ID: 1156460604

View in Genome Browser
Species Human (GRCh38)
Location 18:37319460-37319482
Sequence GATCCTACCCACTAGGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156460604_1156460614 -3 Left 1156460604 18:37319460-37319482 CCCAAGCCCTAGTGGGTAGGATC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1156460614 18:37319480-37319502 ATCTGAGGTCCGGGTTGGGAGGG 0: 1
1: 0
2: 2
3: 8
4: 149
1156460604_1156460612 -7 Left 1156460604 18:37319460-37319482 CCCAAGCCCTAGTGGGTAGGATC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1156460612 18:37319476-37319498 TAGGATCTGAGGTCCGGGTTGGG 0: 1
1: 0
2: 0
3: 2
4: 88
1156460604_1156460618 14 Left 1156460604 18:37319460-37319482 CCCAAGCCCTAGTGGGTAGGATC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1156460618 18:37319497-37319519 GGAGGGGGCCTGAGTCCTAGAGG 0: 1
1: 0
2: 1
3: 19
4: 272
1156460604_1156460613 -4 Left 1156460604 18:37319460-37319482 CCCAAGCCCTAGTGGGTAGGATC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1156460613 18:37319479-37319501 GATCTGAGGTCCGGGTTGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 166
1156460604_1156460616 -1 Left 1156460604 18:37319460-37319482 CCCAAGCCCTAGTGGGTAGGATC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1156460616 18:37319482-37319504 CTGAGGTCCGGGTTGGGAGGGGG 0: 1
1: 0
2: 1
3: 31
4: 409
1156460604_1156460611 -8 Left 1156460604 18:37319460-37319482 CCCAAGCCCTAGTGGGTAGGATC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1156460611 18:37319475-37319497 GTAGGATCTGAGGTCCGGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 105
1156460604_1156460615 -2 Left 1156460604 18:37319460-37319482 CCCAAGCCCTAGTGGGTAGGATC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1156460615 18:37319481-37319503 TCTGAGGTCCGGGTTGGGAGGGG 0: 1
1: 0
2: 2
3: 26
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156460604 Original CRISPR GATCCTACCCACTAGGGCTT GGG (reversed) Intronic
903312795 1:22472932-22472954 GATCCTAACAACCAGGCCTTAGG - Intronic
906210634 1:44010663-44010685 GAGCCCACCCACCAGGGCCTGGG - Intronic
908591223 1:65637233-65637255 GGACCTTCCCACTAGAGCTTGGG - Exonic
913989022 1:143592502-143592524 GCCCCTACACACTAGGGCTAGGG + Intergenic
914357835 1:146903031-146903053 GGTCCTACCCACTAGTATTTTGG + Intergenic
915571996 1:156749878-156749900 TGTCCTACCCACCAGGGCCTTGG + Intronic
916091670 1:161312286-161312308 GACCATACCCACCAGGGCTGTGG - Intergenic
919183782 1:194118337-194118359 GTTTCTACCCACTAGGGCACCGG + Intergenic
919758478 1:201081207-201081229 GCTGCTACCCATTAGGGTTTAGG + Intronic
922792033 1:228316153-228316175 GATCCTTCCCACTAGAGACTGGG + Intronic
1063994941 10:11611064-11611086 GGTCCTGCCCACTGGGGCTCGGG + Intronic
1074380650 10:112977284-112977306 GATTCTTCTCACTAGGGCTTTGG + Intronic
1075855617 10:125626910-125626932 GCTCCTTCCCACTGGGGCCTGGG + Intronic
1080826642 11:35854134-35854156 TATCCCACTCACTGGGGCTTTGG + Intergenic
1083731385 11:64654266-64654288 GGTACTAGCCACTGGGGCTTTGG - Intronic
1088582019 11:111325766-111325788 GAGGCTTCCGACTAGGGCTTAGG - Intergenic
1102186782 12:110954831-110954853 GATGCTACCAATCAGGGCTTTGG + Intergenic
1103719508 12:122965902-122965924 GATCCTGAGCACCAGGGCTTTGG - Intronic
1109571420 13:64195480-64195502 GATAGTACCCACAAGGGCATAGG + Intergenic
1112940395 13:104854692-104854714 GATCCTTCCCAACAGGGCATTGG - Intergenic
1113825238 13:113247486-113247508 GATCCTACACAAAAGGGCATGGG + Intronic
1114690566 14:24576172-24576194 TCTCCTACCCACTGGGGCTGAGG - Exonic
1116509910 14:45732021-45732043 GATTCAGCCCACTAGGGCATAGG + Intergenic
1118487223 14:66225315-66225337 ACACCTACCCACTGGGGCTTCGG + Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1121923572 14:97906333-97906355 GATCATACCCAGCAAGGCTTGGG - Intergenic
1124911290 15:33923700-33923722 GTTCCTAACCCCTAGGGGTTGGG - Intronic
1130337509 15:82969537-82969559 GAACCTACCCACAAAGGCTGAGG - Intronic
1139976348 16:70814261-70814283 GGTCCTACCCACTAGTATTTTGG - Intronic
1142666000 17:1464286-1464308 GCTCCTACCCTCAAGGGCCTGGG - Exonic
1151731029 17:75911178-75911200 GATCCTACCCCCTTGGCCTGCGG - Intronic
1156460604 18:37319460-37319482 GATCCTACCCACTAGGGCTTGGG - Intronic
1158941485 18:62409327-62409349 AATCCACCCCACTTGGGCTTGGG + Intergenic
1159888029 18:73927981-73928003 CATCCAACCCAGGAGGGCTTTGG + Intergenic
1160307755 18:77756234-77756256 GATCCCACCCACTATGGCCACGG - Intergenic
1162472247 19:10879435-10879457 GATCCTACCCACTGTGGCCAAGG - Intronic
1167561379 19:50227887-50227909 GAACCTACCCAAGAGGGGTTTGG + Intronic
925843724 2:8017278-8017300 TATCCTACCCACTAGGCCCCTGG + Intergenic
926888073 2:17615990-17616012 GATCCTCCCCTGCAGGGCTTGGG + Intronic
927055969 2:19365727-19365749 GATTCTACCCAGTAGGGTCTGGG + Intergenic
927523484 2:23717140-23717162 GTTCCTACTCACTTGGGATTTGG - Intergenic
934050040 2:88202155-88202177 TATTCCACCCACGAGGGCTTAGG - Intergenic
935870308 2:107441049-107441071 GATGCTACCCTCTAGGGCTCAGG + Intergenic
946798960 2:223389200-223389222 GTTCCTAGCCACGAGGGCTTGGG + Intergenic
948764657 2:240213181-240213203 GATCCTGCCCACCAGGGAGTAGG + Intergenic
948865074 2:240771079-240771101 GCTCATACCCACCAGGGCATTGG + Exonic
1171295274 20:24011871-24011893 CATCATGCCCATTAGGGCTTTGG + Intergenic
1177799029 21:25809171-25809193 GATCATTCCCACCAGGGCCTAGG + Intergenic
1180729898 22:17973399-17973421 GATCCTTCCCAACAGGGCCTGGG + Intronic
1184064765 22:42111956-42111978 TATCCTGCCCTCTAGGGGTTTGG + Intergenic
950427109 3:12930421-12930443 GAATCTGCCCACTAGGTCTTAGG - Intronic
954465114 3:50649748-50649770 GAAGCTACCCACAAGGGCTCCGG - Intergenic
956708433 3:72019490-72019512 AATCCTACCTTCTAGTGCTTGGG + Intergenic
972443409 4:39118798-39118820 GATCTTACCCTCCAAGGCTTGGG + Intronic
981763028 4:148215030-148215052 AATCCTGCCCAGTAGGGCTTCGG - Intronic
985077517 4:186231070-186231092 TATCCTACCCCCTGGGGATTTGG - Intronic
989699930 5:44251356-44251378 GATACTAAACACTAGTGCTTTGG - Intergenic
992226055 5:74620588-74620610 TAGCATGCCCACTAGGGCTTTGG - Intergenic
992279281 5:75157084-75157106 GATCCTACCAGGGAGGGCTTAGG + Intronic
1001746757 5:174098384-174098406 GGTCCAGCCCCCTAGGGCTTTGG - Intronic
1006226015 6:32536902-32536924 GATCTTGCACACAAGGGCTTTGG - Intergenic
1010931928 6:81814252-81814274 GATCCTACCCTCAAGGGGTCTGG - Intergenic
1013051118 6:106536181-106536203 TTTCCTATCTACTAGGGCTTAGG + Intronic
1022077714 7:26989741-26989763 AATCCTACTCACTAGGAATTAGG + Intronic
1023123054 7:36928731-36928753 CATCCCACCCACCAGGGCTGTGG + Intronic
1023291061 7:38669551-38669573 GATCCTTCCCACTGCAGCTTGGG - Intergenic
1040828625 8:51651914-51651936 GATCTTACCCTCTAGCTCTTAGG + Intronic
1041772572 8:61487685-61487707 TATCCTCCCCACTAGGGATGGGG - Intronic
1044111173 8:88276692-88276714 GTTCTTACCCAATAGTGCTTGGG + Intronic
1053928656 9:43092984-43093006 GAGCCCACCCACCAGGGCCTTGG + Intergenic
1054912375 9:70466158-70466180 GTCTCTACCCACTAGGGTTTCGG + Intergenic
1057407188 9:94783326-94783348 GATGCTACCCAGCAAGGCTTCGG - Intronic
1058598157 9:106638376-106638398 GATCCTACCATCTAGGGGTTAGG + Intergenic
1191218576 X:57960399-57960421 AATCCCACACACTAGTGCTTGGG - Intergenic
1192240532 X:69324333-69324355 TATCCTACCCACAAGAGCATAGG - Intergenic