ID: 1156460053

View in Genome Browser
Species Human (GRCh38)
Location 18:37316546-37316568
Sequence GGCTTGTCACCATTGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156460053_1156460058 2 Left 1156460053 18:37316546-37316568 CCTGCTTCCAATGGTGACAAGCC 0: 1
1: 0
2: 0
3: 6
4: 119
Right 1156460058 18:37316571-37316593 ACCCCTTGGCCTTGTGTTCGAGG 0: 1
1: 0
2: 0
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156460053 Original CRISPR GGCTTGTCACCATTGGAAGC AGG (reversed) Intronic
900266175 1:1758331-1758353 CGCTTGTGACCTTCGGAAGCTGG + Intronic
900997255 1:6129291-6129313 AGCTTCTAGCCATTGGAAGCAGG + Intronic
901625835 1:10624514-10624536 GGCTTGCCACCTTCGGGAGCTGG + Intronic
902074225 1:13769914-13769936 GGATTGTCACAATTAGAAGGGGG + Intronic
906160417 1:43644601-43644623 GACTTGCCACCAATGGCAGCAGG - Intergenic
911018801 1:93365465-93365487 GGGTTGTCACAACTGGAAGTAGG - Exonic
913449976 1:118986633-118986655 GGCTTGTCAGCGTGTGAAGCGGG + Intronic
915575461 1:156773392-156773414 GTCTTGTCACTCTTGGCAGCTGG + Intronic
918472634 1:184889959-184889981 TGTTTGTCACAATTGGAATCGGG - Intronic
920711181 1:208296489-208296511 GGATGGTCACCAGTGGCAGCTGG - Intergenic
921409057 1:214815121-214815143 GGCATGTCACCACTGGAGTCTGG + Intergenic
1064534709 10:16346687-16346709 GGCTTATCAGCATTTGAACCAGG + Intergenic
1066746196 10:38605311-38605333 GGTTTGGCACCAGTGGGAGCCGG - Intergenic
1068825155 10:61429027-61429049 GGCTTCTACCCATTGGAGGCGGG - Exonic
1069249876 10:66254987-66255009 GACTTGCCACCCTTGGAAGGGGG - Intronic
1069753153 10:70757731-70757753 GGCTCTTCACCATTGGTATCAGG + Intronic
1069827804 10:71265018-71265040 GGGTTGTCAGCATTTGAATCTGG - Intronic
1071505680 10:86230103-86230125 GGCTGGTCACCATAGGCAGGAGG - Intronic
1071949106 10:90682738-90682760 TGCTTAACACCACTGGAAGCAGG + Intergenic
1072177917 10:92947288-92947310 TCCTTGTCACCATGGGAAGGAGG + Intronic
1072469028 10:95694308-95694330 GGTTTCTCACCGTTGGAATCCGG - Intergenic
1074248213 10:111714922-111714944 GGCTCTTCACCATTTGAACCTGG - Intergenic
1075571246 10:123547836-123547858 GGCTTGTCACCATGCAAAGGAGG - Intergenic
1076720257 10:132389324-132389346 CCCTTGTCACTGTTGGAAGCTGG + Intergenic
1077523281 11:3048937-3048959 CGCATGTCACCATTGGGAGGAGG + Intronic
1078270133 11:9787547-9787569 GTCTTGTCACCTGTGGCAGCAGG + Intronic
1079852310 11:25551169-25551191 TGTTGGACACCATTGGAAGCTGG + Intergenic
1080200972 11:29669514-29669536 GGCAGGTCTCCCTTGGAAGCAGG - Intergenic
1080379761 11:31756177-31756199 GGCTGGGCAACACTGGAAGCAGG - Intronic
1089292152 11:117443876-117443898 GGCTTCTCACCCTTGCCAGCAGG + Exonic
1089807031 11:121099635-121099657 GGCTTATCACTTTGGGAAGCTGG - Intergenic
1091657208 12:2354364-2354386 GGCTTATCACCACTCCAAGCAGG - Intronic
1093407711 12:18825355-18825377 GCCTTGTCACCATTGACAGTTGG + Intergenic
1094739730 12:33275102-33275124 GCCTTGTCACCTCTGGAAGCAGG - Intergenic
1103213574 12:119184444-119184466 GGCCTGTCCCCAGGGGAAGCAGG + Intronic
1105339275 13:19504624-19504646 GTCTTGTCACCCTTAGTAGCAGG - Intronic
1113866651 13:113530943-113530965 GACTGGGCACCATTAGAAGCTGG + Intronic
1119667561 14:76496232-76496254 GTCTTATCTCCCTTGGAAGCAGG - Intronic
1120929750 14:89836525-89836547 GGCTCTTCACCATGGGGAGCAGG + Intronic
1124870967 15:33542147-33542169 GGTTTCTCACCAGTGGATGCTGG - Intronic
1125236486 15:37520148-37520170 GGCTTGGCCACATTAGAAGCAGG + Intergenic
1125517750 15:40332190-40332212 AGCTTGGCATCATGGGAAGCTGG - Intronic
1129550680 15:76445670-76445692 GGCTTGTTACCACAGGAAGCTGG + Intronic
1135141079 16:19922516-19922538 GGCCTGTCTCCCATGGAAGCTGG - Intergenic
1135855434 16:26005910-26005932 TGTTTGTCACAATTGGGAGCAGG - Intronic
1136736861 16:32474330-32474352 GGTTTGACACCAGTGGGAGCCGG + Intergenic
1138195151 16:55046460-55046482 GGCTGGACACAATTGAAAGCTGG - Intergenic
1142157386 16:88538818-88538840 GGCCTGTCTCCTTTGAAAGCTGG + Intergenic
1203016208 16_KI270728v1_random:355247-355269 GGTTTGACACCAGTGGGAGCCGG - Intergenic
1203034543 16_KI270728v1_random:628405-628427 GGTTTGACACCAGTGGGAGCCGG - Intergenic
1151352535 17:73540161-73540183 GGGCTGTCCCCACTGGAAGCTGG + Intronic
1152290045 17:79435202-79435224 TGCTGGTCACCAGAGGAAGCTGG + Intronic
1156030559 18:32707691-32707713 GTGTTGTCACCATTCGATGCTGG + Intronic
1156460053 18:37316546-37316568 GGCTTGTCACCATTGGAAGCAGG - Intronic
1164984179 19:32636231-32636253 GGCTTATCACAGTTGGATGCAGG - Intronic
925222470 2:2153213-2153235 GGCTTGTGACCAGGGGAAGGAGG + Intronic
926986680 2:18632070-18632092 TGCTTGTCACCATGTGAAGAAGG + Intergenic
927710704 2:25324091-25324113 GGCTTGTCTGCAGTGGGAGCGGG + Intronic
928193755 2:29197574-29197596 AGTTTGTCACCAGTGGAGGCCGG - Exonic
931807680 2:65823594-65823616 GGCTTGACACAATTGACAGCCGG + Intergenic
940154800 2:150644290-150644312 GGCTTCTCTCCACTGGAAGTAGG + Intergenic
940200709 2:151147085-151147107 GGCTTGTTAGCATTTTAAGCAGG - Intergenic
943297995 2:186161956-186161978 GCCCTGTCACCATGTGAAGCAGG + Intergenic
943760132 2:191599056-191599078 GTCTTAGCACCATTGTAAGCAGG + Intergenic
945976843 2:216277638-216277660 GGTTTGTCTCCATGGGAAGTGGG - Intronic
948166668 2:235867845-235867867 GGAATGTCATCATTGGAAACTGG - Intronic
1169927000 20:10793926-10793948 GGCTTGTCTCCTTTGTGAGCCGG + Intergenic
1173229586 20:41183693-41183715 GGCTTGGCACTCTGGGAAGCAGG + Exonic
1173875320 20:46366828-46366850 GTCTTGGCACCATATGAAGCTGG + Exonic
1176734866 21:10536790-10536812 GTCTTGTCACCCTTAGTAGCAGG + Intronic
1177998607 21:28132957-28132979 GGCTTACCACCACTGGAATCTGG + Intergenic
1178783199 21:35626019-35626041 TGCTTGACACTATTGGGAGCTGG - Intronic
1180535687 22:16391582-16391604 GGTTTGGCACCAGTGGGAGCCGG - Intergenic
1180562599 22:16632254-16632276 GTCTTGTCACCCTTAGTAGCAGG + Intergenic
1184614128 22:45626375-45626397 GGCTTGTCTCCACTGGAATCGGG - Intergenic
950689248 3:14642629-14642651 TGGTTGTCACCACTGGAAGTAGG + Intergenic
952722251 3:36545476-36545498 GGCCTGTCATCCATGGAAGCAGG + Intronic
953666234 3:44928392-44928414 GGGTAGTCAGCATTAGAAGCGGG - Intronic
954296617 3:49677788-49677810 GGGCTGTCACCATAGGGAGCGGG + Intronic
956072317 3:65466604-65466626 GGCTCTTCACCATTGGATGGGGG + Intronic
958177775 3:90018439-90018461 GGCTTGTCAAAATTGGGAGATGG + Intergenic
958889067 3:99763147-99763169 GGCTTTGGACCATTGGAAACTGG - Intronic
969278625 4:6154089-6154111 GCCTTCTCACCATAGGCAGCAGG - Intronic
970829843 4:20324224-20324246 GGGTTGTCAACATAGCAAGCTGG - Intronic
974848182 4:67376632-67376654 GGCTTTTCACCATGAGAACCTGG - Intergenic
975485297 4:74928654-74928676 CTCTTGACACCATTGCAAGCAGG - Intergenic
976309640 4:83598110-83598132 AGCTGGTCATCATTCGAAGCAGG - Exonic
978232234 4:106413955-106413977 AGCTTGTCACCATAGGAATGTGG - Intergenic
985209729 4:187579863-187579885 GGCATGATAACATTGGAAGCAGG - Intergenic
990297131 5:54413608-54413630 GGCATGACACGATTGGAGGCTGG - Intergenic
990893209 5:60670598-60670620 AGCTTGTCTCCATTGAAATCAGG - Intronic
992767963 5:80020150-80020172 GGCTTTTCAGCCTTGGAAGAGGG - Intronic
992993691 5:82311651-82311673 TGCTTGTCCACATTGGAAACTGG + Intronic
996998561 5:129728948-129728970 GACTTGTCACAACTGTAAGCTGG + Intronic
999327491 5:150652064-150652086 GGCTTGTCTCCATGGGAACAGGG + Exonic
999639511 5:153658102-153658124 GGCCTGTCACCAAGGGTAGCAGG + Intronic
1003271415 6:4611040-4611062 GGCCTGGCATGATTGGAAGCAGG - Intergenic
1005671704 6:28112850-28112872 GTCTTGTCACCAGGGGAACCTGG - Intergenic
1006426063 6:33963629-33963651 CCCTTGTCACCAAAGGAAGCTGG - Intergenic
1007783688 6:44268489-44268511 GGCTGGTCACCATGGAAACCAGG - Intergenic
1014439100 6:121453092-121453114 GGCATGTCAGAATTGGCAGCTGG + Intergenic
1014987749 6:128032676-128032698 GGCCTTTCATCCTTGGAAGCTGG - Intronic
1015053018 6:128864479-128864501 GGCAGGTCATCATGGGAAGCTGG + Intergenic
1018638932 6:165889428-165889450 GGCTTTTCCCCTTTGGAAGCTGG - Intronic
1024326988 7:48116502-48116524 GGCTGGTCACCAGTGGATGTAGG + Intergenic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1028604385 7:92639748-92639770 AGCCTGGCACCATTGGAAGCTGG + Intronic
1033040087 7:137909660-137909682 GGGTGGTCTCCATTGGAAGAAGG - Intronic
1033851519 7:145502156-145502178 GGCTTGTTACCATTGGATGGTGG + Intergenic
1034404909 7:150896792-150896814 GCCGGGTCACCAGTGGAAGCTGG + Intergenic
1034472083 7:151260596-151260618 GGCGTGTCACCATGGGATTCAGG - Intronic
1036191933 8:6678564-6678586 GGCTTGGGACCACTGGGAGCAGG - Intergenic
1037224807 8:16573111-16573133 GGCTTGCCAACATTAGAATCAGG - Intergenic
1053295104 9:36907077-36907099 GGCTTGGTACCAAGGGAAGCAGG + Intronic
1055858981 9:80725501-80725523 TGCTTGTCACCATGTGAAGAAGG - Intergenic
1059506197 9:114801874-114801896 GGCTTGTCAGCAAGGGAAGGAGG - Intronic
1061387283 9:130297877-130297899 GGCCTGTCCCCAGTGGAAGTGGG + Intronic
1062355402 9:136159728-136159750 GGTCTGTCACCCTAGGAAGCTGG + Intergenic
1062387208 9:136317533-136317555 GGCAAGTCACCATAGGAAGGTGG - Intergenic
1186720200 X:12296082-12296104 TGATTGTCACGACTGGAAGCGGG - Intronic
1189052556 X:37661872-37661894 GGCTTGTCACCTGTGGAGGTGGG - Intronic
1190119978 X:47651343-47651365 GGTCTGTGCCCATTGGAAGCTGG + Intergenic
1194486530 X:94493219-94493241 GGCTTGTCATTATTGATAGCTGG - Intergenic
1198971998 X:142292380-142292402 GGCTTCTCGCTATTGAAAGCGGG - Intergenic
1198983916 X:142428120-142428142 GACTTGCCACCAATGGAACCTGG + Intergenic
1202592907 Y:26506342-26506364 GTCTTGTCACCCTTAGTAGCAGG + Intergenic