ID: 1156456812

View in Genome Browser
Species Human (GRCh38)
Location 18:37299427-37299449
Sequence CGGCCCCCATACCAGGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156456812_1156456818 -6 Left 1156456812 18:37299427-37299449 CCAGGGGCCTGGTATGGGGGCCG 0: 1
1: 0
2: 1
3: 24
4: 262
Right 1156456818 18:37299444-37299466 GGGCCGGGCAGAACTGGGACAGG 0: 1
1: 0
2: 1
3: 27
4: 396
1156456812_1156456820 -2 Left 1156456812 18:37299427-37299449 CCAGGGGCCTGGTATGGGGGCCG 0: 1
1: 0
2: 1
3: 24
4: 262
Right 1156456820 18:37299448-37299470 CGGGCAGAACTGGGACAGGATGG 0: 1
1: 0
2: 4
3: 27
4: 286
1156456812_1156456824 16 Left 1156456812 18:37299427-37299449 CCAGGGGCCTGGTATGGGGGCCG 0: 1
1: 0
2: 1
3: 24
4: 262
Right 1156456824 18:37299466-37299488 GATGGGAGCCTTGGGCCACGTGG 0: 1
1: 0
2: 2
3: 25
4: 266
1156456812_1156456822 7 Left 1156456812 18:37299427-37299449 CCAGGGGCCTGGTATGGGGGCCG 0: 1
1: 0
2: 1
3: 24
4: 262
Right 1156456822 18:37299457-37299479 CTGGGACAGGATGGGAGCCTTGG 0: 1
1: 1
2: 2
3: 43
4: 445
1156456812_1156456821 -1 Left 1156456812 18:37299427-37299449 CCAGGGGCCTGGTATGGGGGCCG 0: 1
1: 0
2: 1
3: 24
4: 262
Right 1156456821 18:37299449-37299471 GGGCAGAACTGGGACAGGATGGG 0: 1
1: 0
2: 3
3: 45
4: 334
1156456812_1156456823 8 Left 1156456812 18:37299427-37299449 CCAGGGGCCTGGTATGGGGGCCG 0: 1
1: 0
2: 1
3: 24
4: 262
Right 1156456823 18:37299458-37299480 TGGGACAGGATGGGAGCCTTGGG 0: 1
1: 0
2: 2
3: 25
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156456812 Original CRISPR CGGCCCCCATACCAGGCCCC TGG (reversed) Intronic
900311700 1:2036463-2036485 CGGCTCCCATGGCAGGACCCGGG + Intergenic
901059519 1:6465662-6465684 CAGCCCACTTCCCAGGCCCCGGG + Intronic
901639803 1:10687477-10687499 TGGCCCACATACCACGCCCGGGG + Intronic
902369572 1:15997407-15997429 CGGCCCCAGTCCCAGGCTCCAGG + Intergenic
902618864 1:17639012-17639034 AGGCCCCCAGGCCAGGCCCTGGG + Intronic
902824408 1:18963073-18963095 AGGGCCCCATGCCAGGCCCAGGG - Intergenic
904880987 1:33696725-33696747 CTGCCCACCTGCCAGGCCCCAGG - Intronic
905294122 1:36943291-36943313 CCTCCCCCATCCCAGGTCCCTGG + Intronic
905653394 1:39671421-39671443 CTGCCCCCAGCCCAGGGCCCAGG + Intronic
905693699 1:39960296-39960318 GGGCGCCCATACCTGGCCTCCGG + Intronic
905993916 1:42364520-42364542 CAGCCACCATGCCTGGCCCCAGG + Intergenic
906196553 1:43933793-43933815 CGGCCCCCAGACAAGGCCCGGGG + Exonic
910232096 1:84997447-84997469 CGGCCCCCAGGACAGGCCCGAGG + Intergenic
910384309 1:86664858-86664880 AGGCCCCCATTCCAGGCCCTAGG + Intergenic
911219801 1:95234409-95234431 CGGTCCCCATACGTGGGCCCAGG - Intronic
915305616 1:154975752-154975774 CCGCCCCCAAACCAAGCCCAGGG - Intronic
915617504 1:157050834-157050856 CAGGCACCATGCCAGGCCCCGGG + Intergenic
917834698 1:178932084-178932106 TGGCCCCCACAGCAGGCCCTGGG + Intergenic
919466135 1:197922864-197922886 CAGGCACCATACCAGGCCCTGGG - Intronic
920423140 1:205849699-205849721 CTTCCCCCATACCTGGCTCCTGG - Intronic
920854553 1:209652280-209652302 AGGCCCTGAAACCAGGCCCCAGG + Intronic
921929442 1:220743071-220743093 AAGCCCCCATTCCAGGCCCTAGG - Intergenic
922287746 1:224183969-224183991 CGGCCCCCTTAACGGGCCCAAGG - Intronic
922763282 1:228145294-228145316 CGGCCCTCAGACCAGGCTCTGGG - Intronic
923057774 1:230440435-230440457 GAGCCCCCATACCCGGCCTCTGG + Intergenic
924553509 1:245099488-245099510 CTGCCCCGACACCAGGCCACAGG + Intronic
924887434 1:248234453-248234475 CAACCCCCTTAACAGGCCCCAGG + Intergenic
1063434300 10:6018152-6018174 CTGCCCCCATGCCAAGCCCAGGG - Intronic
1067091144 10:43266467-43266489 CCACCCCCACGCCAGGCCCCGGG + Intronic
1068727563 10:60320307-60320329 GAGCCACCATACCAGGCCCATGG - Intronic
1069438307 10:68406593-68406615 CGACCCCCAAACCCGGCCGCAGG + Intronic
1071997747 10:91163582-91163604 CGGCCCCCAAACTAGGCGCCGGG - Intronic
1072757515 10:98030695-98030717 CGCCCCCCACCCCGGGCCCCCGG - Exonic
1072803944 10:98412383-98412405 GGGGCCCCATAGCAGGCGCCTGG + Intronic
1073363414 10:102918200-102918222 ACGCCCCCATTCCAGCCCCCTGG + Intergenic
1076724441 10:132406928-132406950 AGGCCCCCACACCATGTCCCAGG - Intronic
1076882513 10:133246344-133246366 AGGCCCCCAACCGAGGCCCCAGG + Intergenic
1077109607 11:856298-856320 CGTCCAGCATACCAGGCCCCAGG - Intronic
1077218653 11:1405576-1405598 GGTCCCCCATCCCAGACCCCTGG - Intronic
1077231453 11:1459753-1459775 CTGCCCCCATCCCAGGGACCCGG + Intronic
1077433750 11:2528430-2528452 CAGCCCCCACCCCAGGCACCTGG + Intronic
1078358098 11:10647760-10647782 AGGGCCCCAGACCTGGCCCCAGG - Intronic
1079099663 11:17533365-17533387 CCGCCCCCATAGCAGACCTCAGG + Intronic
1080556035 11:33418370-33418392 CAGACCCCATGCCAGGCCTCTGG - Intergenic
1080588038 11:33699083-33699105 CAGCCACCACACCCGGCCCCTGG + Intronic
1081637910 11:44733117-44733139 CTGGCCCCAAACCAGCCCCCAGG + Intronic
1083155579 11:60820970-60820992 TGTCCCCCTTGCCAGGCCCCAGG + Intergenic
1083887875 11:65581565-65581587 CGGCCCCCACCCCAGCCCCTCGG + Exonic
1084178885 11:67437009-67437031 CATCCCCCATCCCAGGCCTCAGG - Intronic
1084418979 11:69050785-69050807 TGGCCCCCACACCAGCCCGCCGG - Intronic
1084600068 11:70140022-70140044 CTGCCTCCGTGCCAGGCCCCGGG + Intronic
1084949372 11:72656320-72656342 CAGGCCCAATATCAGGCCCCAGG + Intronic
1085328048 11:75623633-75623655 CAGCCTCCAAACCAGGCACCAGG - Intronic
1087180460 11:95136761-95136783 CCACCCCCACAACAGGCCCCAGG + Intergenic
1093075025 12:14749102-14749124 CAGCCTCCATACCAGGACCAGGG + Intergenic
1094832033 12:34304708-34304730 CAGCCCCTGTGCCAGGCCCCGGG + Intergenic
1095990247 12:48029600-48029622 CCTCCCCCATCCCAGACCCCTGG + Intergenic
1096309331 12:50505873-50505895 CGGCCCGAATAACAGGCACCAGG - Intronic
1096626339 12:52898429-52898451 CCGCCCTCATCCCAGGGCCCTGG + Intronic
1102463483 12:113114729-113114751 CAGCCCCCAGACAAGGCTCCGGG + Intronic
1103128852 12:118449030-118449052 CCACCCCCACAACAGGCCCCAGG + Intergenic
1103563410 12:121804130-121804152 CGCCCCCCCTTCCTGGCCCCCGG + Intergenic
1103738887 12:123078277-123078299 CCTCCCCCATACCAGGCCTCAGG + Intronic
1104599058 12:130140100-130140122 CGGCCCCCAGCACAGGCCTCAGG - Intergenic
1105474936 13:20721228-20721250 CTGCCCCCAGCCTAGGCCCCAGG + Intronic
1106196445 13:27498077-27498099 TGGCCCCCATAGGACGCCCCTGG - Intergenic
1106959614 13:34983176-34983198 CCCACCCCACACCAGGCCCCAGG + Intronic
1107222780 13:38005436-38005458 CAACCCCCATGACAGGCCCCAGG + Intergenic
1107711228 13:43152375-43152397 CTGCCCCCGGCCCAGGCCCCAGG + Intergenic
1111299125 13:86323334-86323356 CCGACCCCACAACAGGCCCCGGG - Intergenic
1113594119 13:111519373-111519395 CTGTCCCCATACCAAGCTCCAGG - Intergenic
1113682930 13:112256912-112256934 CCGCACCCACACCAGGCCCTGGG + Intergenic
1113914148 13:113861015-113861037 CGGCACCCCTCCCAGGCTCCAGG - Intronic
1123941235 15:25217601-25217623 CCGCCCCCCAACCAGGCCCCAGG - Intergenic
1124055853 15:26240488-26240510 CAGGCCCCACACCAGGCCCACGG - Intergenic
1124601725 15:31138203-31138225 CGGCCCCCTTTCCAGTGCCCTGG - Intronic
1126689646 15:51279333-51279355 GGGCTCCCATCCCAGCCCCCAGG - Intronic
1128146050 15:65333105-65333127 CGGCCCCCAGGCCAGGCCAAAGG - Intronic
1128812828 15:70585078-70585100 CGGCCCCCGTCACAGACCCCGGG + Intergenic
1130956245 15:88629357-88629379 CGGCCTCCACACCCGGGCCCGGG + Exonic
1131109953 15:89758803-89758825 CGGCCCCCCTCCCAGCCCCAAGG + Intergenic
1131148998 15:90035204-90035226 CAGCCCCCACACCATGCCCCAGG - Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1131826032 15:96322982-96323004 CGACCCCCATAGCAGGGGCCGGG - Intergenic
1132629486 16:910309-910331 CCGCCCCCACACCAGGGCCCAGG + Intronic
1132686429 16:1164056-1164078 CGGCCTCCATACCCGGCCGGCGG - Intronic
1132891868 16:2208630-2208652 CCTCCCCCATCCCTGGCCCCCGG + Intronic
1132999635 16:2842386-2842408 TGGCCCCCATCCCAGGGCCAGGG + Intergenic
1133805761 16:9125085-9125107 CGGCGCCCCTACGTGGCCCCAGG + Intergenic
1134681953 16:16132456-16132478 CAGCCACCATTCCTGGCCCCTGG + Intronic
1135326219 16:21527399-21527421 CTGCCCCCATCCCAAGCTCCAGG + Intergenic
1136360932 16:29779334-29779356 AGTCCCCAATACCAGGCTCCTGG - Intronic
1138088815 16:54157361-54157383 CAGCCACCATGCCAGGCCCGTGG + Intergenic
1140513357 16:75524419-75524441 CAGGCCCAGTACCAGGCCCCAGG - Intergenic
1141677203 16:85524095-85524117 CGGCCCCCAGACCTGGGCCCCGG - Intergenic
1142039266 16:87882126-87882148 CTGCCCCCATCCCAAGCCCCAGG + Exonic
1142598442 17:1040708-1040730 CTGACTCCATGCCAGGCCCCGGG + Intronic
1142720087 17:1770164-1770186 GGACCCCCAGGCCAGGCCCCTGG - Intronic
1143838677 17:9713420-9713442 CTGCCCCCATTCCCGGCCTCTGG + Intronic
1144836474 17:18159046-18159068 GGGGCCCCCTCCCAGGCCCCTGG + Intronic
1147211214 17:38873625-38873647 ACGCCCCCATACAAGACCCCAGG - Intronic
1147608051 17:41785462-41785484 CGGCCCCTACCTCAGGCCCCTGG + Intronic
1148115591 17:45172848-45172870 CTTCCCCCACCCCAGGCCCCAGG + Intergenic
1148683939 17:49490347-49490369 CTGACCCCAGACCAGTCCCCAGG + Intergenic
1148793103 17:50184652-50184674 CTGCCCCCATCCCCGCCCCCAGG + Exonic
1148836561 17:50468824-50468846 CTGCCCCCAGCCCCGGCCCCAGG - Exonic
1150388221 17:64776615-64776637 GGGCCACCACCCCAGGCCCCAGG - Intergenic
1151269689 17:72984595-72984617 CAGGCCCCATTCCAGGCCTCTGG + Intronic
1151676820 17:75602956-75602978 CGCCCGCCACACCAGACCCCAGG + Intergenic
1151684908 17:75640618-75640640 CGGTCCCCATGCCAGCCGCCAGG - Intronic
1151892302 17:76957975-76957997 CGGCCCCCTAGCCAGGCCGCTGG + Intergenic
1152645942 17:81468553-81468575 CTGCCCCCAGAACAGGCCCTGGG + Intergenic
1152756422 17:82088919-82088941 AGGCGCCCATCCCAGGCTCCCGG + Intronic
1154070627 18:11149008-11149030 CCGCCCCCAAACGACGCCCCGGG - Intergenic
1156456812 18:37299427-37299449 CGGCCCCCATACCAGGCCCCTGG - Intronic
1158458820 18:57630230-57630252 AGGCCACCGTACCAGGCCGCCGG + Intergenic
1160381354 18:78458569-78458591 CGTACCCAATCCCAGGCCCCAGG + Intergenic
1160438150 18:78867095-78867117 CGGCCCCCACACCTGCCCCCAGG + Intergenic
1160838597 19:1136350-1136372 CAGGGCCCATACCAGGCACCTGG - Intronic
1160948761 19:1655697-1655719 CTGTCCCCGTACCAGGGCCCTGG - Intergenic
1160952913 19:1676063-1676085 CGAGCCCCCTCCCAGGCCCCTGG - Intergenic
1161954564 19:7486083-7486105 ATCCCCCCATACCTGGCCCCGGG + Intronic
1162032776 19:7924660-7924682 CTGCCCCCAACCCGGGCCCCAGG - Exonic
1162443416 19:10707451-10707473 CTACCCCCTCACCAGGCCCCTGG + Intronic
1162731774 19:12722465-12722487 AGGCCCACTTACCCGGCCCCGGG + Intronic
1163632349 19:18423956-18423978 GCGCCCCCAGACCTGGCCCCCGG + Intronic
1164739166 19:30563977-30563999 GTCCCCCCATCCCAGGCCCCTGG - Intronic
1164986644 19:32653292-32653314 AGGCTCCCAGACTAGGCCCCCGG + Intronic
1164994149 19:32707360-32707382 TGGACACCATACCAGGGCCCTGG + Intronic
1165357682 19:35313743-35313765 CTGCCCCCACACCTGGCCCTGGG + Exonic
1165447838 19:35866403-35866425 GGGCCCCCAGATCTGGCCCCCGG + Exonic
1166054255 19:40279242-40279264 CGGCACCCACAGCAGGGCCCAGG - Intronic
1167019180 19:46861341-46861363 CGGCCCCCCCCCCAGCCCCCCGG + Intergenic
1167077999 19:47260636-47260658 CGGCCCCCCTTGCTGGCCCCTGG - Exonic
1167358779 19:49019116-49019138 CGGCCCTCACACCCCGCCCCAGG + Intergenic
1167366470 19:49057364-49057386 CGGCCCTCACACCCCGCCCCAGG + Exonic
1167376375 19:49114479-49114501 CGGCCTACATACCCAGCCCCCGG + Intronic
1167961083 19:53104436-53104458 GAGCCACCATACCTGGCCCCAGG + Intergenic
1168345386 19:55648220-55648242 CGGCGCCCATGCCCGGCGCCGGG - Exonic
1168515214 19:57005104-57005126 CTCCCCCCACAACAGGCCCCAGG + Intergenic
925210486 2:2041627-2041649 CGTCCCCCATGGCCGGCCCCAGG + Intronic
925601297 2:5611167-5611189 CAGCTCCCAGTCCAGGCCCCAGG + Intergenic
926142603 2:10377291-10377313 CTGCCCCCGAGCCAGGCCCCAGG + Intronic
927591254 2:24360143-24360165 CGGCCCCCGAGCTAGGCCCCTGG - Intronic
927884116 2:26707984-26708006 CAGGCCCCATTCTAGGCCCCAGG + Intronic
927960579 2:27238526-27238548 CCTCCCCCTTCCCAGGCCCCAGG - Exonic
930058772 2:47272085-47272107 AGGCCCCCATCCCAGCGCCCAGG + Intergenic
930469236 2:51792345-51792367 TGGCCCCCTTTCCAGGCCCCAGG + Intergenic
931254345 2:60556828-60556850 CGACCCCCCTCCCCGGCCCCTGG + Intergenic
932485477 2:72081923-72081945 CAGCCCCCATAGCAGGCGCCTGG + Intergenic
934588243 2:95525315-95525337 CGGCCCCCAGCCCACGCCTCCGG + Intergenic
934924810 2:98374829-98374851 GGGCCCCCCCATCAGGCCCCTGG + Intronic
935692543 2:105744676-105744698 CGGCGCCCGTACCGGGACCCGGG + Intergenic
937096939 2:119241704-119241726 CGGCCTCCATATCAGCTCCCTGG + Intronic
942455787 2:176137160-176137182 CGGACTCCACCCCAGGCCCCAGG - Intergenic
945011242 2:205466081-205466103 CAGGCCCCATCCCAGACCCCTGG - Intronic
946238886 2:218341903-218341925 CTGTCCCCATCCCAGGCCCAAGG - Intronic
947568301 2:231210117-231210139 CAGCGCCCATGCCAGGCCACTGG - Intronic
947796122 2:232895040-232895062 CAGCAGCCATCCCAGGCCCCAGG - Intronic
948140821 2:235670632-235670654 CGGCGCCCAGGCCAGGCTCCCGG - Intronic
948201989 2:236136102-236136124 AGGCCTCCACACCTGGCCCCTGG + Intergenic
948830727 2:240597147-240597169 CTGCCCACCTCCCAGGCCCCCGG - Intronic
1169065578 20:2692840-2692862 CGGGCCCGAGGCCAGGCCCCGGG + Intergenic
1171332454 20:24352470-24352492 CAGCTCCCATACAAGGTCCCTGG + Intergenic
1172006992 20:31824444-31824466 AAACTCCCATACCAGGCCCCAGG - Intronic
1172293508 20:33792206-33792228 CGGGCACCATGCCAAGCCCCTGG - Exonic
1172897512 20:38310771-38310793 TGGCCCCCATACCATGCCTGAGG - Intronic
1173657628 20:44711363-44711385 CAGCCCCCACACAAGGGCCCAGG - Intergenic
1174350596 20:49964899-49964921 CGGCCTCCATGCCTGACCCCGGG + Intergenic
1175225173 20:57440365-57440387 GGGGCACCATACCAGGCCCAGGG - Intergenic
1175579631 20:60088416-60088438 AGACCCCCATCCCAGGCCACGGG - Intergenic
1175810982 20:61857125-61857147 CTGCCCCCATACCCCTCCCCGGG + Intronic
1175943289 20:62547598-62547620 CGGCCCCCATGCCTGGCGCTGGG + Intergenic
1176140462 20:63542643-63542665 AGCCCCCCACACCAGGCCTCTGG + Intronic
1179974665 21:44857661-44857683 CGGCCTCCTTGCCAGGGCCCAGG - Intronic
1180087223 21:45513190-45513212 GGGCCCCCATCTCATGCCCCTGG + Exonic
1181165157 22:20979375-20979397 CCGCCCCCATCCGAGGCCCCGGG - Intronic
1181230073 22:21417067-21417089 CGGACCGCATACCGGCCCCCGGG - Intergenic
1181248576 22:21517799-21517821 CGGACCGCATACCGGCCCCCGGG + Intergenic
1181408899 22:22704378-22704400 CTGCCCCCAGACCCTGCCCCAGG + Intergenic
1181438811 22:22925236-22925258 AGGCCCCCATCCCGGGACCCGGG + Intergenic
1181786863 22:25233465-25233487 CAGCCCCCATTCCAGGCCACCGG - Intergenic
1181818912 22:25460422-25460444 GAGCCCCCATTCCAGGCCACGGG - Intergenic
1181956299 22:26589988-26590010 CGGCCCCCAGCCCGCGCCCCCGG + Intronic
1183353473 22:37346260-37346282 AGCCTCCCAGACCAGGCCCCAGG + Intergenic
1183511169 22:38235913-38235935 CGGCTCCAGTACCAGACCCCTGG + Intronic
1184264966 22:43342088-43342110 CGCCACCCATACCAGACCTCAGG + Intronic
1184465873 22:44668718-44668740 CGGCCCCCTCCCCCGGCCCCGGG + Intronic
1185224257 22:49644024-49644046 AGGCCACCAGACCTGGCCCCTGG + Intronic
1185310740 22:50152881-50152903 CTGCCCCCAGACCAAGCCCTTGG - Intronic
950408875 3:12821442-12821464 GGTCCCACATAACAGGCCCCTGG - Intronic
950801132 3:15552542-15552564 AGGCCCCCATTCCAGGCCCTAGG - Intergenic
952194004 3:31053485-31053507 CAGCCCCCTTACCAGTCTCCTGG + Intergenic
956891920 3:73622270-73622292 TGGCCCCCCTTCCTGGCCCCTGG - Intronic
960067272 3:113387386-113387408 AGGCCCCTATTCCAGGCCCTAGG + Intronic
960783436 3:121346109-121346131 CCGACCCCACAACAGGCCCCAGG + Intronic
960986477 3:123284421-123284443 CGGCCTCTGTCCCAGGCCCCGGG - Exonic
961653578 3:128429420-128429442 CTGCCCCCATCCCGGGCCCTGGG + Intergenic
966245874 3:177807796-177807818 TAGACCCCATACCAGGCCCCGGG - Intergenic
967851519 3:194086279-194086301 AGGCCCCCATAGCAAGACCCAGG + Intergenic
968808788 4:2790898-2790920 CTGGCCCCACACCAGACCCCGGG - Intergenic
968809281 4:2792866-2792888 CGGCCCCGGGACGAGGCCCCTGG - Intergenic
969115362 4:4867580-4867602 CCGCCCCCTTCCCAGGCCCAGGG + Intergenic
969613987 4:8241794-8241816 CGGCCCTCATCTCAGTCCCCAGG + Intronic
971320327 4:25600283-25600305 CCGACCCCACAACAGGCCCCAGG - Intergenic
973969990 4:56203886-56203908 CTGCCTCCATACAAGGCCACTGG + Intronic
975706091 4:77113237-77113259 CCGGCCCCAGCCCAGGCCCCTGG - Intergenic
979726633 4:123970401-123970423 CGCACCCCACAACAGGCCCCAGG + Intergenic
981319085 4:143370703-143370725 CTGACCCCACAACAGGCCCCGGG + Intronic
982911521 4:161148563-161148585 AGGCCCCCATTCCAAGCCCTAGG + Intergenic
987626404 5:20406419-20406441 CCTCCCCCACAACAGGCCCCGGG - Intronic
988722501 5:33892332-33892354 AGGCCCCCAGGCCAGCCCCCCGG + Intergenic
996259267 5:121445955-121445977 AGGCCCCCATTCCAGGCCCAAGG + Intergenic
998411401 5:141914275-141914297 CGCCCTCCCTCCCAGGCCCCGGG + Intergenic
1000161615 5:158602973-158602995 GGGCCCCCAAAGCAGGCCGCTGG + Intergenic
1001436331 5:171702549-171702571 TGGCCCCCAGACCCTGCCCCGGG + Intergenic
1001602642 5:172939158-172939180 CGGCCCCCGTAGCAGGCACCAGG + Intronic
1001617723 5:173056510-173056532 CTTCCCCCAGCCCAGGCCCCTGG - Intronic
1002329055 5:178429098-178429120 TGGGCCCCATGCCAGGCACCAGG + Intronic
1002330310 5:178436321-178436343 CTGCCCCCATCCCAGGCAGCCGG + Intronic
1002600923 5:180353476-180353498 CGGCCCCCCTCCCTGGCTCCTGG - Intergenic
1003000029 6:2323283-2323305 CAGCCACCATGCCTGGCCCCTGG + Intergenic
1006110331 6:31740546-31740568 CGGCCCCAGTGCCGGGCCCCAGG + Exonic
1006863168 6:37187221-37187243 CGGCCCCCACCCCAGGCCCCAGG - Intergenic
1007662742 6:43496560-43496582 CGAACCCCAAACCAGGGCCCAGG + Intronic
1009058248 6:58365158-58365180 CCCACCCCATAACAGGCCCCAGG - Intergenic
1012997262 6:105986092-105986114 CGGCGCCCTGCCCAGGCCCCAGG - Intergenic
1014652009 6:124051579-124051601 CCGACCCCACAACAGGCCCCGGG + Intronic
1015370761 6:132449413-132449435 AAGCCACCATACCAGGTCCCAGG + Exonic
1017601000 6:156081187-156081209 CCGACCCCATAACAGGCCCCCGG - Intergenic
1017684064 6:156894285-156894307 CGGCCCCCATCCCAACCCCCCGG - Intronic
1019148622 6:169989390-169989412 CCAGCCCCAAACCAGGCCCCTGG + Intergenic
1019445029 7:1066693-1066715 CGGCCTCCCCAGCAGGCCCCTGG - Intronic
1019470773 7:1219335-1219357 GGGCCACCATGCCCGGCCCCTGG - Intergenic
1019476645 7:1247605-1247627 CGCCCCCCACACCGGGGCCCGGG - Intergenic
1019492334 7:1321307-1321329 AGGCCCCCTCCCCAGGCCCCTGG - Intergenic
1019554303 7:1621003-1621025 CGGCCCCCACACCACCCGCCGGG - Intergenic
1019566020 7:1679448-1679470 GGGACCCCAGAGCAGGCCCCGGG - Intergenic
1019634778 7:2069713-2069735 AGGCCCCCCAACCAGGCGCCTGG - Intronic
1021103864 7:16615267-16615289 AGGCCTGTATACCAGGCCCCCGG + Intronic
1024063151 7:45713818-45713840 CGGCTCCCAAATCAGGTCCCTGG + Exonic
1024527776 7:50363230-50363252 GAGCCCCCAGACCAGGGCCCTGG + Intronic
1029614902 7:101650161-101650183 CTGCCCCCATCCCCGGCGCCTGG - Intergenic
1030176475 7:106660373-106660395 CGGCCCCCGAAGCAGGGCCCGGG + Exonic
1032266574 7:130374057-130374079 CGGCTCCCAGACCCGGTCCCAGG + Intergenic
1035240101 7:157523784-157523806 CGGCACCCACACAAGTCCCCAGG - Intergenic
1039396943 8:37234476-37234498 GGGCCACCATGCCTGGCCCCCGG - Intergenic
1040617190 8:49048399-49048421 GGGCCCCCAAACCAGCCCCATGG - Intergenic
1043581540 8:81721188-81721210 CAGCCCCCATCCCCGGCCGCGGG - Intronic
1044730547 8:95225567-95225589 CAGCCCCCAGGCCAAGCCCCAGG - Intergenic
1045194434 8:99915790-99915812 GTGCCACCATACCTGGCCCCTGG + Intergenic
1047782769 8:128123382-128123404 GGGTCCCCAGGCCAGGCCCCGGG + Intergenic
1048283612 8:133123698-133123720 CGGTCCCCAAACCTGGCCACAGG - Intronic
1048581268 8:135731521-135731543 AGGCCTCCAGCCCAGGCCCCAGG - Intergenic
1049392048 8:142376741-142376763 CAGCCCCCATGCCCGGGCCCTGG - Intronic
1049474549 8:142790629-142790651 TGGCCTCCATCCCCGGCCCCTGG - Intergenic
1049707810 8:144050927-144050949 CCGCCCCCCTACCAGGGCCCTGG + Intergenic
1049804574 8:144533089-144533111 TGGCCCCCACACCCGGCGCCCGG + Intronic
1050462195 9:5886344-5886366 CAGCCCCCACACCAGCCCCAGGG - Intronic
1051613795 9:18987612-18987634 GGGCTACCATACCAGGCCCAAGG - Intronic
1053005319 9:34600445-34600467 CCGCCCCCACACCTGGACCCAGG + Intergenic
1055301998 9:74891879-74891901 AGGCCCCCATTCCAGGCCCTAGG + Intergenic
1056338776 9:85603357-85603379 AGGCCACCATTACAGGCCCCAGG + Intronic
1056814528 9:89791873-89791895 CTGCTCCCAGCCCAGGCCCCAGG + Intergenic
1057368912 9:94451948-94451970 GGTTCCCCATCCCAGGCCCCTGG + Intronic
1057438464 9:95063829-95063851 TGGCCCTCATGCCTGGCCCCAGG + Intronic
1058957591 9:109963587-109963609 CAGCCCCCATACTGGGCCCTGGG + Intronic
1059175825 9:112169516-112169538 GGGCCCCCACACCTGGCCTCAGG + Intronic
1061225411 9:129278416-129278438 CTGACCCCATCACAGGCCCCAGG + Intergenic
1061836598 9:133333706-133333728 CTGCCCGCCTACCTGGCCCCGGG + Exonic
1061928953 9:133822380-133822402 CTGCCCCCACCCCAGTCCCCTGG - Intronic
1062037976 9:134391137-134391159 CCGGCCCCATGCCAGGCCCCAGG + Intronic
1062045007 9:134420921-134420943 CGGCTGAGATACCAGGCCCCAGG - Intronic
1062341551 9:136095705-136095727 GGGCCCCCCTACCCCGCCCCCGG + Intergenic
1062422667 9:136490872-136490894 GGGCCCACAAATCAGGCCCCCGG - Intergenic
1062424915 9:136501736-136501758 TGGCACCCTTACCAGGCCCGCGG + Exonic
1062587205 9:137254787-137254809 CGGCCGCCCTCCCAGGCACCGGG - Intergenic
1062626621 9:137445953-137445975 CAGCCCCCAGACCACACCCCAGG + Intergenic
1062628204 9:137452462-137452484 CGGCCCCCACCCCAGCCCCAGGG + Intronic
1062635105 9:137486606-137486628 CGGCCCCCACCTCCGGCCCCAGG + Intronic
1203758899 EBV:1766-1788 GGGCCCCCATACCGGGCAACCGG - Intergenic
1186611091 X:11139125-11139147 CCGCCTCCATACCCGGGCCCAGG - Exonic
1189543021 X:42012304-42012326 CTGACCCCATTCCAGGCTCCCGG + Intergenic
1189875724 X:45434008-45434030 AGGACCCCATTCCAGGCCCTAGG - Intergenic
1190455743 X:50626321-50626343 CTGCCCCCTTACCAGGTGCCAGG + Intronic
1194857909 X:98956718-98956740 GGGCCCCCATTCCAGGCTCTAGG - Intergenic
1198927505 X:141815153-141815175 AGGCCCCCGTTCCAGGCCCTAGG - Intergenic
1201283621 Y:12361137-12361159 CTGCCCCCATTCCAGGACACTGG - Intergenic