ID: 1156462613

View in Genome Browser
Species Human (GRCh38)
Location 18:37329862-37329884
Sequence TGCCCATGACGCTGACCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156462608_1156462613 -8 Left 1156462608 18:37329847-37329869 CCACATGGGGTGGCCTGCCCATG 0: 1
1: 0
2: 1
3: 13
4: 251
Right 1156462613 18:37329862-37329884 TGCCCATGACGCTGACCTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 124
1156462607_1156462613 1 Left 1156462607 18:37329838-37329860 CCTGTGTGGCCACATGGGGTGGC 0: 1
1: 1
2: 3
3: 25
4: 233
Right 1156462613 18:37329862-37329884 TGCCCATGACGCTGACCTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 124
1156462605_1156462613 2 Left 1156462605 18:37329837-37329859 CCCTGTGTGGCCACATGGGGTGG 0: 1
1: 0
2: 3
3: 25
4: 225
Right 1156462613 18:37329862-37329884 TGCCCATGACGCTGACCTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156462613 Original CRISPR TGCCCATGACGCTGACCTGG GGG Intronic
900341257 1:2190416-2190438 TGCCCAGGGCGCTGACCTGCAGG - Intronic
900410587 1:2510851-2510873 TGCCCGTCACGCTGCCCTGCAGG + Intronic
900838891 1:5031153-5031175 TCCCCAGGAGGCTGACCTGGAGG - Intergenic
903865264 1:26393036-26393058 TGCCCCTGAAGCTGACCTTTGGG - Intergenic
912536556 1:110377541-110377563 TCCCCAAGACACTGACCTGAAGG - Intronic
913592302 1:120341332-120341354 AGCCCATTACGCAAACCTGGCGG + Intergenic
913651056 1:120913813-120913835 AGCCCATTACGCAAACCTGGCGG - Intergenic
914170057 1:145215254-145215276 AGCCCATTACGCAAACCTGGCGG + Intergenic
914525176 1:148459217-148459239 AGCCCATTACGCAAACCTGGCGG + Intergenic
914598502 1:149176613-149176635 AGCCCATTACGCAAACCTGGCGG - Intergenic
914641228 1:149607917-149607939 AGCCCATTACGCAAACCTGGCGG - Intergenic
915084263 1:153374404-153374426 TGCCCATGACCCTGCACTGAGGG - Intronic
917883022 1:179357894-179357916 TGCCCATGGCTCTGAAATGGAGG - Exonic
919063465 1:192664030-192664052 TGCCCATGACTATGTCCTGAAGG + Intergenic
922810275 1:228411433-228411455 TGCCCAAGAGGCTTATCTGGGGG - Intronic
1070558563 10:77548546-77548568 AATCCATGAAGCTGACCTGGTGG + Intronic
1073163222 10:101419548-101419570 TCCCCATGGCACAGACCTGGCGG - Intronic
1074411192 10:113230212-113230234 TGCCCAGAAGGATGACCTGGGGG - Intergenic
1076117239 10:127908739-127908761 TGCCCCTGAATCTGACCTTGGGG + Intronic
1076513920 10:131032632-131032654 AGCCCATGACGCTGGCATGGTGG - Intergenic
1076742015 10:132490392-132490414 TACCGAGGACCCTGACCTGGGGG + Intergenic
1078434984 11:11316875-11316897 TGCCCAAGTCCCTGCCCTGGAGG - Intronic
1091406981 12:215133-215155 TGACCAGGACGCTGTTCTGGAGG - Intergenic
1091599356 12:1908599-1908621 TGTCCGTGACGCAGTCCTGGGGG - Intronic
1091605700 12:1949654-1949676 TGTCCATGACCCTGACCTAAAGG + Intronic
1091830854 12:3550370-3550392 TGCCTCTGAAGCTGACCTTGGGG - Intronic
1091989883 12:4946783-4946805 TGCCCATGGCAGTGACCTGAGGG + Intergenic
1092397141 12:8136845-8136867 TGCCAATGTCGCTGACCTTCTGG - Exonic
1092503636 12:9072637-9072659 TGCCCAAGAGTCTCACCTGGAGG + Exonic
1096220295 12:49824801-49824823 TCCCCCAGACACTGACCTGGAGG - Intronic
1098166947 12:67708452-67708474 TGCCCATGAAGCTGGCCCTGGGG - Intergenic
1100857484 12:98770828-98770850 TACCCATGACATTGAACTGGGGG + Intronic
1107128801 13:36872853-36872875 TGGCCAGGAGGCTGAGCTGGGGG + Exonic
1111380613 13:87445500-87445522 TGCCCATTCTCCTGACCTGGAGG - Intergenic
1113094095 13:106645438-106645460 TGCCCATGAAGCTGGCTTGAAGG + Intergenic
1113610532 13:111641868-111641890 TTCCCAAGAAGCTGCCCTGGAGG - Intronic
1113930902 13:113968368-113968390 TGCCCGGGACGGTGGCCTGGGGG - Intergenic
1114484347 14:23054245-23054267 GGCCCAGGACCCAGACCTGGGGG - Exonic
1117627029 14:57650770-57650792 GGGCCATGAGGCTGACCTGGAGG - Intronic
1122717864 14:103706191-103706213 TGGGGATGACGCTGACCTGAGGG + Intronic
1122773381 14:104106849-104106871 TGCCCACGCCGGTGACGTGGAGG + Exonic
1123756154 15:23399147-23399169 TGCCCAGGAAGCTGAGCCGGAGG - Intergenic
1128306894 15:66604583-66604605 TGCCCATGTCTCTGCCCTGCAGG - Intronic
1128900680 15:71419309-71419331 TACCCAGGAGGCTGAGCTGGGGG - Intronic
1129466064 15:75725050-75725072 TTCCCCTGCCTCTGACCTGGTGG + Intronic
1131259281 15:90880226-90880248 TGCCCATGGGGCTGACCAGGTGG - Exonic
1131871989 15:96772955-96772977 TGTCCATGTCACAGACCTGGAGG - Intergenic
1132842321 16:1984151-1984173 TGGCCTGGAGGCTGACCTGGAGG + Intronic
1132869784 16:2110786-2110808 TGCCAATGACTCAGCCCTGGTGG - Exonic
1133138424 16:3728260-3728282 GGCCCATGGAGCTGCCCTGGAGG + Exonic
1134717637 16:16364815-16364837 TGCCAATGACTCAGCCCTGGTGG + Intergenic
1134957115 16:18387344-18387366 TGCCAATGACTCAGCCCTGGTGG - Intergenic
1136852596 16:33624978-33625000 TGCCATTGAAGCTTACCTGGGGG + Intergenic
1136895912 16:33995886-33995908 TGGCCATGCTGCTGACCTGACGG + Intergenic
1138424610 16:56922557-56922579 TGCCCTAGATGCTGGCCTGGAGG + Intergenic
1144787559 17:17840372-17840394 TGCCCGGGACGCGCACCTGGCGG - Intergenic
1145256965 17:21330741-21330763 TGCACATCACCCTGAGCTGGAGG + Intergenic
1145319669 17:21757312-21757334 TGCACATCACCCTGAGCTGGAGG - Intergenic
1149285560 17:55160485-55160507 TGCCCGTGAAGCTGATCTGGTGG + Exonic
1151976370 17:77485666-77485688 TGGCCAGGACACAGACCTGGTGG + Intronic
1152122877 17:78429421-78429443 TGGCCAGGAGGCTGACCTGGAGG - Intronic
1152461426 17:80444333-80444355 TACCCAGGACGCTGGGCTGGAGG + Intergenic
1153442837 18:5139941-5139963 TTCCACTGAAGCTGACCTGGAGG - Intergenic
1156462613 18:37329862-37329884 TGCCCATGACGCTGACCTGGGGG + Intronic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1163266707 19:16226414-16226436 TGCCGTTGGCGCTGACCTGGGGG - Exonic
1164893759 19:31849985-31850007 TGCCCAGGAGGCTGAGGTGGGGG + Intergenic
1166673153 19:44723562-44723584 AGACCATGACCCTGACCAGGGGG + Intergenic
1166827092 19:45616469-45616491 TGCCCAGGCGGCTGACCTTGCGG + Exonic
1167674881 19:50877832-50877854 TGACGATGAGGATGACCTGGGGG + Intronic
1168498758 19:56875842-56875864 TGCTCGTGACCCTGACCTGCTGG + Intergenic
925874473 2:8300290-8300312 TGCCCCTCACACAGACCTGGTGG - Intergenic
926932961 2:18058479-18058501 TGCCCATGACCCTGAAGTTGGGG - Intronic
927809498 2:26173500-26173522 GGCCCAGGAGGCGGACCTGGCGG - Intronic
929119463 2:38472437-38472459 TGCCGATGACACTGTCCTAGAGG + Intergenic
933287870 2:80403947-80403969 TGCAGATGAGGCTGACTTGGTGG + Intronic
941843133 2:170108982-170109004 GGCCCATGACAGTGTCCTGGAGG + Intergenic
944089930 2:195895546-195895568 TACCCAGGAGGCTGACGTGGGGG - Intronic
947308715 2:228776776-228776798 TGCCCTTCTCCCTGACCTGGAGG - Intergenic
1172776743 20:37411822-37411844 TTCCCATGAGGCAGCCCTGGTGG + Intergenic
1173736711 20:45366982-45367004 TCCCCTCGGCGCTGACCTGGTGG + Exonic
1174864466 20:54122277-54122299 TGCACATGACACTGACCAGGAGG + Intergenic
1175278412 20:57787428-57787450 TGCCCATCACTCTCCCCTGGGGG - Intergenic
1175536466 20:59718147-59718169 TGCCCAGGACTCAGGCCTGGGGG - Intronic
1175889157 20:62308490-62308512 TGCCCCTGGCTCTGGCCTGGAGG - Intronic
1175895936 20:62335588-62335610 TACCCATGAGGGTGTCCTGGAGG - Intronic
1176074348 20:63241693-63241715 GGCACAAGACGCTGACCTGCCGG - Intronic
1178979073 21:37245646-37245668 TGCCAATCACTCTGCCCTGGTGG - Intronic
1179343911 21:40538340-40538362 GGCCCATCACGCTGTCCTGTAGG + Intronic
1181030026 22:20145251-20145273 TGCCCATTAAGCTTACTTGGGGG - Intronic
1181114843 22:20625359-20625381 TGGCCATGTGGCAGACCTGGTGG + Intergenic
1181513236 22:23398062-23398084 TGCCCATTAAGCTTACCTGGGGG + Intergenic
1183083115 22:35469804-35469826 AGCCAGTGAGGCTGACCTGGGGG + Intergenic
1184093128 22:42302688-42302710 TGGCCATGACCCTGCCCTGCAGG + Intronic
1185398108 22:50602834-50602856 TGGACATGACCCTGCCCTGGTGG + Intronic
951611916 3:24498994-24499016 TGCCCATGAAGCTGGCCATGGGG + Intergenic
953883939 3:46705094-46705116 TGGACATGACCCTGCCCTGGGGG - Intronic
954215404 3:49121680-49121702 TGCCCAGGAGGCTGAGCAGGTGG - Exonic
954424191 3:50434714-50434736 TGCTCATGACCCTGAAATGGGGG - Intronic
954430345 3:50467508-50467530 TGCCCACAAGGCTGACATGGAGG - Intronic
954448108 3:50557417-50557439 TTTCCATGACGCTGGCCTGAAGG + Intergenic
958985513 3:100776014-100776036 TGTCCATGATTCTGGCCTGGTGG + Intronic
962855189 3:139338936-139338958 TGCCCAGGCCCCTGACCTGGGGG + Intronic
968627593 4:1634170-1634192 TGCCTGTGACCCTGACCTCGGGG + Intronic
973696568 4:53496379-53496401 TGTCCATCCCGTTGACCTGGGGG + Exonic
981423247 4:144575404-144575426 TGCCCATGAGCATGACCTAGTGG + Intergenic
988116777 5:26903741-26903763 AGCCAATGACCCTGACGTGGGGG - Exonic
989395633 5:40952941-40952963 TATGCATGACGCTTACCTGGGGG + Intronic
990105765 5:52257951-52257973 AGCCCATGAAGCTGGCCTTGTGG + Intergenic
995312624 5:110731178-110731200 TGCCGAAGACCATGACCTGGAGG - Intronic
999002489 5:147939531-147939553 TCCCCATGAGCCTGACATGGCGG - Intergenic
1001122342 5:168991191-168991213 TGCCAAGGACTCTGAACTGGGGG + Intronic
1003045885 6:2732373-2732395 TGCCCATCACGATGAGCTGTTGG - Intronic
1004760569 6:18661445-18661467 TGCCCATGCCTATGTCCTGGTGG - Intergenic
1006302539 6:33201230-33201252 TGGCCATCACGCTGACCAGAGGG - Exonic
1006514511 6:34538520-34538542 TCGCCACGAGGCTGACCTGGTGG - Intronic
1006561316 6:34915231-34915253 AGCCCATGGCACTGACCTAGGGG - Intronic
1007356088 6:41318868-41318890 TGCACGTGCCGCTGTCCTGGAGG + Intergenic
1017826679 6:158086850-158086872 TCCAGATGACGCGGACCTGGTGG + Exonic
1017857168 6:158359969-158359991 TGCCCTTGACTCTGGCCTTGGGG + Intronic
1018270428 6:162071525-162071547 TGCCCATGCCCATGACCTGATGG - Intronic
1019351091 7:554336-554358 AGCCCATCACGCTGACCTTGCGG + Intronic
1023675092 7:42620709-42620731 TTCCCATGACCCTGGCATGGAGG - Intergenic
1035745985 8:1962389-1962411 AGCCCACGATGCTGAGCTGGGGG - Intergenic
1035760619 8:2066100-2066122 TGGTCATGACGGTGACCTGCTGG + Intronic
1036503933 8:9338048-9338070 TGCCCAGGAGGCTGAGCTGGAGG + Intergenic
1038777099 8:30540893-30540915 TGCCCAAGCCACAGACCTGGTGG - Intronic
1038852304 8:31291675-31291697 TGCCCATGACTATGTCCTGAAGG + Intergenic
1040554513 8:48467441-48467463 TTCCCATGGCTCTGGCCTGGTGG + Intergenic
1042647972 8:71008484-71008506 TGCCAATGCTGCTGATCTGGGGG - Intergenic
1058539686 9:105998855-105998877 TGTCCAAGAGGCTGACCTGTGGG + Intergenic
1060057072 9:120423922-120423944 TGCCCAGGTGGCTGGCCTGGTGG - Intronic
1060134179 9:121135886-121135908 TGCCTATGAAGCTGAGCTAGAGG + Exonic
1061069010 9:128297184-128297206 TGCCCAGGGCCCTGACCTAGCGG + Intergenic
1061482101 9:130902440-130902462 TGCGCATGTGGATGACCTGGTGG + Exonic
1188110585 X:26192838-26192860 TGCCCTTGACGTTAGCCTGGGGG + Intronic
1189367273 X:40398411-40398433 AGCCCATGACACTTGCCTGGAGG + Intergenic
1194564269 X:95464266-95464288 TGCCCATGAAGCTGGCCCTGGGG - Intergenic