ID: 1156456799

View in Genome Browser
Species Human (GRCh38)
Location 18:37299394-37299416
Sequence CTCTGGGCAGGGATGCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 253}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156456792_1156456799 -8 Left 1156456792 18:37299379-37299401 CCAGGGCCCAGTCACCTCTGGGC 0: 1
1: 0
2: 1
3: 36
4: 356
Right 1156456799 18:37299394-37299416 CTCTGGGCAGGGATGCTCCTGGG 0: 1
1: 0
2: 2
3: 27
4: 253
1156456783_1156456799 24 Left 1156456783 18:37299347-37299369 CCCTTAGAAGTGAGGGGAGGAAA 0: 1
1: 0
2: 2
3: 19
4: 242
Right 1156456799 18:37299394-37299416 CTCTGGGCAGGGATGCTCCTGGG 0: 1
1: 0
2: 2
3: 27
4: 253
1156456780_1156456799 29 Left 1156456780 18:37299342-37299364 CCCATCCCTTAGAAGTGAGGGGA 0: 1
1: 0
2: 3
3: 7
4: 114
Right 1156456799 18:37299394-37299416 CTCTGGGCAGGGATGCTCCTGGG 0: 1
1: 0
2: 2
3: 27
4: 253
1156456784_1156456799 23 Left 1156456784 18:37299348-37299370 CCTTAGAAGTGAGGGGAGGAAAA 0: 1
1: 1
2: 2
3: 28
4: 298
Right 1156456799 18:37299394-37299416 CTCTGGGCAGGGATGCTCCTGGG 0: 1
1: 0
2: 2
3: 27
4: 253
1156456781_1156456799 28 Left 1156456781 18:37299343-37299365 CCATCCCTTAGAAGTGAGGGGAG 0: 1
1: 0
2: 2
3: 18
4: 164
Right 1156456799 18:37299394-37299416 CTCTGGGCAGGGATGCTCCTGGG 0: 1
1: 0
2: 2
3: 27
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156456799 Original CRISPR CTCTGGGCAGGGATGCTCCT GGG Intronic
900348429 1:2223063-2223085 CTCTGGCCAGGGCAGCCCCTGGG + Intergenic
900367676 1:2317888-2317910 CTCAGCGCAGGGACGCTGCTCGG + Intergenic
901098714 1:6702629-6702651 TTCTGGGCAGGAAGGCTTCTGGG - Intergenic
901215226 1:7551172-7551194 CTCTGGGCAGGGAAGCCCCAGGG - Intronic
902293081 1:15447628-15447650 CTCTGGCCTGGCCTGCTCCTGGG + Intronic
902671022 1:17973855-17973877 CTCTGGGCAGGGCTCTTTCTTGG + Intergenic
902975257 1:20083721-20083743 CTCTGGGAAGGGAGGCTGCGTGG + Intronic
903188923 1:21645641-21645663 CTCTGGGCAGGGATCTCCCAAGG - Intronic
903373506 1:22851836-22851858 CTGTGTGCAGGGCTGCTGCTGGG - Intronic
903778587 1:25808282-25808304 CTCTGGCCTGGGCTGCGCCTGGG + Intronic
903862550 1:26373532-26373554 ATCTGTGCAGGGCTGGTCCTGGG + Intronic
904349787 1:29897685-29897707 CTCTCAGCAGGGATGCTGCATGG - Intergenic
904997081 1:34639657-34639679 CTCTGCCCAGGGTTGGTCCTGGG + Intergenic
908941409 1:69439019-69439041 CACTGAGTAGGGTTGCTCCTAGG + Intergenic
911674343 1:100642393-100642415 CTCTGGATAGGGTTTCTCCTGGG - Intergenic
914753350 1:150550016-150550038 CTCAGGACAGGGATTCTCCATGG + Intronic
915163898 1:153937750-153937772 CTCTGGTAAGGCAGGCTCCTCGG + Exonic
919738495 1:200968513-200968535 CCCTGGGCAGAGAGGCCCCTCGG - Intergenic
919785497 1:201255501-201255523 CTCTGGCAAGACATGCTCCTTGG + Intergenic
919931834 1:202226082-202226104 CTGTGGGCAGGGATTCACCAGGG - Intronic
919989659 1:202700387-202700409 CTCTGGGCTGGGCTTCACCTAGG + Intronic
922798976 1:228355463-228355485 CTCTGGGGAGGGAGGCAGCTAGG + Intronic
924025824 1:239831904-239831926 CTTTGGGGAAGGATGCTTCTAGG - Intronic
1062848440 10:725706-725728 CTCTGGGCAGGGCTGCTGCCTGG - Intergenic
1064266755 10:13831557-13831579 CTCTGGGAAGTGAAGCTACTGGG - Intronic
1064697460 10:17982708-17982730 AACTGCCCAGGGATGCTCCTAGG - Intronic
1070813569 10:79310396-79310418 CCCTGGGCAGGGGTGATGCTGGG - Intronic
1073110840 10:101062214-101062236 CTTTGGGCAAGGATGCTCAGGGG + Intronic
1074393184 10:113074867-113074889 CACAGGGCAGGGATGCTGCTAGG + Intronic
1074763401 10:116683998-116684020 CCCTGGGCCGGCCTGCTCCTAGG + Intronic
1075782816 10:125027700-125027722 CTCAGAGCTGGGATGCTGCTGGG - Exonic
1076372769 10:129965453-129965475 CTCTTGGCAGGGAAGTGCCTAGG - Intergenic
1076451776 10:130561339-130561361 CTCAGGGCGTGTATGCTCCTAGG + Intergenic
1076451855 10:130561654-130561676 CTCAGGGCGTGTATGCTCCTAGG + Intergenic
1076748650 10:132528374-132528396 CTGTGTGCAGGGCTGCTCCTAGG + Intergenic
1077113562 11:872794-872816 CTCAGGGCAGGGTTGGCCCTCGG + Intronic
1077226866 11:1442409-1442431 CTCTGGGCAGGGGGTCTCCAGGG + Intronic
1077311119 11:1889508-1889530 CTCTGGGCACGGAGGCTCTGGGG + Exonic
1077671979 11:4165782-4165804 CTTTGGGCAGAGCTGCCCCTGGG - Intergenic
1081049044 11:38314996-38315018 CTCTGGGGAGGGATGATCACTGG - Intergenic
1081580308 11:44347259-44347281 CTCTGGGTGGGGCTGGTCCTGGG + Intergenic
1083768478 11:64853512-64853534 CCCTGGGCAGGGCTGCTCCTTGG + Exonic
1084409202 11:68996785-68996807 CGCTGGGCAGGGCTGCCCCCAGG + Intergenic
1084609415 11:70192797-70192819 CACTGCGCAGGGAGGCCCCTTGG + Intergenic
1084908665 11:72369513-72369535 CTCTCGGCAGCTATGCTACTTGG + Intronic
1085283832 11:75347269-75347291 CTTTGGCCAGGGCTGCTCATGGG - Intronic
1085475718 11:76787713-76787735 CTGTGGGCAGGGATGCGATTAGG - Intronic
1088914918 11:114220179-114220201 CTCTGGGCCCAGATGGTCCTTGG + Intronic
1089496651 11:118911435-118911457 CTCTGGGGAGGAAGGCTCCTGGG + Intronic
1090276965 11:125427086-125427108 CTATGGACAGGGAGGCTGCTTGG + Intronic
1090380774 11:126326206-126326228 CTCTGGGCAGGGGTGTTGCCAGG + Intronic
1090737490 11:129622889-129622911 CTCTGGGCAGGGAAGCTGGGAGG + Intergenic
1092145258 12:6210337-6210359 CTCTGGGAAGGGACTCTCCAGGG - Intronic
1095349001 12:41188079-41188101 CCCTGGGCAGGGCTGCTGATGGG - Intergenic
1095708099 12:45259512-45259534 CAATTGGCAGGGATGCCCCTGGG + Intronic
1095891876 12:47242431-47242453 CTCTGGGCAGGTACCCTCTTTGG + Intergenic
1096546790 12:52345628-52345650 GTGGGGGCAGGGCTGCTCCTGGG + Intergenic
1096944726 12:55392172-55392194 CTGTAGGCAGGCAGGCTCCTGGG - Intergenic
1097052669 12:56232717-56232739 GTCTGGGCAGGGATGCCTCTGGG + Exonic
1102303501 12:111788082-111788104 GTCTTGGCAGGCATGCTACTTGG + Intronic
1102438169 12:112941560-112941582 CTTTGCCCAGGGAGGCTCCTCGG + Exonic
1103481207 12:121250759-121250781 CTTTGTGCAGGAACGCTCCTAGG - Intronic
1103879466 12:124154969-124154991 CACTGGGCAGGGATGGCCATTGG - Intronic
1104665379 12:130643759-130643781 CTGTGGGCATGTCTGCTCCTTGG - Intronic
1104837872 12:131803486-131803508 CTGTCGGCAAGGATGCTGCTGGG + Intergenic
1106221891 13:27753220-27753242 CTCTAAGCAGGGATGGGCCTTGG - Intergenic
1108123677 13:47217416-47217438 CTCTGGGCAATGATGCTCCATGG - Intergenic
1113929964 13:113963119-113963141 CCCTGGGCAAGGATGCCGCTTGG + Intergenic
1113981468 13:114280722-114280744 CTCTGGGCAGGGTGGCTCTCGGG + Intergenic
1117666242 14:58059302-58059324 ATCTGGGAAGGCATGCTCCCAGG + Intronic
1118455449 14:65942064-65942086 CTCTGGCCAGTGATGGTCTTGGG - Intergenic
1118867423 14:69714373-69714395 CTCTACGCAAGGATGTTCCTCGG - Exonic
1119597024 14:75944451-75944473 GTCAGGGCAGGGAGGCTCCGTGG - Intronic
1122285862 14:100652157-100652179 CTCTGGGCCAGGATTCTCATAGG - Intergenic
1122586039 14:102807266-102807288 TCCTGGGCAGGCAGGCTCCTGGG - Intronic
1122856848 14:104564062-104564084 CTCTGGGTAGCGAGGCTTCTGGG + Intronic
1122902534 14:104787739-104787761 CTCTGGGCAGGGATGCCCTGTGG - Intronic
1129252100 15:74314738-74314760 CTCCTGGCAGGAATGCTGCTGGG - Intronic
1129341569 15:74889942-74889964 CTCTGGGCACGGGTGCCCCGGGG + Intergenic
1132350115 15:101134099-101134121 CTCTGAGGAGGGATCCTGCTGGG - Intergenic
1132616450 16:843294-843316 CTCTGGTCAGGGCTGCATCTGGG - Intergenic
1132764717 16:1528615-1528637 CCCTGGGTGGGGATGCTCCGAGG - Intronic
1132812456 16:1807887-1807909 CTCGGGCCAGGCTTGCTCCTAGG + Exonic
1132829327 16:1919722-1919744 CTCTGGCCAGGGCTGCTGCTGGG - Intergenic
1136265833 16:29117525-29117547 CTCTGTGCAGGGACGCTGTTGGG + Intergenic
1138449808 16:57086953-57086975 CTCTGGGGAGGGAGGGTCATGGG - Intergenic
1139577972 16:67854427-67854449 ACCTGGTCAGGGAGGCTCCTTGG + Intronic
1141446751 16:84064260-84064282 CTCTGTGCAGGAATCCTACTAGG + Intronic
1142054651 16:87985432-87985454 CTCTGTGCAGGGACGCTGTTGGG + Intronic
1142309176 16:89302202-89302224 CCCTGGGCCGGGAGGCTGCTGGG - Intronic
1142312405 16:89321513-89321535 CTCTGGCAAGGAGTGCTCCTGGG - Intronic
1142603166 17:1067137-1067159 GTCTGGGAAGGGGTGCACCTGGG + Exonic
1143468749 17:7157683-7157705 CTCTGGGCCAGGTTGCTACTGGG - Intergenic
1144481035 17:15629089-15629111 GTCCGGGTAGGGATGCTCCCAGG + Exonic
1144917330 17:18734964-18734986 GTCCGGGTAGGGATGCTCCCAGG - Exonic
1144943747 17:18959350-18959372 CTCTGTGCAGTGCTGTTCCTGGG + Intronic
1146016362 17:29236934-29236956 CTCTGGGCAGAGTAGCTGCTGGG + Intergenic
1146889391 17:36496244-36496266 CACTGGGCTGGGGTGATCCTTGG - Exonic
1147251839 17:39157329-39157351 CTCTGGGCAAGGATTCTTCACGG + Intronic
1147725768 17:42565366-42565388 CGTTGGGCAGGGAAGCTCCCAGG - Intronic
1148105505 17:45116632-45116654 CTCTGGGGATGGCAGCTCCTCGG + Exonic
1148800522 17:50222120-50222142 CTCTGGTCAGGGATGTGCCAAGG + Intergenic
1148962315 17:51403717-51403739 CGCTGGGCACTGATGCACCTTGG + Intergenic
1149082856 17:52678658-52678680 CTCTTGGTAGGCATGCTCCTAGG + Intergenic
1149621391 17:58047877-58047899 CTCTGGGCAGTCATTCTGCTAGG - Intergenic
1150336357 17:64333401-64333423 CTCTGGCCAGGGTTTCTCCATGG + Intronic
1150622899 17:66821818-66821840 CCCAGGGCATGGATGCTCTTGGG + Intergenic
1151475829 17:74343957-74343979 GTCTGGAAAGGGGTGCTCCTTGG + Intronic
1151801450 17:76382212-76382234 CTCTGAGCAGGGATGCAGCTGGG + Intronic
1152406940 17:80103215-80103237 CCCTGGCCAGTGAAGCTCCTTGG - Intergenic
1152567711 17:81107548-81107570 CTCCGTCCAGGGAGGCTCCTGGG + Intronic
1153480463 18:5543029-5543051 CTCGGGGCCGCGATTCTCCTCGG - Intronic
1156456799 18:37299394-37299416 CTCTGGGCAGGGATGCTCCTGGG + Intronic
1158404676 18:57150886-57150908 CTCTGGGCTGGGTGGGTCCTGGG + Intergenic
1158535291 18:58303051-58303073 CACTGGGCAGCCCTGCTCCTGGG + Intronic
1160378148 18:78429555-78429577 CTGGGGTCAGGGATGCTCGTGGG + Intergenic
1160378162 18:78429609-78429631 CTGGGGTCAGGGATGCTCGTGGG + Intergenic
1160378176 18:78429663-78429685 CTGGGGTCAGGGATGCTCGTGGG + Intergenic
1161195471 19:2983960-2983982 GGCTGGGCAGGGACCCTCCTGGG - Intronic
1161345178 19:3765381-3765403 CTCCGGGAAGGGGTCCTCCTGGG - Intronic
1161571264 19:5032036-5032058 CTCTGGGGAAGGGTCCTCCTTGG - Intronic
1163321511 19:16577447-16577469 TTCAGGTCATGGATGCTCCTGGG + Exonic
1166046278 19:40232880-40232902 CTCTGAAAAGGGAGGCTCCTAGG - Exonic
1166824695 19:45601529-45601551 CTCTGGGCTGGGAACCTGCTTGG - Intronic
1166930480 19:46298581-46298603 CTGTGGCCAAGGATGCTCTTGGG + Intronic
1167023719 19:46898751-46898773 ATCTGTGCATGGAGGCTCCTGGG - Intergenic
1167439257 19:49499083-49499105 CTCTGGGCGGGGAGGATCTTGGG + Intronic
1168416230 19:56170594-56170616 CTCTGCACAGAAATGCTCCTGGG + Intergenic
1168650415 19:58088825-58088847 CTGTTGACAGGGATGCTGCTGGG - Exonic
927003235 2:18821528-18821550 CTCAGTGCAGGGATGCTCTGGGG - Intergenic
928134432 2:28677657-28677679 CTCTGGGCAGTTATGGGCCTTGG - Intergenic
929044062 2:37773550-37773572 CTCTGGGCAGGGAGGGGCCAAGG - Intergenic
929828483 2:45328948-45328970 CTCTGGGCAGTCATGGTGCTTGG + Intergenic
930378017 2:50591996-50592018 CTCCAGGCAGTGATGCTCCAAGG + Intronic
931215103 2:60234718-60234740 CTTGGGGCAGGGAGGCTCTTGGG - Intergenic
932317810 2:70797739-70797761 CTCTGGGAAGGGAAGGTCTTTGG - Intergenic
934943691 2:98520911-98520933 CTGTGGGCACGGAGGCTCCAAGG - Intronic
935598791 2:104901198-104901220 CTGTGGGCAGGCTTGCTCCTGGG - Intergenic
939079495 2:137642560-137642582 CACTGGGCAGGTTTTCTCCTGGG - Exonic
941541815 2:166795434-166795456 TTCTGGGCTGGGATGCTGCATGG + Intergenic
942042716 2:172081523-172081545 CTCCGGGCAGGAATGGCCCTTGG - Exonic
943785843 2:191877800-191877822 CTTTAGGCATGGATGCTCCAAGG - Intergenic
944215859 2:197255042-197255064 CTCTGGACAGGGAATCTCCTTGG - Intronic
944624790 2:201559519-201559541 CTCTGGGCAGGAATACTCCCAGG + Intronic
945258897 2:207825967-207825989 CTCTCGGCAGGTATGACCCTGGG + Intergenic
948979366 2:241485266-241485288 CTCTAGGGAGGGAAGATCCTAGG - Intronic
948979415 2:241485422-241485444 CTCTAGGAAGGGAAGATCCTAGG - Intronic
949080812 2:242097857-242097879 GTCTTGGCAGAGATGCTTCTGGG + Intergenic
1168798226 20:626532-626554 ATCTGTGGAAGGATGCTCCTGGG + Intergenic
1169029097 20:2394509-2394531 CTCAGGGCAGGGGTACTCCTGGG - Exonic
1169641756 20:7760059-7760081 CTCTGGCCAGAGATCCTCATAGG - Intergenic
1169923401 20:10758497-10758519 CACTGGTCAGGGATGCTTCCAGG - Intergenic
1170810067 20:19667324-19667346 CTCTGATCTGGGGTGCTCCTGGG - Intronic
1173733609 20:45344772-45344794 CTCTGGGCAGGAAGGACCCTTGG + Intronic
1174869923 20:54173192-54173214 GTCTGGGCAGGGAGGGTCCCCGG - Intronic
1175264955 20:57696943-57696965 CTCCGGGCAGCCATGCTCTTCGG + Intronic
1176171044 20:63696521-63696543 CTCTGGGGAGGGATGGTACCAGG + Intronic
1176200432 20:63857944-63857966 CTCTGGGGAGGGCTGCTCACTGG + Intergenic
1176235277 20:64050905-64050927 CTCAGGGCAGGAGTGCCCCTGGG - Intronic
1176291889 21:5050136-5050158 CCCTGGGCAGGGCTGCACCAAGG - Intergenic
1177270354 21:18840460-18840482 CTCTCACCAGGTATGCTCCTGGG + Intergenic
1177524943 21:22278849-22278871 CTCTGGGGAGTGATGCTCATAGG - Intergenic
1178492399 21:33061041-33061063 CTCTCGGGAGGGCTGCTCATTGG - Intergenic
1179496999 21:41778320-41778342 GTCTGGCCAAGGACGCTCCTTGG + Intergenic
1179503298 21:41823210-41823232 CTGTGGGCAGGGCAGCTTCTGGG - Intronic
1180895921 22:19331957-19331979 CCCAGGGCAAGGATGCACCTGGG + Intronic
1181462336 22:23093247-23093269 CTCTTGGCAGAGATGTTTCTAGG + Intronic
1182041679 22:27243130-27243152 CTCGGGGCGGGGGTGCACCTTGG - Intergenic
1184641693 22:45876398-45876420 CTCTGGACATTGAGGCTCCTTGG + Intergenic
949980815 3:9500773-9500795 CCCAGGGCAGGGAGGCTCCCCGG + Exonic
950005366 3:9687931-9687953 CTCTGAGAAGGGCTGCTCCCTGG + Intronic
952951722 3:38531091-38531113 CAGTGGGCAGGGAGGCTGCTGGG + Intronic
953878924 3:46681668-46681690 TTGGGGGCAGGGATACTCCTGGG - Intronic
954277470 3:49552068-49552090 CACAGGGCAGGCATGTTCCTGGG + Intergenic
954417148 3:50398922-50398944 ATCTGTGCAGGGCTGCTCCCAGG - Intronic
955058225 3:55474671-55474693 CGCTGGGCCGGGATGCTGCCGGG + Intronic
956166225 3:66400251-66400273 CTCTCTGCAGGGAAGCCCCTAGG + Intronic
956787649 3:72655842-72655864 CTCTTGGCATTGGTGCTCCTGGG + Intergenic
957005934 3:74946809-74946831 CTGTGGACAGGCAGGCTCCTTGG - Intergenic
958765895 3:98367669-98367691 CACTGTGCAGGGTTGCACCTGGG + Intergenic
961385582 3:126521636-126521658 CTCTGGCCTGGGGTCCTCCTGGG - Intergenic
961639158 3:128354017-128354039 CTCTGGGCATGGCTGCCCCAGGG - Intronic
963854351 3:150238516-150238538 CTCTGGGCAGAAATGCACCAGGG + Intergenic
965289990 3:166865966-166865988 CCCTGGGTAGGGGAGCTCCTAGG - Intergenic
965615028 3:170585229-170585251 CTCTGGGCAGGGAGCTTCCCTGG + Intronic
967619285 3:191612967-191612989 CTCTGAGCAGGTACGCTCATGGG - Intergenic
968081169 3:195847768-195847790 CGCTGTGCAGGGCTGCTCCTGGG - Intergenic
968672193 4:1857590-1857612 CCCTGGGGAGGGAGCCTCCTAGG - Intergenic
968920040 4:3517766-3517788 CGCTGGGAAGGGCTGCTCCCAGG + Intronic
969044656 4:4328004-4328026 CCCCGGGCTGGGTTGCTCCTAGG - Intergenic
969086079 4:4657543-4657565 TTCAGGGCAGGGAAGCTTCTGGG - Intergenic
969526355 4:7706027-7706049 GTCTGGGCAGGGATGAGGCTGGG + Intronic
969526376 4:7706108-7706130 GTCTGGGCAGGGATGAGGCTGGG + Intronic
969526390 4:7706162-7706184 GTCTGGGCAGGGATGAGGCTGGG + Intronic
969526398 4:7706189-7706211 GTCTGGGCAGGGATGAGGCTGGG + Intronic
969526430 4:7706297-7706319 GTCTGGGCAGGGATGAGGCTGGG + Intronic
969526438 4:7706324-7706346 GTCTGGGCAGGGATGAGGCTGGG + Intronic
969526446 4:7706351-7706373 GTCTGGGCAGGGATGAGGCTGGG + Intronic
969526453 4:7706378-7706400 GTCTGGGCAGGGATGAGGCTGGG + Intronic
969526465 4:7706432-7706454 GTCTGGGCAGGGATGAGGCTGGG + Intronic
969526491 4:7706529-7706551 GTCTGGGCAGGGATGAGGCTGGG + Intronic
969526503 4:7706583-7706605 GTCTGGGCAGGGATGAGGCTGGG + Intronic
969526557 4:7706788-7706810 GTCTGGGCAGGGATGAGGCTGGG + Intronic
969651114 4:8468908-8468930 TTCCGGGCAGGGATGCTGCTTGG + Intronic
970743548 4:19266829-19266851 TTGTGGGCAGGGATTCTCCTGGG - Intergenic
973005129 4:44996120-44996142 CTCAGGGCAGGGTAGCTCCATGG - Intergenic
978900467 4:113943331-113943353 CTCAGGGCAGTCATGATCCTAGG - Intronic
979896366 4:126162952-126162974 CTCTGGGCAGGGATAATACGTGG - Intergenic
982839166 4:160160274-160160296 CTCTGGTCAGGGATTCTCTCTGG + Intergenic
983989081 4:174096719-174096741 CTCTTGGCAGGTATGATCCCAGG - Intergenic
984833364 4:183997266-183997288 CCTTGGCCTGGGATGCTCCTTGG - Intronic
986004582 5:3657324-3657346 CTGTGTGCCAGGATGCTCCTAGG + Intergenic
990326091 5:54676724-54676746 CACTTGGCAGGGATTTTCCTGGG - Intergenic
992226267 5:74622068-74622090 CTCTGGGCTGGGATGTTGATAGG - Intergenic
993436974 5:87909478-87909500 ACCTGGGCAGGCATGCACCTAGG - Intergenic
993672633 5:90779755-90779777 ATCTGGGCAGAGATGCTGGTAGG - Intronic
996310800 5:122102311-122102333 CTCTGGGGTTTGATGCTCCTGGG - Intergenic
997449479 5:133970083-133970105 CTCAGAGAAGGGAAGCTCCTGGG - Intergenic
997700216 5:135892569-135892591 CTCTTGGCAGGTAGGCTTCTGGG - Intronic
998168114 5:139856024-139856046 CTCTGGGCAGGCATGGGGCTTGG - Intronic
998327721 5:141296714-141296736 AGCTGGGCAGGAAGGCTCCTAGG - Intergenic
1001073119 5:168604126-168604148 GTCTGGGTAGGTGTGCTCCTAGG + Intergenic
1001290210 5:170451939-170451961 GCCTGGGCAGGGCAGCTCCTGGG - Intronic
1003068202 6:2920921-2920943 CTGTGGGCAGGGAGGAGCCTTGG - Intergenic
1005292184 6:24390491-24390513 CTCTGGGAAGGGGTGCTACTGGG + Intergenic
1006276639 6:33009508-33009530 CTCAGAGCAGGGCTGGTCCTGGG - Exonic
1006317078 6:33297548-33297570 CTCTGGGCTGGTATAGTCCTTGG - Intronic
1006856475 6:37137217-37137239 CTCTGGGGAGGTAAGGTCCTCGG + Intergenic
1007415704 6:41690010-41690032 CCCTGGGCAGGTAGGCTCCTTGG - Intronic
1007702971 6:43775079-43775101 CTCTGGGGAGGGAAGGCCCTGGG + Intronic
1011819071 6:91229614-91229636 CTCTGGGAAAGGAAGCTCCGTGG - Intergenic
1012606362 6:101162719-101162741 CTCTGTCCAGTGAAGCTCCTTGG - Intergenic
1015031766 6:128603857-128603879 CTCTGGGCAGGAATGGGTCTTGG + Intergenic
1015422750 6:133029973-133029995 CTATGGGCAGGAATTCTCCCAGG - Intergenic
1017995456 6:159528075-159528097 CCAAGGGCAGGGATGATCCTGGG + Intergenic
1018304607 6:162442280-162442302 CTCCGCGCAGGGGGGCTCCTGGG - Intronic
1018887613 6:167953766-167953788 CTCTGGCCAGTGTCGCTCCTGGG + Intronic
1019930362 7:4218740-4218762 CTCTTCTCAGGGATGCTCCTTGG + Intronic
1021627006 7:22603308-22603330 CTCTGGACAAGGCTGCTTCTGGG + Intronic
1023610349 7:41965617-41965639 CTCGGGGCAGGGCTGCTCGAGGG + Exonic
1024295721 7:47840505-47840527 CTCTGGACAGGAGAGCTCCTTGG + Exonic
1029507060 7:100968944-100968966 CTCTGGGCAGGGATGGGCCATGG + Intergenic
1029547439 7:101217648-101217670 CTCTGGGCAGGGCTGCGGCCAGG - Exonic
1029560525 7:101299994-101300016 CTCAGGGCAGGGAAGCCCGTGGG - Intergenic
1029561057 7:101303160-101303182 CTCAGGGCAGGGAAGCCCGTGGG - Intergenic
1029889861 7:103916177-103916199 ATCTGGGCAGGGCTACTGCTGGG + Intronic
1032266734 7:130374787-130374809 AACTGGGCAGGGGTGCACCTCGG - Intergenic
1033021132 7:137725319-137725341 TTCTGGGCAGAGATACACCTGGG + Intronic
1035655624 8:1302769-1302791 CTCTGGGCAAGGTCGCTCCATGG - Intergenic
1035730941 8:1853230-1853252 GCCTGGGCAGGGCTGCACCTAGG - Intronic
1037501146 8:19486532-19486554 CTCTGGGCAGGAATGCTTCGAGG - Intronic
1037688089 8:21160945-21160967 GGCTGGGCAGGGATGCTGCGGGG - Intergenic
1040607844 8:48952104-48952126 CACTGGGCATGGTTGCTCCTTGG + Intergenic
1042343916 8:67708673-67708695 CTCAGGGCAGGGTGGCTCCATGG - Intronic
1042390417 8:68227855-68227877 CTCTGGGGAGGGATGTTTCTTGG + Intronic
1044824687 8:96184713-96184735 CTCTGTGCAGGCATGCACATTGG + Intergenic
1044973018 8:97638267-97638289 CTCTGGGCTGGGATGGTCCTTGG + Intergenic
1048498810 8:134957607-134957629 CACAGGCCAGGGAGGCTCCTGGG + Intergenic
1048919595 8:139215856-139215878 GTCTGGGCAAGGATGGTCATAGG - Intergenic
1049235799 8:141511631-141511653 CTCAGGGCAGGCATGTTCTTAGG - Intergenic
1049242275 8:141544027-141544049 CTCTGGGGCTGGAAGCTCCTTGG + Intergenic
1049437948 8:142596296-142596318 CTCTGGGCACGGAGGGGCCTTGG - Intergenic
1049989980 9:981574-981596 CTTGGGGCTGGGATGCTGCTGGG + Intronic
1053297764 9:36927186-36927208 CTCTTGGCTGGGATGCTGCCTGG - Intronic
1054451187 9:65404293-65404315 CTATGGGCAGTGTTCCTCCTGGG - Intergenic
1056581271 9:87889340-87889362 CACGGGGCAGGGAGGCTGCTGGG - Intergenic
1057477535 9:95415564-95415586 ATCTGGCCAGGAATGCTGCTGGG - Intergenic
1058742601 9:107958946-107958968 CTGTGGGCAAGGAAGCTTCTTGG + Intergenic
1060555909 9:124507117-124507139 CTCTGGGCAGGGAAGGTGCCAGG - Intronic
1061206474 9:129166852-129166874 CCCTGGGTAGGGGTGGTCCTGGG + Intergenic
1061217431 9:129229908-129229930 CTCTGCCCAGCAATGCTCCTGGG + Intergenic
1062345114 9:136110944-136110966 CTCTGGGGAGGGCGGCCCCTGGG - Intergenic
1062729698 9:138102058-138102080 CCCAGGGCAGGGCTGCTGCTGGG - Intronic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1186894203 X:13989696-13989718 CTCTGGGAAGAGAGGCGCCTTGG + Intergenic
1187099222 X:16175222-16175244 CTCTGGAAAAGGATGCTCATGGG - Intergenic
1187493694 X:19776408-19776430 CACTGGGCAGTGATGTCCCTGGG + Intronic
1188168660 X:26893191-26893213 CTGTGGGCAGGGCAGGTCCTTGG - Intergenic
1188242328 X:27808130-27808152 CCCCGGGCAGGGATCCTCTTAGG + Intronic
1188242422 X:27808638-27808660 CCCCGGGCAGGGATCCTCTTGGG + Intronic
1189368828 X:40411856-40411878 CTGGGGGCAGGGATGCTCCCTGG - Intergenic
1199601672 X:149544843-149544865 CTCTGGGATGGCATGATCCTCGG - Intronic
1200096611 X:153667534-153667556 CACTGGGCAAGGATGCTCTCTGG + Intergenic