307936-36307958 CTTCTCTGCCAGAGGGCACTGGG + Intronic
1173280653 20:41624169-41624191 ATTGACAGCAAGAGGGAACAAGG - Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1177905598 21:26967787-26967809 CTGGACAGCCAGAGAGCCCAGGG + Intergenic
1179966028 21:44806319-44806341 CTTGAGGGCCAGAGAGCACGTGG + Exonic
1184396493 22:44244994-44245016 CTTGTCTTCCAGAGGGCACAGGG + Exonic
1185109758 22:48894364-48894386 CGAGGCGGCCAGAGGCCACATGG - Intergenic
1185278373 22:49959646-49959668 GTTGGGGGCCAGAGGGCCCAGGG - Intergenic
950742990 3:15064746-15064768 CTTGCTGGCCAGAGGGGCCAAGG + Intronic
952377303 3:32778504-32778526 GTTAAGGGCCGGAGGGCACAAGG - Intergenic
952669387 3:35947979-35948001 CCTGACTGACAGAGGGCAAAAGG - Intergenic
953447668 3:42981311-42981333 CTTGAGGTCCAGAGACCACAGGG + Intronic
961358499 3:126353406-126353428 CATGAGGGTCAGAGGGCAAATGG - Intronic
961382735 3:126506186-126506208 CTGGAAGGCGAGAGGGGACAAGG - Intronic
963786610 3:149541354-149541376 CCTGACCCACAGAGGGCACACGG + Intronic
964776190 3:160281093-160281115 CTTGATGGCCTGAGGGCAAGAGG - Intronic
965089461 3:164144188-164144210 CCTGAGGGCCAAAGGGCCCATGG + Intergenic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
969120830 4:4909749-4909771 CTTTAGGGTCAGAGGGCTCAAGG + Intergenic
969613866 4:8241269-8241291 GTTGGCGGCCAGAGGGGAGACGG + Intronic
971201245 4:24511212-24511234 GCTGACGGGCAGTGGGCACAAGG - Intergenic
980125473 4:128770107-128770129 CATTACAGCCAGAGGACACAAGG - Intergenic
981403134 4:144337703-144337725 CTTGAGGGCTAGAGAGAACAAGG + Intergenic
981491568 4:145346160-145346182 CATGAGCGCCATAGGGCACAAGG + Intergenic
985382770 4:189412855-189412877 CTTGAAGACCTGAGGTCACAGGG - Intergenic
985599649 5:820449-820471 CTCCACAGCCAGAGGGCAAAGGG - Intronic
985829073 5:2214495-2214517 CCTGAAGGAGAGAGGGCACATGG - Intergenic
997733358 5:136196207-136196229 TTTGACAGGCAGAGGTCACAGGG + Intergenic
1003392008 6:5722552-5722574 CTTGATGGCAAGAGCTCACAGGG + Intronic
1007659987 6:43477963-43477985 CTGGCCGGCCAGAGGGGAAAGGG + Intronic
1019302995 7:318303-318325 GTCGACGGCCACAGGGCACGGGG + Intergenic
1019369025 7:651194-651216 CTTGAGGGCCAGAGGCCCCTAGG - Intronic
1019527537 7:1487449-1487471 CCTGAGGGCCACAGGGGACACGG + Exonic
1022389246 7:29929076-29929098 CTTGAGGGCCAGACAGCACTCGG + Intronic
1022660410 7:32361585-32361607 GTGGAAGGGCAGAGGGCACAAGG - Intergenic
1024090910 7:45939139-45939161 TCTGACGTCCACAGGGCACAGGG - Intergenic
1024668257 7:51566653-51566675 CTTCAAGGCCAGAACGCACAGGG - Intergenic
1032142669 7:129347378-129347400 TTTGACGGGCAGAGGGTATATGG + Intronic
1032446624 7:131989804-131989826 CATGAAGGGCAGAAGGCACAAGG - Intergenic
1032522471 7:132556264-132556286 GTGGACAGCCAGAGGGCACGAGG - Intronic
1033410856 7:141116297-141116319 CTGGAAGGCCACAGGGCAGAGGG - Intronic
1034107247 7:148500988-148501010 CTTGAAACCCAGAGGGCACCTGG + Intergenic
1043394141 8:79820262-79820284 GTTGACGGACAGAGCACACAAGG + Intergenic
1044306530 8:90646136-90646158 CTTGTCGGCCAGAGGGGGCGGGG + Intronic
1044621884 8:94198694-94198716 CTTGGCTGCCAGAGAGCTCAGGG - Intronic
1045976961 8:108140068-108140090 TTGGACGGCCTGAGGGCATATGG + Intergenic
1046049263 8:109001899-109001921 CTTGACAGTCAGGGAGCACAGGG + Intergenic
1047916592 8:129590648-129590670 CTTGAGGCTCAGAGGGCTCAAGG - Intergenic
1048972905 8:139655187-139655209 CTTGACAACCCGAGGCCACAGGG - Intronic
1049648691 8:143752293-143752315 CTTGGAGGCCAGAAGGCAGAGGG - Intergenic
1057949236 9:99356659-99356681 ACTGACGGACAGAGGGTACAGGG - Intergenic
1058128850 9:101226826-101226848 CTTGAGGGCCAGAAGGGAGAAGG + Intronic
1058501937 9:105628919-105628941 CTTGACTGACAAGGGGCACAGGG + Intronic
1058689790 9:107510065-107510087 CTAGGAGCCCAGAGGGCACAGGG + Intergenic
1059299394 9:113300005-113300027 CTTCACGGCCAGAAGACTCATGG + Intronic
1059859776 9:118446999-118447021 CTTGAGGGCCAGGGGACAAATGG - Intergenic
1060711135 9:125865210-125865232 CTATATGGCCAGAGGGCTCAAGG + Intronic
1061957469 9:133971158-133971180 ACTGAGGGTCAGAGGGCACACGG - Intronic
1062024626 9:134334651-134334673 TTTGACAGCCAGAGGGCCCCAGG - Intronic
1062368898 9:136226468-136226490 CTGCACGGCCAGGGGGCGCAAGG - Intronic
1185449166 X:273713-273735 CATGAGGACCAGAGGTCACAGGG - Intergenic
1185449459 X:274894-274916 CATGAGGACCAGAGGTCACAGGG - Intergenic
1187250855 X:17596856-17596878 CTTGGAGGCCTTAGGGCACAGGG - Intronic
1187556693 X:20358627-20358649 CTTGACAGCCAGAGAGCCAATGG + Intergenic
1189448791 X:41107357-41107379 CTTGAAGGCCAGAAGGCAGTGGG - Intronic
1190411399 X:50140434-50140456 CTTCAAGTCCAGAGGGAACAAGG - Intergenic
1192326012 X:70133167-70133189 CTTGGCGGCTGAAGGGCACAGGG + Intergenic
1196837999 X:119831245-119831267 CTAGGCAGCCAAAGGGCACATGG - Intergenic
1197927383 X:131661298-131661320 CTGGAATGCCAGAGGCCACATGG + Intergenic
1198435026 X:136608853-136608875 ACTGACGGCCAGGGGCCACACGG - Intergenic
1199223886 X:145348993-145349015 CTTGAGAGTCAGGGGGCACAAGG + Intergenic
1201344470 Y:12967456-12967478 CTTGATGGCCTGAGGGCAAGAGG + Intergenic
1201772973 Y:17635839-17635861 CTTGCTGGCCAGAAGGGACATGG - Intergenic
1201828582 Y:18270147-18270169 CTTGCTGGCCAGAAGGGACATGG + Intergenic