ID: 1156457779

View in Genome Browser
Species Human (GRCh38)
Location 18:37304440-37304462
Sequence CAGCCAAAAGGCCCATGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156457779 Original CRISPR CAGCCAAAAGGCCCATGGTG GGG Intronic
900184189 1:1325241-1325263 CAGCCCAACGGCCCAAGGTCAGG - Intronic
900326852 1:2112481-2112503 CAACCCAGAGGCCCATGCTGAGG + Intronic
900981678 1:6049443-6049465 CAGGAAAGAGGCACATGGTGTGG + Intronic
901947375 1:12714731-12714753 CAGCCAACAGTCCTATGGAGTGG + Intergenic
906208264 1:43998350-43998372 CAGCCTAAAGGCCCAGGATGTGG - Intronic
907192212 1:52658912-52658934 CAGCCAAAGGGTACATGATGGGG + Intronic
907489205 1:54798260-54798282 CATGCAAAGGCCCCATGGTGGGG - Intronic
910557128 1:88546660-88546682 AAGCAAATAGGCCCATGGAGAGG + Intergenic
911520616 1:98925807-98925829 CAGGCAAAAGGGAAATGGTGGGG + Intronic
912473747 1:109923257-109923279 CAGCCACAGGGGCCATGGAGGGG - Exonic
919864476 1:201770038-201770060 CAGCCAGAGGGCCAAGGGTGTGG - Intronic
920836246 1:209513708-209513730 CAGCCAAAAGGTACAGGATGTGG - Intergenic
924934653 1:248757750-248757772 CAGCCTGAAGGCAGATGGTGAGG - Intergenic
1063438149 10:6050963-6050985 CAGCCAAAAGGCTCACCCTGTGG + Intronic
1063930724 10:11026160-11026182 CAGCCAAGAGGCACAAGGTAGGG - Intronic
1064575093 10:16737004-16737026 AAGCCAAAAGGGGGATGGTGGGG + Intronic
1069827063 10:71260851-71260873 CAGCCAAGAGGCCCAGGAAGGGG + Intronic
1072415128 10:95240967-95240989 GAGCCAGAAGGCCCAGGATGGGG + Intronic
1075073194 10:119332637-119332659 CTGCCAAAAGGACCATGGATAGG - Intronic
1076497027 10:130904102-130904124 CATCCAAAAGCCCCATGCAGGGG - Intergenic
1079456518 11:20641189-20641211 CAGCCAAAAGGCCCCTGTACTGG - Intronic
1083795882 11:65016402-65016424 AAACCAAAAGGCCCTAGGTGAGG - Intronic
1085610646 11:77945697-77945719 CAGCCAAAAAGCCAATCCTGCGG + Intronic
1086373109 11:86174512-86174534 CAGCCACATGGCCCATAGGGAGG + Intergenic
1087269524 11:96097386-96097408 CACCCAAAAGGTCCACAGTGTGG - Intronic
1087361676 11:97168018-97168040 CAAACAAAAAGACCATGGTGTGG + Intergenic
1088194762 11:107262246-107262268 CAGCCAAAAGGGCCATCAGGAGG + Intergenic
1089294244 11:117458456-117458478 CAGAAAGAATGCCCATGGTGTGG + Intronic
1090432949 11:126662032-126662054 GAGCCAAAACGCCCATTGAGAGG + Intronic
1092046206 12:5433140-5433162 CTGCGCAAAGGCCCAGGGTGGGG - Intronic
1100407667 12:94285356-94285378 CAGCCAAAAAGCCCAAGGATGGG - Intronic
1101295128 12:103414775-103414797 CTGCCAAAAGGCCCCTGGATTGG - Intronic
1104801182 12:131556136-131556158 CAGCCACGATGCCCATGGAGAGG - Intergenic
1106173239 13:27307266-27307288 CAGCAAAAAGGCCCCCGGAGAGG - Intergenic
1106464009 13:29996661-29996683 CAGCCAGCCTGCCCATGGTGTGG - Intergenic
1107905505 13:45057556-45057578 TAGAGAAGAGGCCCATGGTGTGG - Intergenic
1107961377 13:45562547-45562569 CAGCCAACATGCTCTTGGTGGGG + Intronic
1107975918 13:45688422-45688444 CTGCCAAAATGCCCATCCTGAGG - Intergenic
1108978808 13:56483759-56483781 GATCCCAAAGGCCCAAGGTGAGG + Intergenic
1110725394 13:78816929-78816951 CAGCCAACAGGCCCGTCCTGTGG - Intergenic
1115087208 14:29531977-29531999 CAACCAAAAAGCCCATTTTGGGG - Intergenic
1116866793 14:50037963-50037985 CAGCCCAAATGCCCATGGGAGGG + Intergenic
1121835402 14:97087893-97087915 CAGCCAAAGGTCCCTGGGTGAGG + Intergenic
1122050786 14:99058340-99058362 AAGCCAATGGGCACATGGTGGGG + Intergenic
1122384079 14:101332084-101332106 CAGCCAAAGGAAGCATGGTGTGG - Intergenic
1124552280 15:30692921-30692943 CAGCCTAAAGGCTCCAGGTGAGG - Intronic
1124678959 15:31712745-31712767 CAGCCTAAAGGCTCCAGGTGAGG + Intronic
1126338031 15:47607855-47607877 CAGGCAAAAGGCCTAGGGAGAGG + Intronic
1126918002 15:53487363-53487385 GAGCCAAAGGGAACATGGTGTGG - Intergenic
1129931636 15:79415861-79415883 CAAACAAAATTCCCATGGTGTGG + Intronic
1131538991 15:93260458-93260480 TAGACAAAAGTCCCAGGGTGAGG - Intergenic
1131558784 15:93421827-93421849 CAGCCAACAGGCCAATGGGCAGG - Intergenic
1132160727 15:99539208-99539230 CAGCTAGATGGCCCAGGGTGGGG + Intergenic
1132936056 16:2481849-2481871 GGGCCAACCGGCCCATGGTGTGG + Intronic
1133050774 16:3116062-3116084 CAGGCTCAAGGCCCATGGTCAGG + Intronic
1133280375 16:4661740-4661762 CAGCCACAAGTCCCATGGGATGG - Intronic
1133303496 16:4796770-4796792 CTGCCAAGAAGCCCATGGGGTGG - Intergenic
1134518493 16:14906200-14906222 CAGACAAAAGGCCCAGGTTAAGG + Intronic
1134555435 16:15160017-15160039 CAGACAAAAGGCCCAGGTTAAGG - Intergenic
1134706164 16:16304853-16304875 CAGACAAAAGGCCCAGGTTAAGG + Intergenic
1134961376 16:18407257-18407279 CAGACAAAAGGCCCAGGTTAAGG - Intergenic
1134965676 16:18489860-18489882 CAGACAAAAGGCCCAGGTTAAGG - Intronic
1135112290 16:19699632-19699654 CAGACACCAGGACCATGGTGAGG + Exonic
1138656812 16:58496157-58496179 CAGCACACAGGCCCACGGTGTGG + Intronic
1138782599 16:59807495-59807517 CTGCCACAAATCCCATGGTGAGG + Intergenic
1140746883 16:77988515-77988537 CTGGCAAAAAGCCCATGGTTGGG + Intergenic
1141300925 16:82814791-82814813 CAGTCACAAGGCCCAGGTTGTGG - Intronic
1143876153 17:9992176-9992198 CAGACAAAAGCCCCAGGGAGTGG + Intronic
1144060647 17:11580956-11580978 CAGCCCAAGAGCACATGGTGAGG + Intergenic
1146631692 17:34474513-34474535 CAGCCAGGAGGCCCATGGCCTGG - Intergenic
1148643359 17:49204661-49204683 CAGCCCAAATGCCAAGGGTGAGG - Intronic
1150979207 17:70122747-70122769 CAGTCAAGAGGCCAGTGGTGAGG - Intronic
1152255903 17:79239264-79239286 CATCCAAAAGGCCCATGGAATGG - Intronic
1155056084 18:22185140-22185162 CAGTGAAAAGGGCCATGGTCTGG + Intronic
1156457779 18:37304440-37304462 CAGCCAAAAGGCCCATGGTGGGG + Intronic
1157505538 18:48223531-48223553 CAGCCAAAAAGCCCATTGTAAGG - Intronic
1157925156 18:51756279-51756301 CAGACAAATGGCCCATTGAGGGG - Intergenic
1160228985 18:77032257-77032279 AAACAAAAAGGGCCATGGTGTGG + Intronic
1160533016 18:79576616-79576638 CAGCCAGCAGGCCCATGTGGAGG + Intergenic
1161607611 19:5223342-5223364 CAGCCCAGAGGCACAAGGTGGGG + Intronic
1163782165 19:19256347-19256369 CAGCCATCAGGCCCCTGATGGGG + Exonic
1164444503 19:28305716-28305738 CAGCAAAGAGGCCCACGTTGTGG - Intergenic
1164684133 19:30156063-30156085 CTGCCAAATGGCCCACGCTGGGG + Intergenic
1165071705 19:33259573-33259595 GAGCCACAAGGCCCAGGGTTGGG - Intergenic
1165775272 19:38400694-38400716 CAGCGGACAGGCCCAGGGTGAGG + Intergenic
925045199 2:767622-767644 CAACCAGAAGGCCCCTGCTGTGG - Intergenic
927289982 2:21395731-21395753 CAGCCAAAAGGCCCTAGATGGGG - Intergenic
928908403 2:36393024-36393046 CAGCTAAAAGGCCTTTGATGAGG - Intronic
930518195 2:52433387-52433409 CCCCCAAAAAGCCCATGGTCAGG + Intergenic
933544849 2:83697003-83697025 CAGCCCCAAGGCCCAGAGTGTGG - Intergenic
939828548 2:147045283-147045305 CAGTCCAAAGGCCCCTGGAGTGG - Intergenic
940363586 2:152821305-152821327 CAGCCATATGGCCCATAATGAGG - Intergenic
942098404 2:172555669-172555691 CAGCCAAAAGGCTCAAGGACAGG - Intronic
945091857 2:206183200-206183222 AAGCCATATGGCCCATGGGGTGG + Intronic
946484615 2:220089067-220089089 GAGCGTAAAGCCCCATGGTGTGG + Intergenic
947972987 2:234339573-234339595 CAGCCAAAAGGGCTCTGATGTGG - Intergenic
1169950224 20:11035404-11035426 CAGCAACATAGCCCATGGTGGGG - Intergenic
1172034162 20:32000083-32000105 CAGTCAAAGGGCCCAGGGAGAGG + Exonic
1172153400 20:32806547-32806569 CAGCCAACAGACAGATGGTGTGG - Intronic
1172812650 20:37660217-37660239 CATCCAAAAGGCCCATGGCACGG - Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174832216 20:53823387-53823409 GAGCCCAAAGGGCCATGGGGAGG + Intergenic
1175687733 20:61043901-61043923 CTCCTAAAAGGCCCATGGAGTGG + Intergenic
1179377595 21:40864692-40864714 CAGCCAAAAGCTCAATGGAGAGG + Intergenic
1179568664 21:42264981-42265003 CAGCCAAAGGGCCCAAGAGGTGG - Intronic
1181114136 22:20620730-20620752 CAGCCAAGAGGCCCTGGGTTAGG + Intergenic
1182060965 22:27397072-27397094 CAACCTAAATGCCCATGGAGAGG - Intergenic
1184240492 22:43209071-43209093 CAGCCAAAAGCCGCAGTGTGCGG - Intronic
950886428 3:16366590-16366612 CAGACAAAAGGACCATGAGGTGG - Intronic
952379645 3:32794943-32794965 CAGCCTATAGTCCCATGGTCAGG + Intergenic
954749112 3:52803852-52803874 CAGCAAGAACGCCCATGGCGAGG + Exonic
955153681 3:56394109-56394131 CAGCCAACATGCCCATGGCAAGG + Intronic
960534932 3:118805075-118805097 TAGCAAGAAGGCCCATGCTGAGG + Intergenic
961319531 3:126063301-126063323 TAGCCAAGAGGCCCAGGGAGGGG - Intronic
961570198 3:127792239-127792261 CAGCCAAAAGTCCATTGCTGTGG + Intronic
969895784 4:10303252-10303274 CAGCAAAAAGGCACATGTTAAGG + Intergenic
973185731 4:47325686-47325708 AAGCCAAAAGAACTATGGTGGGG - Intronic
978250063 4:106619878-106619900 CAGCCAAAGAGTCCATGGAGTGG - Intergenic
980977910 4:139628779-139628801 CAGCCAAGAAGCCCAGGGAGTGG + Intergenic
984943097 4:184951375-184951397 CAGCCCAAACGTCCATGGTGAGG + Intergenic
986272530 5:6246317-6246339 CTGCCAACTGGCCCATGATGGGG + Intergenic
986808771 5:11333789-11333811 CGTCCAAACAGCCCATGGTGAGG - Intronic
987649150 5:20718391-20718413 CAGCAAAATGGACCAAGGTGAGG - Intergenic
988746408 5:34143148-34143170 CAGCAAAATGGACCAAGGTGAGG + Intergenic
992280428 5:75169927-75169949 CTGCCAAAAGTCCCCTGGGGAGG + Intronic
993622357 5:90183719-90183741 CAGCTAAATGGTCCATGGTATGG - Intergenic
993920556 5:93795368-93795390 CAACAAAAAGGCTCATGGTCTGG - Intronic
994608065 5:101995926-101995948 AAGACAAAAGGCCAATGTTGAGG + Intergenic
997443546 5:133925614-133925636 CAGGCAAAAATCCCATGCTGTGG - Intergenic
1000164478 5:158634699-158634721 CACCCAGATGGCCCATGGAGAGG - Intergenic
1000349724 5:160343898-160343920 CAGGCAAAGGCCCCGTGGTGGGG - Intronic
1004851218 6:19701799-19701821 TAGCCAAAAGGCCCAAGTGGTGG - Intergenic
1005088814 6:22034874-22034896 CAGGCAAATGGCCTCTGGTGTGG - Intergenic
1005544556 6:26851386-26851408 CAGCAAAATGGACCAAGGTGAGG + Intergenic
1009015344 6:57893012-57893034 CAGCAAAATGGACCAAGGTGAGG + Intergenic
1009483050 6:64184333-64184355 CAGGCAGAAGGCACATGGTTAGG - Intronic
1011494977 6:87928585-87928607 CAGGCAAAAGGACGATGGGGAGG + Intergenic
1015320925 6:131873341-131873363 TTGCCAAAAGTCCCATGGGGAGG + Intronic
1018077548 6:160230404-160230426 CTGCCAAAAGGGCCATGGACCGG - Intronic
1018372067 6:163177591-163177613 CAGGCAACAGGGCCAAGGTGTGG + Intronic
1019193200 6:170266188-170266210 CAGCAAAATGCCCCATTGTGTGG + Intergenic
1025842456 7:65163349-65163371 CAGCCAAAAAGCCAATCCTGCGG - Intergenic
1025880589 7:65532620-65532642 CAGCCAAAAAGCCAATCCTGCGG + Intergenic
1025892848 7:65669984-65670006 CAGCCAAAAAGCCAATCCTGCGG - Intergenic
1031899361 7:127392542-127392564 CACCGAAAAGGCCCAAGGTTGGG - Exonic
1038515523 8:28184375-28184397 CCTCCAAAAGGCCCATCGTGAGG + Intronic
1040465193 8:47688467-47688489 CACACAAAAGGACCCTGGTGTGG + Intronic
1040563155 8:48542505-48542527 CAGCCAGCAGGCCCACGGAGGGG + Intergenic
1042771688 8:72389140-72389162 TGGCCCAAAGCCCCATGGTGGGG + Intergenic
1042826919 8:72989075-72989097 CAGCCAGAATGCCCATGGTCTGG - Intergenic
1045345133 8:101287386-101287408 AAGCCAAAAAAGCCATGGTGTGG - Intergenic
1047016956 8:120733977-120733999 CAGCCTTAAGGCTTATGGTGAGG + Intronic
1047184005 8:122615521-122615543 CTGCCAAATGTCCCCTGGTGGGG + Intergenic
1052995962 9:34551804-34551826 CAGCCCAAGGGGCCAGGGTGAGG + Exonic
1054496100 9:65824800-65824822 CTGCTATAATGCCCATGGTGCGG - Intergenic
1057048601 9:91904575-91904597 CAGGCTTCAGGCCCATGGTGGGG + Intronic
1057499530 9:95585671-95585693 CATCCAAAGAGCCCAGGGTGGGG - Intergenic
1059862534 9:118480869-118480891 CAGCCAAACAGCCCATAGTTAGG - Intergenic
1059965618 9:119610618-119610640 CAGCCTAAAGGCATATGGGGAGG - Intergenic
1060034639 9:120244237-120244259 CAGCCAGAAGGTGCATGGTGAGG - Intergenic
1061796109 9:133086789-133086811 CAGCCGAGTGGCCCATGTTGGGG - Intronic
1062180217 9:135187407-135187429 CAGCCAAAGGGTCTCTGGTGTGG + Intergenic
1062351247 9:136140249-136140271 CAGCCCCAAGGCCCATGGATGGG + Intergenic
1062629480 9:137457483-137457505 CAGCCCAAAGGCCCGAGGGGTGG + Exonic
1187303521 X:18074357-18074379 CAGCCCAAAGAGCCATAGTGAGG - Intergenic
1193196627 X:78639677-78639699 CAGCCAAAGGGCTCCAGGTGTGG + Intergenic
1195552632 X:106185933-106185955 TTGCCCAAAGCCCCATGGTGGGG - Intronic
1197520719 X:127492709-127492731 CAGCCAAAGGCCCTATGATGTGG - Intergenic
1199570156 X:149259262-149259284 CAGCAGAAAGGTACATGGTGTGG - Intergenic
1199745913 X:150771927-150771949 CTGCCAAAAGGCCCATGCTGGGG - Intronic
1200078604 X:153564534-153564556 CAGCCAAAGGGCCCAGGGAGTGG - Intronic