ID: 1156458102

View in Genome Browser
Species Human (GRCh38)
Location 18:37306037-37306059
Sequence CCATCAGGGCAGAAGCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156458102_1156458109 3 Left 1156458102 18:37306037-37306059 CCAGTGGGCTTCTGCCCTGATGG 0: 1
1: 0
2: 1
3: 25
4: 390
Right 1156458109 18:37306063-37306085 AGAGGCATCAAAGCTCGCACAGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156458102 Original CRISPR CCATCAGGGCAGAAGCCCAC TGG (reversed) Intronic
900985461 1:6070669-6070691 CCATGAGGATAGAAGGCCACAGG - Intronic
903318789 1:22529269-22529291 CCATAAGGGCAGCAGCCTATGGG - Exonic
904412793 1:30335137-30335159 CCAGCAGACCAGATGCCCACAGG + Intergenic
905429313 1:37909993-37910015 CCATCTGTGCAGGACCCCACTGG + Intronic
905463933 1:38138957-38138979 CCTTCAGGGCAGGACCCCAGAGG + Intergenic
905838450 1:41151508-41151530 CCCTCAGGTAAGAAGCCCAAGGG + Intronic
906080945 1:43087850-43087872 CCATCTGTGCAGGACCCCACTGG + Intergenic
906155517 1:43611896-43611918 ACATCAGGGCTGAAGCCCTGTGG + Intronic
906356146 1:45107066-45107088 CAAACAGGGCCGAAGGCCACAGG + Intronic
906565619 1:46799123-46799145 AGATCAGCCCAGAAGCCCACAGG - Exonic
906744498 1:48212358-48212380 CCATCTGTGCAGGACCCCACTGG - Intergenic
909984705 1:82146673-82146695 CTGGCAGTGCAGAAGCCCACTGG - Intergenic
910234421 1:85020602-85020624 CCTGCAGGGCACAAGCCCAGGGG - Intronic
911256070 1:95634810-95634832 CCATGAAGGCAGAAGCACCCAGG - Intergenic
911443655 1:97963128-97963150 CAATCAGAGAAGAACCCCACTGG + Intergenic
911768769 1:101712565-101712587 CCATCATGGTAGAAACCCAAAGG + Intergenic
912942814 1:114060000-114060022 CAATCATGGCAGAAGGCCAACGG - Intergenic
915215018 1:154334435-154334457 GGATCAGGGCAGAAGCCCAGAGG + Intronic
917509445 1:175658173-175658195 CCCTCAGGTCAGCAGCCCTCAGG + Intronic
917877813 1:179302514-179302536 CAATCATGGCAGAAGACCAAGGG - Intronic
919417417 1:197328745-197328767 CCAGCAGGGCAGATGCAGACAGG - Exonic
919476422 1:198037135-198037157 CCATCTGTGCAGGACCCCACTGG + Intergenic
920835291 1:209505410-209505432 CCATCAGGGCAGATGGCCTTTGG - Intergenic
921127190 1:212188273-212188295 CCCTCAGCCCTGAAGCCCACTGG - Intergenic
921148660 1:212382827-212382849 CCACCAAGGCAGAAGCTCCCAGG + Intronic
922606065 1:226890680-226890702 CCAGCAGGAAAGAAGACCACAGG + Intronic
922754538 1:228088256-228088278 CAATCAGGGCAGAATCCCTGAGG + Intronic
922924793 1:229339633-229339655 CCAGCCAGGCAGCAGCCCACAGG + Intronic
923110355 1:230885174-230885196 CCAACAGGACAGAAGCCAGCAGG + Intergenic
924180679 1:241436313-241436335 CCATCTGTGCAGGACCCCACTGG + Intergenic
1064264752 10:13816833-13816855 CAATCTGGGCAGGAGCCCAGAGG + Intronic
1065256734 10:23877214-23877236 CTATCAGGCCAGAAGCCCATTGG + Intronic
1065737558 10:28768075-28768097 CCACAAGGGCAGTAGCTCACAGG + Intergenic
1066103373 10:32137025-32137047 CCATCTGTGCAGGACCCCACTGG - Intergenic
1066437187 10:35405849-35405871 CCATCTGTGCAGGACCCCACTGG - Intronic
1067519148 10:46982020-46982042 CCAGCAGAGCATAAGGCCACAGG - Intronic
1067643097 10:48069814-48069836 CCAGCAGAGCATAAGGCCACAGG + Intergenic
1068327734 10:55516314-55516336 CCATCATGGCAGAAGGCAAAAGG - Intronic
1070759670 10:79016257-79016279 ACAGCTGGGCAGAAGCCCAGAGG + Intergenic
1071187259 10:83059490-83059512 CCATCTGTGCAGGACCCCACTGG + Intergenic
1071700102 10:87922235-87922257 CAATCATGGCAGAAGGCCAAGGG - Intronic
1071961134 10:90809767-90809789 CCATCTGTGCAGGACCCCACTGG + Intronic
1072201067 10:93159231-93159253 CAATCATGGCAGAAGGCCAAAGG - Intergenic
1072633590 10:97163730-97163752 CTGCCAGGGCAGAAGGCCACAGG + Intronic
1072652174 10:97304239-97304261 GCCTCAGGTCAGAAGGCCACAGG + Intergenic
1073683546 10:105729720-105729742 CCATCTGTGCAGGACCCCACTGG + Intergenic
1073877976 10:107947797-107947819 CAATCAGGGCAGAAGTTGACGGG + Intergenic
1074019052 10:109564707-109564729 CCATCTGTGCAGGACCCCACTGG + Intergenic
1075859975 10:125667029-125667051 CCTTCAGGGCAGAGGCCTGCAGG + Intronic
1076236452 10:128867243-128867265 ACTTCAGGGCAGAGGCGCACTGG + Intergenic
1076389487 10:130087849-130087871 CCAGCATGGCAGAGCCCCACCGG - Intergenic
1076393309 10:130120131-130120153 CAATCATGGCAGAAGGCCAAGGG + Intergenic
1076506986 10:130984779-130984801 CCATGAGGGCAGCAGAGCACAGG + Intergenic
1079390794 11:20020426-20020448 CCATGAGGGCAGATGCCCTTTGG - Intronic
1079484600 11:20922201-20922223 CCATCAGGGTGGAAGCTCAGGGG + Intronic
1079727049 11:23890552-23890574 CCATCTGTGCAGGACCCCACTGG - Intergenic
1080658291 11:34275230-34275252 CCAACAGGGCTGAAGCCTGCAGG + Intronic
1080697269 11:34613372-34613394 CCACCAGGGCAGAAAACCTCAGG - Intergenic
1082244317 11:49904394-49904416 CCATCATGGCAGAAGGCAAAGGG + Intergenic
1082686987 11:56251190-56251212 CCATCAGGAAAGAAGTCCAGAGG + Intergenic
1083883641 11:65560216-65560238 CCCTGAGGTCAGATGCCCACAGG - Intergenic
1085570219 11:77552274-77552296 CCATCTGTGCAGGACCCCACTGG + Intronic
1086490907 11:87356970-87356992 TTATCAGGTCAGAAGCTCACAGG + Intergenic
1086550240 11:88045533-88045555 CCATCTGTGCAGGACCCCACTGG + Intergenic
1087127841 11:94643958-94643980 CCATCTGTGCAGGACCCCACTGG + Intergenic
1087155042 11:94894114-94894136 ACATCAGGGAAGCTGCCCACAGG - Intergenic
1089187334 11:116628248-116628270 CAATCACGGCAGAAGCCAAAAGG + Intergenic
1089707741 11:120292690-120292712 CCATCAGTGCAGCTGCCCACTGG + Intronic
1089987709 11:122829464-122829486 CCATCTGTGCAGGACCCCACTGG + Intergenic
1090107572 11:123868968-123868990 CCATCTGTGCAGGACCCCACTGG - Intergenic
1090526783 11:127546102-127546124 CCATCTGTGCAGGACCCCACTGG - Intergenic
1090546463 11:127772446-127772468 CCATCTGTGCAGGACCCCACTGG - Intergenic
1090871933 11:130756880-130756902 CCATCTGTGCAGGACCCCACTGG - Intergenic
1090993208 11:131839467-131839489 CAGCCAGGGCAGAAGCCCTCAGG + Intronic
1090995728 11:131864246-131864268 CCATCAGGGCAGGATCCATCAGG + Intronic
1092315742 12:7411594-7411616 CAATCATGGCAGAAGGCCAAGGG - Intronic
1094732266 12:33191695-33191717 CGATCATGGCAGAAGGCAACAGG - Intergenic
1096179110 12:49540943-49540965 CCATCAGAGCAGTAGACCACGGG - Exonic
1096993279 12:55822104-55822126 CCCCCAGGGCAGATGCCCAATGG - Exonic
1097686049 12:62691844-62691866 CCAGCAGGGCAGAGGGCCCCAGG - Intronic
1098919929 12:76293801-76293823 CCATCTGTGCAGGACCCCACTGG + Intergenic
1099479422 12:83147627-83147649 CCAGCAGAGCATAAGGCCACGGG + Intergenic
1099997616 12:89796116-89796138 CAATCATGGTAGAAGCCCAAGGG + Intergenic
1100807053 12:98296539-98296561 GCAACAGGGCAGCAGACCACAGG - Intergenic
1101697176 12:107137768-107137790 TCATGAGGCCAGAAGCCAACAGG - Intergenic
1102624001 12:114219954-114219976 CCATGAAGGCAAAAGCGCACAGG - Intergenic
1104149609 12:126070114-126070136 CCATTAGCTCAAAAGCCCACTGG - Intergenic
1104190435 12:126477292-126477314 CAATCATGGCAGAAGGCAACAGG + Intergenic
1107427762 13:40311334-40311356 CCATCAGGACAGATTCCTACTGG - Intergenic
1108715577 13:53074969-53074991 GCAACAGGGCAGAGGCCCAGGGG - Intergenic
1109499316 13:63215465-63215487 CCATCTGTGCAGGACCCCACTGG + Intergenic
1109589572 13:64460427-64460449 CCATCATGAAAAAAGCCCACTGG - Intergenic
1110240192 13:73258238-73258260 CTAGCAGAGGAGAAGCCCACTGG - Intergenic
1110397552 13:75049280-75049302 CCATCATGGCAGAAGGCAAAGGG + Intergenic
1111151168 13:84254947-84254969 TCTTCAGGTCAGAAGCCCAGGGG - Intergenic
1111240417 13:85466225-85466247 CCATCATGGCAGAAGACAAAGGG + Intergenic
1114935585 14:27532830-27532852 CAATCATGGCAGAAGCCAAAAGG - Intergenic
1116107013 14:40521918-40521940 CCATCATGGCAGAAGGCAAAGGG + Intergenic
1116490557 14:45498754-45498776 CCATCTGGGCGGGACCCCACTGG - Intergenic
1116703265 14:48265744-48265766 CCATCTGTGCAGGACCCCACTGG - Intergenic
1117757413 14:58990079-58990101 ACATCAGGCTAGAAGCCCAGAGG + Intergenic
1119935107 14:78585241-78585263 CTATCAGGGCAGATGGTCACAGG + Intronic
1120767082 14:88338099-88338121 CCATCATGGCAGAAGGCGAGGGG - Intergenic
1120920383 14:89749713-89749735 TCATCAGGCCAGAAGCCCATGGG + Intergenic
1121193274 14:92048079-92048101 CCATCTGTGCAGGACCCCACTGG - Exonic
1121588134 14:95078047-95078069 CCATCATGGCAGAAGTCGAAGGG + Intergenic
1122507659 14:102241970-102241992 CCATCTGTGCAGGACCCCACTGG + Intronic
1122900758 14:104781447-104781469 CCAGCAGGGCAGCAGCCCCAGGG + Intronic
1123033391 14:105461626-105461648 CCATCCGGGCAGCAGCGCACAGG + Intronic
1124150665 15:27175167-27175189 CGAGCAGGGCAGAAGCCCTGGGG - Intronic
1124451264 15:29793563-29793585 TAATCAGGGCAGAAGGCAACAGG + Intronic
1125226234 15:37399433-37399455 CCATCATGGCAGAAGGCAAAGGG + Intergenic
1125508703 15:40281752-40281774 CCATCAGGGCCCCAGCCCGCAGG + Exonic
1125629246 15:41133850-41133872 CCATCTGTGCAGGACCCCACTGG + Intergenic
1126906397 15:53372327-53372349 CGATCATGGCAGAAGGCAACAGG - Intergenic
1127254838 15:57281043-57281065 CCATCAGATCAAAAACCCACTGG - Intronic
1128349737 15:66880941-66880963 CCACCAGGGCAGGTGCCCAGCGG - Intergenic
1128769177 15:70269085-70269107 CCAGGAGAGCAGAAGCCCTCGGG - Intergenic
1129259459 15:74356271-74356293 CCATCTGTGCAGGACCCCACTGG + Intronic
1129322340 15:74782211-74782233 CCACCCCGGCAGAAGCCCCCGGG - Exonic
1129702237 15:77774577-77774599 CCAGCAGGGCATGAGCCCAGTGG + Intronic
1130394935 15:83493650-83493672 CGCTCAGGGCAGGAGCTCACAGG - Intronic
1130648541 15:85748993-85749015 CCATGCGGGCAGCAGCACACAGG - Intronic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1132143858 15:99415290-99415312 CCATCAGGGCTGACCCCCAGAGG + Intergenic
1132295334 15:100730286-100730308 CCAGCAGGGCAGAACCACCCAGG - Intergenic
1132854475 16:2038690-2038712 CCAGCAGGGCACAGGCGCACAGG - Exonic
1135330180 16:21554216-21554238 CCAGCAGGGCTGGAGCCCACAGG + Intergenic
1136409864 16:30069945-30069967 CCTTCAGGGCAGAGGCCTGCAGG - Exonic
1137249620 16:46732313-46732335 GCAGCAGGGCAAAAGCCCAGGGG - Exonic
1137547655 16:49415624-49415646 CGCTCAGGGCAGAGGCCCAGAGG + Intergenic
1138166408 16:54805800-54805822 CCATCATGGCAGAAGGCGAAGGG + Intergenic
1138548302 16:57732870-57732892 CAATCATGGCAGAAGGCCAAAGG + Intergenic
1140217007 16:73016830-73016852 CCATTACAGCTGAAGCCCACTGG + Intronic
1141707376 16:85674491-85674513 CTATCAGGGCAAAATCTCACTGG + Exonic
1142043221 16:87908732-87908754 CCAGCAGGGCTGGAGCCCACAGG + Intronic
1142126807 16:88414511-88414533 CCGTGAGGGCAGAGGCCCCCAGG + Intergenic
1142408596 16:89904787-89904809 CCCTCAGGCCAGCAGCCCAGGGG + Intronic
1143838890 17:9714912-9714934 CCATCAGGCTGGAAGGCCACCGG + Intronic
1143954664 17:10658862-10658884 CCAACAGGGCAGAGCCCCAGGGG - Intergenic
1144289292 17:13809984-13810006 CCATCATGGCAGAAGGCGAAGGG - Intergenic
1144351795 17:14403650-14403672 CCATCATGGCAGAAGGCAAAGGG - Intergenic
1144439902 17:15272164-15272186 CCATCAGCTCAAAAGCCCACTGG + Intergenic
1147165441 17:38590841-38590863 CCATTAGGCCAGAGCCCCACAGG + Intronic
1149398082 17:56265287-56265309 CCATCATGGCAGAAGGCAAAGGG + Intronic
1149565882 17:57640126-57640148 ACATCAGGGCAGGAGGGCACTGG + Intronic
1150293536 17:63995718-63995740 CCACCTGGGCACAAGCCCACAGG + Intergenic
1151285755 17:73109864-73109886 GCATAAAGGCAGAAGCACACAGG + Intergenic
1151293256 17:73165375-73165397 CCATCAGCGCAGATGCACACAGG - Intronic
1152064578 17:78103642-78103664 CCACCATAGCAGAATCCCACAGG + Intronic
1152681514 17:81670726-81670748 CCCTCAGGGCTGATTCCCACAGG - Intronic
1152753594 17:82077767-82077789 CCATAAGGGCAGCACCCCACGGG - Intergenic
1152753769 17:82078531-82078553 GCATAAGGGCAGCACCCCACGGG + Exonic
1152904543 17:82963071-82963093 GCATCAGGGAAGAAGCCGAGTGG + Intronic
1154261390 18:12836268-12836290 GCAACTGGGCAGAAGGCCACAGG + Intronic
1155173843 18:23286383-23286405 CCATCTGTGCAGGACCCCACTGG + Intronic
1155808351 18:30200824-30200846 CAATCATGGCAGAAGGCCAAGGG + Intergenic
1156046671 18:32885229-32885251 CAATCATGGCAGAAGGCAACGGG - Intergenic
1156391246 18:36652583-36652605 GCCTCAGGGCAGAGCCCCACTGG + Exonic
1156458102 18:37306037-37306059 CCATCAGGGCAGAAGCCCACTGG - Intronic
1158394620 18:57069993-57070015 CCATCTGTGCAGGACCCCACTGG - Intergenic
1159372312 18:67544527-67544549 CAATCATGGCAGAAGCCCAAGGG + Intergenic
1159838945 18:73373647-73373669 CAATCATGGCAGAAGACCAAGGG - Intergenic
1159929238 18:74294775-74294797 CCATCTGTGCAGGACCCCACTGG + Intergenic
1159966659 18:74601603-74601625 CCATCATGGCAGAAGGCAAACGG + Intronic
1160509748 18:79446807-79446829 CCATGTGCGCAGATGCCCACAGG - Intronic
1160729189 19:632992-633014 CCATAAAGGCAGAAGCCGAAGGG + Intronic
1161168198 19:2799878-2799900 CCTTCAGCACAGAAGCCCACAGG - Intronic
1161712065 19:5854453-5854475 CCATCTGTGCAGGACCCCACTGG + Intergenic
1161980877 19:7629764-7629786 CCAGCAAGACAGAAGCTCACTGG - Exonic
1162337890 19:10072932-10072954 CCATCCCTGCAGAAGCCCAGTGG + Intergenic
1163710031 19:18840877-18840899 CCATCCTGGCAAAGGCCCACGGG - Intronic
1163712713 19:18856329-18856351 CCATCAGGCCGCCAGCCCACAGG - Intronic
1164004065 19:21133142-21133164 CCATCTGAGCAGGACCCCACTGG - Intergenic
1164258788 19:23551607-23551629 CCATCTGTGCAGGACCCCACTGG + Intronic
1165496983 19:36158784-36158806 CCATCTGTGCAGGACCCCACTGG - Intergenic
1165510296 19:36262850-36262872 CCATCTGTGCAGGAACCCACTGG - Intergenic
1165835383 19:38751954-38751976 CCATCTGTGCAGGACCCCACTGG + Intronic
1166116603 19:40659563-40659585 CAGTCAAGGCAGAAGCACACTGG - Intergenic
1166137769 19:40787599-40787621 CCAGCAGGGGAGAGGCCCAGGGG + Intronic
1166486847 19:43221181-43221203 CCATGAGACCACAAGCCCACTGG - Intronic
1168248164 19:55124884-55124906 CCATCTGTGCAGGACCCCACTGG + Intergenic
1168465494 19:56598052-56598074 CCATGAGAACAGAAGCCCCCAGG - Intronic
1168720826 19:58554209-58554231 CCATGATGGTAGAAGCTCACTGG + Exonic
925216261 2:2098229-2098251 CCATGAGGAAAGAAGCCTACAGG - Intronic
925433832 2:3819270-3819292 CCATCTGTGCAGGACCCCACTGG - Intronic
926487122 2:13475640-13475662 CAATCATGGCAGAAGGCCAAGGG + Intergenic
926892874 2:17653092-17653114 CCATCAGGGCTGGGGACCACAGG + Intronic
928836673 2:35555789-35555811 CAATCATGGCAGAAGGCCAAGGG + Intergenic
930099059 2:47589034-47589056 CCATCTGTGCAGGACCCCACTGG - Intergenic
930489991 2:52057562-52057584 CAATCATGGCAGAAGGCCGCAGG - Intergenic
931850447 2:66246275-66246297 CCATCTGTGCAGGACCCCACTGG + Intergenic
931948281 2:67333941-67333963 CCATCTGTGCAGGACCCCACTGG + Intergenic
932656588 2:73615950-73615972 CAATCATGGCAGAAGGCAACCGG - Intergenic
934050726 2:88208512-88208534 CCATCATGGCAGAAGGCAAGCGG + Intergenic
934141286 2:89050263-89050285 CCATCTGTGCAGGACCCCACTGG + Intergenic
934756007 2:96825275-96825297 CCAGCAGCACAGAGGCCCACTGG - Intronic
934962162 2:98685867-98685889 CCATGAGCGGAGAAGCCCAGAGG + Intronic
935133188 2:100276827-100276849 CCCTCAGGGCAGAAGGCAAACGG - Exonic
935151758 2:100443263-100443285 CCATCATGGCAGAAGGCAAAGGG - Intergenic
936386022 2:112030086-112030108 CCATCATGGCAGAAGGCAAAAGG + Intergenic
936402390 2:112175333-112175355 CAATGTGGGCAGATGCCCACAGG + Intronic
936548310 2:113412046-113412068 CCAGCAGGGCAGAGGCCAGCAGG + Intergenic
936690744 2:114885209-114885231 CAATCACGGCAGAAGCCAAAGGG + Intronic
936703418 2:115040799-115040821 CAATCATGGCAGAAGGCGACAGG - Intronic
936787974 2:116118433-116118455 CAATCAGGGCAGAAGGCAAAGGG + Intergenic
937097054 2:119242297-119242319 CCATCAGGGCAAAACTCCCCGGG + Intronic
937910221 2:127072058-127072080 CCTTCAGGGCAGGAGGCGACTGG - Intronic
939787537 2:146536260-146536282 CAATCATGGCAGAAGACGACGGG + Intergenic
940675779 2:156723435-156723457 CCATCCGTGCAGGACCCCACTGG - Intergenic
940986985 2:160060790-160060812 AGAACAGGGCAGCAGCCCACAGG - Intronic
941935868 2:170981005-170981027 CCATCTGTGCAGGACCCCACTGG - Intergenic
943602880 2:189942317-189942339 CCATCATGGCAGAAGGCAAAGGG - Intronic
944251058 2:197580457-197580479 CCATCTGTGCAGGACCCCACTGG + Intronic
946521143 2:220466044-220466066 CAATCATGGCAGAAGCCGAAAGG - Intergenic
948751726 2:240136891-240136913 CCTTCCGGGCACAAGCCCAGAGG + Intergenic
948868789 2:240788050-240788072 CCAGCAGGGCATCATCCCACAGG - Exonic
949006688 2:241653446-241653468 CCCACAGGCCACAAGCCCACTGG - Intronic
1169357995 20:4924147-4924169 CCATCAGGACACAGCCCCACAGG + Intronic
1170751797 20:19154957-19154979 CCATCATGGCAGAAGGCAAAAGG + Intergenic
1171051665 20:21865140-21865162 CTTTCAGGCCAGAAACCCACTGG - Intergenic
1171515267 20:25726987-25727009 CAATCATGGCAGAAGGCCAAGGG + Intergenic
1171520201 20:25770078-25770100 CCAAAAGGGCAGAGGCCCCCAGG + Intronic
1171556718 20:26086415-26086437 CCAAAAGGGCAGAGGCCCCCAGG - Intergenic
1172212926 20:33213655-33213677 CCATGAGGGCAAAGGCCCTCAGG - Intergenic
1173823069 20:46030944-46030966 CCCTCCGGCCAGAAGCCCGCGGG - Intronic
1174401242 20:50277112-50277134 CACTCAGAGCAGAAGCCCACAGG + Intergenic
1175806583 20:61832542-61832564 CAATCAGGGCAGAAGGCGAAGGG + Intronic
1176383796 21:6127112-6127134 CCACCAGGGAAGAAGCACCCTGG + Intergenic
1176654331 21:9576364-9576386 CCAAAAGGGCAGAGGCCCCCAGG + Intergenic
1177411782 21:20738950-20738972 CCATCAGGGCAGAAGGCAAAAGG - Intergenic
1178374880 21:32058495-32058517 CCATCTGGGCAGAAGTGCAATGG - Intergenic
1178945216 21:36941296-36941318 CCATCATGGCAGAAGGCAAAGGG - Intronic
1179272961 21:39865763-39865785 CCAACAGGGCAGGAGGCCCCTGG + Intergenic
1179432503 21:41333506-41333528 CAATCATGGCAGAAGCCAAAGGG - Intronic
1179448753 21:41453111-41453133 CCATCACGGCAGAAGGCAATGGG + Intronic
1179550247 21:42139291-42139313 CAATCATGGCAGAAGACCAAGGG + Intronic
1181176783 22:21042342-21042364 AGATCAGGGCAGATGCCCAGAGG - Intergenic
1182184093 22:28384052-28384074 CCATTGGGGTAAAAGCCCACAGG - Intronic
1182995507 22:34808426-34808448 CAATCAAGGCAGAAGCCAAAAGG - Intergenic
1182998186 22:34833466-34833488 CTCTCATGGCAGAAGCACACAGG + Intergenic
1184296840 22:43530358-43530380 ACATCAGGGCAGATGCCCAATGG + Intronic
1184574561 22:45352400-45352422 ATATCAGGGCAGAAGCCAAGGGG - Intronic
949162071 3:894035-894057 CCATCTGTGCAGGAACCCACTGG - Intergenic
951888956 3:27551495-27551517 CCATCTGTGCAGGACCCCACTGG - Intergenic
952343537 3:32464776-32464798 CCATCTGTGCAGGACCCCACTGG - Intronic
953177215 3:40563323-40563345 CCATCTGTGCAGGACCCCACTGG + Intronic
953483582 3:43273653-43273675 CCATCAGGGCAGGAGGACAGGGG + Intergenic
954165814 3:48756987-48757009 ATAGCAGGGCAGAAACCCACAGG - Intronic
954327207 3:49870000-49870022 CCTTAAGGGCAGAATCCCACTGG + Exonic
954655980 3:52194608-52194630 CCTTCAGGGCAGAGGCCTGCAGG - Intergenic
954719387 3:52548132-52548154 CCACCATGGCAGATGCCCTCTGG - Exonic
954755146 3:52835175-52835197 TCATCAGGGCTGCAGCCCCCAGG - Exonic
954875211 3:53798806-53798828 CCATCAGGGCTGGGTCCCACTGG - Intronic
955104639 3:55885411-55885433 GTCCCAGGGCAGAAGCCCACAGG + Intronic
955878556 3:63520287-63520309 CAATCAGGACTGAAGCCAACTGG - Intronic
956233477 3:67042047-67042069 CCATCTGTGCAGGACCCCACTGG - Intergenic
956548968 3:70438229-70438251 CCATCTGTGCAGGACCCCACTGG - Intergenic
958186958 3:90134297-90134319 ACACAAGGGCAGAAGCCAACAGG - Intergenic
958421979 3:93940144-93940166 CCATCTGTGCAGAACCCCACTGG + Intronic
959565928 3:107833292-107833314 TGATCAGGGCAGAATCCCAGGGG + Intergenic
959601426 3:108190539-108190561 CAATCATGGCAGAAGGCCAAGGG - Intronic
959814858 3:110663082-110663104 CAATCATGGCAGAAGGCCAAGGG - Intergenic
961189503 3:124946200-124946222 GCATCAGGGCAGGAGCTCAGAGG - Intronic
961881068 3:130061616-130061638 CCATCTGTGCGGAACCCCACTGG + Intergenic
962022166 3:131512474-131512496 CCATCTGTGCAGGACCCCACTGG - Intergenic
962083380 3:132164673-132164695 CAATGAGGGCAGAGGTCCACTGG + Intronic
963908966 3:150798717-150798739 CAATCTGGGGAGAAGTCCACGGG + Intergenic
965336351 3:167433558-167433580 CCATCTGTGCAGGACCCCACTGG + Intergenic
965813888 3:172617463-172617485 CAATCATGGCAGAAGGCCAAGGG + Intergenic
965861947 3:173159275-173159297 CCATCTGTGCAGGACCCCACTGG - Intergenic
966549569 3:181189543-181189565 TCATCAGGGAAGCAGCACACAGG + Intergenic
967643809 3:191898736-191898758 CCATCTGTGCAGGACCCCACTGG - Intergenic
967866201 3:194192072-194192094 CAATCATGGCAGAAGGCCAAGGG - Intergenic
968520521 4:1032864-1032886 GCATCAGGGCAGATTCCCACCGG - Intergenic
968808091 4:2788029-2788051 GCAGCTGGCCAGAAGCCCACAGG + Intergenic
970087566 4:12366105-12366127 CCATCTGTGCAGGACCCCACTGG + Intergenic
970276176 4:14403615-14403637 CCATCATGGCAGAAGGGCAAAGG + Intergenic
970813051 4:20118325-20118347 CAATCAGGGCAGAAGGCAAAGGG + Intergenic
976823678 4:89235337-89235359 CAATCATGGCAGAAGCCAAAGGG - Intergenic
978018062 4:103772999-103773021 CAATCAGGGCAGAAGGCAAAGGG - Intergenic
978240121 4:106505077-106505099 CAATCATGGCAGAAGGCGACGGG - Intergenic
979235911 4:118399979-118400001 CAAACAGGGCAGAAGGCCGCAGG - Intergenic
979236141 4:118402511-118402533 CAATCATGGCAGAAGGCCAAGGG + Intergenic
979895139 4:126148507-126148529 CCATCTGTGCAGGACCCCACTGG - Intergenic
979916884 4:126446261-126446283 CCATCATGGCAGAAGGCAAAGGG - Intergenic
980284970 4:130769700-130769722 CCATCTGTGCAGGACCCCACTGG + Intergenic
980903959 4:138930211-138930233 CCATCTGTGCAGGACCCCACTGG + Intergenic
981491953 4:145348918-145348940 CAATCATGGCAGAAGCCAAGTGG - Intergenic
981593489 4:146391858-146391880 ACATTAAGGCAAAAGCCCACTGG + Intronic
981756094 4:148142950-148142972 CCATCATGGCAGAAGCTGAAGGG - Intronic
982795802 4:159642190-159642212 CAATCATGGCAGAAGGCCAAGGG + Intergenic
983659593 4:170118794-170118816 CCATCTGTGCAGGACCCCACTGG + Intergenic
983707695 4:170679832-170679854 CCATCTGTGCAGGACCCCACTGG + Intergenic
984460334 4:180028246-180028268 CCATCAGGGCAAAAGCTCACAGG + Intergenic
985887201 5:2688861-2688883 GCGTCTGGGCGGAAGCCCACAGG + Intergenic
986555020 5:9001916-9001938 CCATCTGTGCAGGACCCCACTGG - Intergenic
991022019 5:61989214-61989236 CCATCAGGGCTGAACACCCCAGG + Intergenic
993836726 5:92826315-92826337 CCATCTGTGCAGGACCCCACTGG + Intergenic
994324897 5:98436906-98436928 CCATCTGTGCAGGACCCCACTGG + Intergenic
996528097 5:124499538-124499560 CCATCACCTCAGAAGCCTACAGG + Intergenic
997235446 5:132269626-132269648 TACTCAGGGCAGAACCCCACAGG + Intronic
998382052 5:141732591-141732613 CCTTGAGGGCAGGAGACCACAGG + Intergenic
998423063 5:142005101-142005123 CCATCAGGGCCGATGCCTATAGG + Exonic
1000606954 5:163336364-163336386 CCATCTGTGCAGGACCCCACTGG + Intergenic
1000883351 5:166721952-166721974 CAATCATGGCAGAAGCCAAAAGG + Intergenic
1001198005 5:169691099-169691121 CCATCATGGCAGAAGGCAAAGGG + Intronic
1001871494 5:175159872-175159894 GCTTCAAGGAAGAAGCCCACAGG - Intergenic
1002018092 5:176341966-176341988 CCAGCAGGGCTGAAGTCCACTGG + Intronic
1002433609 5:179218478-179218500 CCATCAGCACAGAGCCCCACTGG + Intronic
1002710959 5:181194860-181194882 CAGTCAGGGCAGAAGCCCCCTGG + Exonic
1004837025 6:19541244-19541266 CCATCTGTGCAGGACCCCACTGG + Intergenic
1005679323 6:28190043-28190065 CCATCATGGCTAAAGCCCAGGGG + Intergenic
1005927685 6:30457418-30457440 CCATCATGGCAGAAGGCAATAGG + Intergenic
1005958247 6:30679425-30679447 TCAGCAGGGGAGAAGCCCGCGGG + Intronic
1006439722 6:34046523-34046545 CCAGCAGGACGGAACCCCACAGG - Intronic
1006629134 6:35418807-35418829 CCAGGAGGGGAGCAGCCCACTGG + Intronic
1007360956 6:41355280-41355302 CAATCAGGGCAGAAGACAAAGGG - Intergenic
1007415373 6:41688414-41688436 CCACCAGGGCACAAGCAGACAGG + Intronic
1009786650 6:68349058-68349080 ATATAAGGGCAGAACCCCACAGG - Intergenic
1012187043 6:96231855-96231877 CAATCATGGCAGAAGCCAAAAGG + Intergenic
1014396086 6:120927529-120927551 CCATCTGTGCAGGACCCCACTGG + Intergenic
1014520849 6:122440059-122440081 CAATGATGGCAGAAGCCAACAGG - Intergenic
1014612107 6:123558981-123559003 CCATCTGTGCAGGACCCCACTGG + Intronic
1015165239 6:130194683-130194705 CCATCTGTGCAGGACCCCACTGG + Intronic
1015468561 6:133576228-133576250 CAATCATGGCAGAAGGCAACGGG - Intergenic
1016204558 6:141455169-141455191 CCATCTGTGCAGGACCCCACTGG + Intergenic
1017047127 6:150357161-150357183 CAATCATGGCAGAAGGCGACGGG - Intergenic
1017995801 6:159530805-159530827 CCATCATGGCAGCATCTCACAGG + Intergenic
1018016081 6:159713537-159713559 CTTTCAGGGCAGAAGCACAGGGG - Intronic
1018040746 6:159919703-159919725 CCCTCAGGGCACAGGACCACGGG - Intergenic
1018077618 6:160230833-160230855 CCATCTGTGCAGGACCCCACTGG + Intronic
1018473905 6:164121880-164121902 CCATCACGGCAGAAGGCAAAAGG + Intergenic
1018521448 6:164655522-164655544 CCATCTGTGCAGGAACCCACTGG - Intergenic
1018692388 6:166357999-166358021 CCATCATGGCAGAAGGCAAAAGG + Intergenic
1018854898 6:167668226-167668248 AGATGAGGGCAGAAGGCCACTGG - Intergenic
1018854906 6:167668293-167668315 GGATGAGGGCAGAAGGCCACTGG - Intergenic
1018854916 6:167668360-167668382 AGATGAGGGCAGAAGGCCACTGG - Intergenic
1019533737 7:1516861-1516883 CCTGCAGGACAGAAGCCCCCGGG - Intergenic
1020067451 7:5199822-5199844 AGATCAGGGCAGACGGCCACAGG - Intronic
1020406028 7:7834887-7834909 CAATCAGGGCAGAAGGCGAAGGG + Intronic
1021087577 7:16440780-16440802 CTATCATGGCAGAAGGCCAAAGG - Intergenic
1021660646 7:22915458-22915480 CCATCTGTGCAGGACCCCACTGG + Intergenic
1022447424 7:30481571-30481593 CCATCTGTGCAGGACCCCACTGG + Intergenic
1023407034 7:39844056-39844078 CAATCATGGCAGAAGCCGAAGGG - Intergenic
1024060247 7:45692174-45692196 CCATCAGGCCCCATGCCCACTGG + Intronic
1024254299 7:47528327-47528349 CTAACAGCACAGAAGCCCACAGG + Intronic
1024802311 7:53094420-53094442 ACATCAGTTCAGAGGCCCACAGG - Intergenic
1025280695 7:57625032-57625054 CCAAAAGGGCAGAGGCCCCCAGG + Intergenic
1025304035 7:57840475-57840497 CCAAAAGGGCAGAGGCCCCCAGG - Intergenic
1026295826 7:69051534-69051556 CAATCATGGCAGAAGGCGACAGG + Intergenic
1026836762 7:73644869-73644891 CCATCAGGGCATCAGGCCCCTGG + Intergenic
1027516330 7:79146868-79146890 CCATCAGGGCAGAGTTACACTGG - Intronic
1029144847 7:98438599-98438621 CAATCATGGCAGAAGGCAACAGG - Intergenic
1029867347 7:103648336-103648358 CAATCATGGCAGAAGGCCAAAGG - Intronic
1030097330 7:105911953-105911975 CAATCAGGGCTGAAAACCACTGG - Intronic
1030163588 7:106531772-106531794 CCATCTGTGCAGGACCCCACTGG - Intergenic
1030445760 7:109645489-109645511 CCATCTGTGCAGGACCCCACTGG - Intergenic
1030879365 7:114858015-114858037 CCATCAGTGCAGAATTCCAATGG - Intergenic
1033625608 7:143107161-143107183 CCATCTGTGCAGGACCCCACTGG + Intergenic
1034127247 7:148684526-148684548 CCAGCAGGGCAGAAGGCCTTGGG + Intergenic
1035672622 8:1431907-1431929 CCATCAGGGCTGAACCCTGCCGG + Intergenic
1035971220 8:4251548-4251570 TAATCAGGGCAGTATCCCACAGG + Intronic
1037029984 8:14092716-14092738 CCATCATGGCAGAAGGCAAAAGG - Intronic
1037767881 8:21782966-21782988 CCAGCAGGGCCCAAGCCCCCAGG - Intronic
1037915433 8:22770116-22770138 CCCTCTGGGTGGAAGCCCACAGG + Intronic
1038149036 8:24925918-24925940 CAATCATGGCAGAAGGCAACGGG - Intergenic
1038956933 8:32478245-32478267 CCCACATGGAAGAAGCCCACTGG - Intronic
1039449627 8:37661636-37661658 CCCTCAGTGCAGAAACCCATAGG + Intergenic
1043214699 8:77570821-77570843 CCATCATGGCAGAAGGCAAAGGG + Intergenic
1044923487 8:97189345-97189367 CAATCATGGCAGAAGGCCAAGGG + Intergenic
1046309333 8:112414431-112414453 CAATCATGGCAGAAGGCAACGGG - Intronic
1047418109 8:124682434-124682456 CCATCAGTGCACAAGGCCACAGG + Intronic
1049476037 8:142797423-142797445 TCACCAGGGCAGGAGCCCAAGGG + Intergenic
1050117202 9:2275262-2275284 CCAACAGGGCTGAAGCCTAATGG - Intergenic
1050616441 9:7406149-7406171 CAATCAGGGCAGAAGGCAAAGGG - Intergenic
1051546058 9:18276658-18276680 CAATCAGGGCAGAAGGCAAAGGG + Intergenic
1053727253 9:41016741-41016763 CCAGCAGGGCAGAGGCCAGCAGG - Intergenic
1054701263 9:68415371-68415393 CCAGCAGGGCAGAGGCCAGCAGG + Intronic
1054807466 9:69408123-69408145 CCATCTGTGCAGGACCCCACTGG - Intergenic
1055619296 9:78107186-78107208 CAATCAGGGCAGAAGGCAAAGGG - Intergenic
1055881768 9:81011347-81011369 CCATCTGTGCAGGACCCCACTGG + Intergenic
1056007999 9:82294409-82294431 CAATCAGGGCAGAAGGCAAAAGG + Intergenic
1057378012 9:94542167-94542189 CCATCTGTGCAGGACCCCACTGG + Intergenic
1058329473 9:103741050-103741072 CAATCAGGGCAGAAGGCAAGAGG + Intergenic
1059574641 9:115475699-115475721 CCATCTGTGCAGGACCCCACTGG + Intergenic
1059738018 9:117121785-117121807 CAATCATGGCAGAAGCCGATGGG + Intronic
1060274351 9:122171211-122171233 CCGTCAGGGCAGAAGCCTCCAGG + Intronic
1060768327 9:126311648-126311670 CCATCATGGCAGAAGGCAAAAGG + Intergenic
1061873769 9:133534122-133534144 CCATCTGGTCAGCAGGCCACGGG + Intronic
1061995587 9:134181221-134181243 GGCTCAGGGCAGCAGCCCACGGG + Intergenic
1062071373 9:134556745-134556767 CCATCTGGGCTGCAGTCCACAGG - Intergenic
1203632052 Un_KI270750v1:79822-79844 CCAAAAGGGCAGAGGCCCCCAGG + Intergenic
1186663284 X:11691582-11691604 CAATCATGGCAGAAGGCCAAAGG + Intergenic
1187114405 X:16334415-16334437 CAATCATGGCAGAAGGCCATGGG + Intergenic
1188463354 X:30452464-30452486 CCATCTGTGCAGGACCCCACTGG - Intergenic
1188766551 X:34099897-34099919 CCTTCAGTGGAGAAGCCCTCTGG - Intergenic
1189957020 X:46286448-46286470 CCATCATGGCAGAAGGCAAAGGG - Intergenic
1190109731 X:47582304-47582326 CCATCAGTGCAGAAGCCAAGGGG - Exonic
1190113978 X:47613746-47613768 CCATCAGGCCAGCAGCTCCCGGG - Intronic
1190703419 X:53005399-53005421 CAATCATGGCAGAAGGCAACGGG + Intergenic
1190703762 X:53007992-53008014 CAATCATGGCAGAAGGCAACAGG + Intergenic
1191014172 X:55791676-55791698 CCATCTGTGCAGGACCCCACTGG - Intergenic
1192454615 X:71266523-71266545 CCATCTGTGCAGGACCCCACTGG + Intergenic
1193175705 X:78389692-78389714 CCATCATGGCAGAAGGCAAAAGG + Intergenic
1194308521 X:92276428-92276450 CCATCTGTGCAGGACCCCACTGG - Intronic
1194367127 X:93025274-93025296 CCATCTGTGCAGGACCCCACTGG + Intergenic
1194400564 X:93434582-93434604 CCACCAAGGTGGAAGCCCACTGG - Intergenic
1195964053 X:110414149-110414171 CCATCTGGGCATAAGCACAGAGG - Intronic
1196798637 X:119522717-119522739 GCTTCAGAGCAGAAGCCAACAGG + Intergenic
1196812885 X:119642737-119642759 CCTTCAGAGCAGAAGAACACAGG + Intronic
1199112698 X:143954287-143954309 CAATCATGGCAGAAGGCAACGGG - Intergenic
1200007783 X:153099234-153099256 CCATCATCTCAGAAGCCCCCTGG - Intergenic
1200675340 Y:6141530-6141552 CCATCTGTGCAGGACCCCACTGG + Intergenic
1201307484 Y:12563297-12563319 CCATCTGTGCAGGACCCCACTGG - Intergenic
1201853979 Y:18520713-18520735 CCATCTTGCCAGATGCCCACTGG - Intergenic
1201879342 Y:18799671-18799693 CCATCTTGCCAGATGCCCACTGG + Intronic