ID: 1156465665

View in Genome Browser
Species Human (GRCh38)
Location 18:37346744-37346766
Sequence CTGCTTGTGCAGAAGCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 842
Summary {0: 1, 1: 0, 2: 8, 3: 101, 4: 732}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156465665 Original CRISPR CTGCTTGTGCAGAAGCCCTG GGG Intronic
901001416 1:6150748-6150770 CTGCTAATGCAAATGCCCTGGGG + Intronic
901147121 1:7072789-7072811 ATGCAGGTGCAGAAGCCCTGGGG + Intronic
901154817 1:7128467-7128489 GAGCTTGTGCAAAGGCCCTGAGG + Intronic
901297567 1:8172269-8172291 CAGCTTGTGCAAAGGGCCTGAGG + Intergenic
901320872 1:8339203-8339225 CTCCACCTGCAGAAGCCCTGGGG + Intronic
901396385 1:8985190-8985212 CGGCATGTGCAAAGGCCCTGTGG - Intergenic
901661374 1:10799875-10799897 CAGCAGGTGCAGAGGCCCTGAGG - Intergenic
901673200 1:10867603-10867625 GTCCTGGTCCAGAAGCCCTGGGG - Intergenic
901677189 1:10892407-10892429 CTGCAAGTGCAAAGGCCCTGGGG - Intergenic
901690725 1:10971477-10971499 CAGTATGTGCAGAGGCCCTGAGG - Intronic
901781057 1:11594845-11594867 CAGCATGTGCAAAGGCCCTGGGG - Intergenic
901864340 1:12094354-12094376 CAGCTTGTGCAAAGGCCCTGGGG + Intronic
902183845 1:14710567-14710589 CAGCTAGTGCAAAGGCCCTGAGG - Intronic
902195592 1:14795793-14795815 CAGCATGTGCAAAGGCCCTGAGG - Intronic
902278940 1:15360354-15360376 CTGCATGTGCTAAGGCCCTGGGG + Intronic
902369684 1:15998065-15998087 TGGCTTGTGCAAAGGCCCTGAGG - Intergenic
902572408 1:17355190-17355212 GTGCATGTGCAAAGGCCCTGAGG + Intronic
902679921 1:18036102-18036124 CTGCTAGTGCAAAGGGCCTGAGG + Intergenic
902752392 1:18526145-18526167 CTGCTGGACCAGAAACCCTGAGG - Intergenic
902801629 1:18833819-18833841 CAGCCAGTGCAAAAGCCCTGGGG + Intergenic
902837645 1:19057540-19057562 CAGCCTGAGCAGAGGCCCTGGGG + Intergenic
902893611 1:19463395-19463417 CTGCTTCTGCAAAACACCTGTGG + Intronic
902957212 1:19933916-19933938 CAGCCTGTGCAAAGGCCCTGTGG + Intergenic
903050757 1:20599166-20599188 CAGCTTGTGCAAAGGCCCTGTGG + Intronic
903232455 1:21930171-21930193 CAGCTAGTGCAGAGGCCCAGAGG - Intronic
903299822 1:22370814-22370836 CTGCAAGTGCAAAGGCCCTGAGG + Intergenic
903328973 1:22587452-22587474 CTGCATGTGCACGTGCCCTGTGG + Intronic
903765150 1:25729230-25729252 CAGCATGTGCAAAGGCCCTGAGG - Intronic
903946963 1:26970084-26970106 CAGCTGGTGCAAAGGCCCTGAGG + Intergenic
904052825 1:27650481-27650503 CTGCTTTCTCAGAAGCCCTAGGG + Intergenic
904251161 1:29225292-29225314 CTGCATGTGCAGAGACCCCGAGG - Intronic
904300270 1:29549574-29549596 CTGCGTGGGCAAAGGCCCTGTGG - Intergenic
904359347 1:29961840-29961862 CAGCATGTGCAAAGGCCCTGGGG - Intergenic
904457963 1:30658541-30658563 CTGCATGGGCAAAGGCCCTGTGG + Intergenic
904584433 1:31572102-31572124 CAGCATGAGCAAAAGCCCTGAGG - Intergenic
904632889 1:31856297-31856319 CAGCTAGTGCAAAGGCCCTGCGG + Intergenic
904824562 1:33265943-33265965 CTGCATGTGCAAAGGCCCCGAGG - Intronic
904911454 1:33937376-33937398 CAGCATGTGCAAAGGCCCTGAGG + Intronic
905186407 1:36200126-36200148 CAGCTTGTGCAACGGCCCTGAGG - Intergenic
905287202 1:36889314-36889336 CAGCATGTGCGGAAGCCCAGAGG + Intronic
905317596 1:37093498-37093520 CTGCTTTCACTGAAGCCCTGGGG + Intergenic
905519161 1:38584761-38584783 CTGCTTGTGCAGAAGCTCAGAGG + Intergenic
905958995 1:42027597-42027619 CAGCAAGTGCAAAAGCCCTGAGG - Intronic
906101592 1:43267402-43267424 CTGCTGGTGCAGAGGCTCTGAGG + Intronic
906144317 1:43550905-43550927 CAGCTTATGCAAAGGCCCTGTGG + Intronic
906297461 1:44658013-44658035 CTACTTGGGCAGAAGGCATGAGG - Intronic
906938189 1:50232910-50232932 CAGCCTGTGCAAAAGCCCTAAGG + Intergenic
907243660 1:53093996-53094018 CGGCTTGCGCAAAGGCCCTGAGG - Intronic
907335372 1:53696049-53696071 CTGGGAGTGGAGAAGCCCTGGGG - Intronic
907671812 1:56481026-56481048 CAGAGTGTGCAGAGGCCCTGTGG + Intergenic
908087149 1:60647799-60647821 TTGCTTCTGCTGAAGCCCTCAGG + Intergenic
908090276 1:60678311-60678333 CAGCATTTGCAGAAGCCCAGAGG + Intergenic
909465519 1:75969705-75969727 CAGCATGTGCAAAAGCCCTGAGG + Intergenic
909712720 1:78671036-78671058 CTGCTTTTGCAGTATCCCAGAGG + Intergenic
911151845 1:94603842-94603864 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
912674588 1:111666845-111666867 TAGCTTCTGCAAAAGCCCTGTGG + Intronic
912732852 1:112125082-112125104 CTGCCTGTGAAGGAGGCCTGTGG + Intergenic
912965697 1:114235350-114235372 CTTTTTCTCCAGAAGCCCTGAGG + Intergenic
913103992 1:115595186-115595208 GTGCTTGTCCAGAGGCCCAGTGG + Intergenic
913304307 1:117409275-117409297 CTGCTTTTGCTGCATCCCTGAGG + Intronic
913547459 1:119883409-119883431 CAGCTTATGCAGCAGCACTGAGG + Intergenic
913556702 1:119974654-119974676 CAGCTTATGCAGCAGCACTGAGG - Intronic
914813815 1:151048445-151048467 CGGCTGGTGCTGATGCCCTGGGG + Exonic
915039867 1:152959742-152959764 CACCTTGTCCAGAAGCCCAGGGG + Intergenic
916171039 1:162001991-162002013 CTCCTTGGGCAGCAGCTCTGTGG - Intronic
917212297 1:172643505-172643527 TTCCTTTTGCAGAAGGCCTGGGG - Intergenic
917315104 1:173715862-173715884 GTGCATCTGCAGAAGGCCTGTGG + Intronic
917795608 1:178530715-178530737 TTGCAAGTGCAGAGGCCCTGAGG - Intronic
918065825 1:181101086-181101108 CTGCATGTGCAAAGGCCCTGAGG + Intergenic
918854004 1:189727506-189727528 TTGGTTGTGCAGAAGCTCTTTGG + Intergenic
918864040 1:189871238-189871260 CTGGTTGTGCACTAGTCCTGGGG + Intergenic
919516576 1:198532765-198532787 CAGCAAGTGCAGAGGCCCTGAGG + Intronic
920292985 1:204936970-204936992 CTGCTTGTGCAAAGGCCCTGTGG - Intronic
921410575 1:214832217-214832239 GAGCTTGTGCAAAGGCCCTGAGG - Intergenic
921808044 1:219478380-219478402 CTGCTGCTGCTGAGGCCCTGGGG - Intergenic
922283710 1:224149916-224149938 CAGCATGTGCAAAAGCCCTGGGG + Intronic
922419676 1:225451120-225451142 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
922475395 1:225903799-225903821 CAGCTTGTGCAAAGGCCCTGAGG - Intronic
922507478 1:226134903-226134925 CAGCCAGTGCAGAGGCCCTGAGG - Intergenic
922764668 1:228150702-228150724 CTCCCTGCGCAGCAGCCCTGGGG - Intronic
923039217 1:230307930-230307952 CAGATAATGCAGAAGCCCTGAGG + Intergenic
924015271 1:239714509-239714531 CAGCTTGTGCCAAGGCCCTGCGG + Intronic
1064329670 10:14381696-14381718 CAGCAAGTGCAAAAGCCCTGAGG - Intronic
1064352079 10:14585552-14585574 CTGCATGTGCAGCTGCCCTGAGG + Intronic
1064404548 10:15049653-15049675 CTGCTTATACAAAAACCCTGAGG + Exonic
1065206953 10:23365986-23366008 TTGCTTGTGCAAAGGCCCTGGGG - Intergenic
1066132849 10:32410778-32410800 CAGCATGTGCAAAGGCCCTGGGG + Intergenic
1066482387 10:35809483-35809505 CGGCATGTGCAAAGGCCCTGAGG - Intergenic
1067043520 10:42970960-42970982 CCTCTAGGGCAGAAGCCCTGAGG - Intergenic
1067231877 10:44417853-44417875 CATCTTGTGCAAAGGCCCTGAGG + Intergenic
1067289523 10:44931170-44931192 TCACTTGTGCAAAAGCCCTGTGG + Intronic
1069372629 10:67763970-67763992 CTGCTTGGGCAGAAGCCCGAGGG + Intergenic
1069568892 10:69482303-69482325 CTGCCTGTGCAAAGGCCCTGGGG + Intronic
1069676931 10:70255137-70255159 CCGCCTGTGCAGAAGCCCGCCGG + Exonic
1069711921 10:70495113-70495135 CGGCCCGTGCAGATGCCCTGCGG - Intronic
1069717638 10:70531198-70531220 CAGCTTGGGCAGAGGCCCTGAGG + Intronic
1069854785 10:71434115-71434137 CGGCCTGTGCAAAGGCCCTGAGG - Intronic
1069862127 10:71478353-71478375 CTGCAGGTGCAAAGGCCCTGAGG - Intronic
1070507305 10:77125419-77125441 CTGCATGTGCAGAGGCCCTGGGG - Intronic
1070555059 10:77521159-77521181 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1070623211 10:78029767-78029789 CTGCTTGTCTAAAAGCCTTGAGG - Intergenic
1070645305 10:78198039-78198061 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1070771205 10:79083332-79083354 CAGCATGTGCAAAGGCCCTGTGG + Intronic
1070794862 10:79210584-79210606 CTGCTAATGCAAAGGCCCTGAGG + Intronic
1071432736 10:85619060-85619082 AGCCTAGTGCAGAAGCCCTGGGG - Intronic
1071851819 10:89580537-89580559 CTGGGTGAGCAGAAGCGCTGAGG - Exonic
1072533477 10:96341529-96341551 CAGCATGTGCAAAAGCCATGTGG + Intergenic
1072552978 10:96493423-96493445 CAGCATGTGCAAAGGCCCTGGGG + Intronic
1072618993 10:97067600-97067622 TGGCTTGTGCGGCAGCCCTGGGG + Intronic
1072781785 10:98256495-98256517 TAGCTTATGCAAAAGCCCTGTGG - Intronic
1072885575 10:99269958-99269980 CTGCCTGTGCAGTATCCCAGAGG - Intergenic
1073418721 10:103406363-103406385 CTGCTGGTTCAGAAGCCATGGGG - Intronic
1073583735 10:104689479-104689501 CAGCTTGTGCAAAGGCCCTGAGG - Intronic
1074696157 10:116051642-116051664 CTGCCTGTGAAGGAGCTCTGTGG + Intergenic
1074890916 10:117735939-117735961 CTGCAAGTGCAAAAGTCCTGTGG - Intergenic
1075420486 10:122296930-122296952 CAGCATGTGCAAAGGCCCTGGGG - Intronic
1075634315 10:124019912-124019934 CAGCGTGTGCAGAGGCCCAGTGG - Intronic
1076618782 10:131773732-131773754 CTGCTTCTGCAGATGCCCACAGG + Intergenic
1076854648 10:133109904-133109926 CTGAGTGTGCAGAGGCCGTGGGG - Intronic
1077239830 11:1504738-1504760 CAGCTGCTGCGGAAGCCCTGGGG - Intergenic
1077283397 11:1755457-1755479 CAGCCAGTGCAGAGGCCCTGCGG - Intronic
1077429833 11:2510889-2510911 CTGCACGTGCAGAAGCCCTGAGG - Intronic
1077602286 11:3581974-3581996 CAGCGTGTGCAAAAGCCCAGGGG + Intergenic
1079300892 11:19278019-19278041 CAGCAAGTGCAAAAGCCCTGAGG - Intergenic
1079307976 11:19341089-19341111 CTGCTAGTGCAAAGGCCATGAGG - Intergenic
1079321065 11:19451781-19451803 CAGCTTGTGCAAAGGCCCTGAGG + Intronic
1080223046 11:29928742-29928764 CAGCAAATGCAGAAGCCCTGGGG - Intergenic
1080769746 11:35329634-35329656 GTGCTTTTGCAAAAGCCCAGAGG - Intronic
1081591228 11:44424690-44424712 CAGCATGTGCAAAAGCCCCGAGG + Intergenic
1083305268 11:61758676-61758698 CAGCCGGTGCAAAAGCCCTGAGG - Intronic
1083860698 11:65418484-65418506 CTGTAGGTGCAGCAGCCCTGGGG + Intergenic
1084020282 11:66413296-66413318 CAGCATGTGCAAAAGCACTGTGG + Intergenic
1084220240 11:67673522-67673544 CAACGTGTGCAAAAGCCCTGTGG + Intronic
1084258181 11:67956525-67956547 CAGCGTGTGCAAAAGCCCAGAGG + Intergenic
1084265417 11:68003159-68003181 CTGCATCTGCAGGAGGCCTGGGG + Exonic
1084477603 11:69397855-69397877 CTGCCTGTGCAAAGGCCCTGTGG + Intergenic
1084577292 11:69997555-69997577 ATGCTTGTGCAAAGGCCCTGTGG - Intergenic
1084685640 11:70693390-70693412 CAGCAAGTGCAGAAGCACTGGGG - Intronic
1084814565 11:71638689-71638711 CAGCGTGTGCAAAAGCCCAGAGG - Intergenic
1085374955 11:76052042-76052064 CAGCTTGTGTAAAGGCCCTGTGG - Intronic
1085449082 11:76621311-76621333 CTGCATGTACAAAGGCCCTGTGG + Intergenic
1085509717 11:77082145-77082167 CAGTGTGTGCAGAGGCCCTGAGG + Intronic
1085814074 11:79717182-79717204 TTGGTTGTGCACCAGCCCTGTGG - Intergenic
1085821171 11:79795297-79795319 CTGTTTGTGCCCCAGCCCTGGGG - Intergenic
1085892864 11:80601838-80601860 CTGTCTGTGCAGAAGTACTGTGG - Intergenic
1086417660 11:86605314-86605336 CAGCATGTGCAGATGCCCTGAGG - Intronic
1087074368 11:94115467-94115489 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1088711083 11:112509454-112509476 CTGCTGAGGCAGAAGCCATGGGG - Intergenic
1088910659 11:114188966-114188988 GAGCATTTGCAGAAGCCCTGAGG + Intronic
1089161077 11:116437819-116437841 CTGATTCTGCAGAAACACTGTGG - Intergenic
1089166466 11:116481245-116481267 CAGCTAGTGCAAAAGCTCTGAGG + Intergenic
1089187691 11:116631373-116631395 CTGCAAGTGCTGAAGCCCTGGGG - Intergenic
1090260958 11:125319807-125319829 TAGCTTGTGCAAAGGCCCTGTGG + Intronic
1090387472 11:126365244-126365266 CTGGTTGTGCACCAGCCCTGAGG + Intronic
1090390038 11:126382442-126382464 CTGGTTGTGCACCAGCCCTGAGG + Intronic
1090879854 11:130823982-130824004 TTGCATGTGCAGAGGCCCTGTGG - Intergenic
1091007202 11:131964199-131964221 CCGCGTGTGCAGAGGCCCAGGGG + Intronic
1091394006 12:142609-142631 CTGCTGGTGGAGACGCTCTGTGG + Intronic
1091951291 12:4595271-4595293 GTGTTTGTGCACAAGTCCTGAGG - Intronic
1091978298 12:4844522-4844544 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1092428429 12:8391326-8391348 CAGCGTGTGCAAAAGCCCAGAGG + Intergenic
1092429510 12:8397478-8397500 CAGCGTGTGCAAAAGCCCAGAGG + Intergenic
1093867335 12:24244428-24244450 CAGCTGGTGCATAGGCCCTGGGG - Intergenic
1093966911 12:25337559-25337581 CTGCAAGTGCAGAGGTCCTGAGG + Intergenic
1094212953 12:27911261-27911283 CTACATGTGCAAAGGCCCTGTGG - Intergenic
1095450063 12:42321022-42321044 TAGCTTGTGCAAAGGCCCTGTGG - Intronic
1097607359 12:61771710-61771732 CTGCTTGTGCTGTATCCCAGAGG - Intronic
1099472801 12:83072168-83072190 CTGCTTTTGCTGTATCCCTGAGG + Intronic
1100436223 12:94573767-94573789 CTGAATATGCAGAAGCCCTGAGG - Intronic
1100790526 12:98125218-98125240 CAGCCTGTGCAAAGGCCCTGGGG - Intergenic
1101718254 12:107330099-107330121 CTGCATGTGCAAAGGGCCTGTGG + Intronic
1102330051 12:112021261-112021283 CTGCAAGTGCAAAAGCTCTGAGG - Intronic
1102403076 12:112647756-112647778 CTGCAGGTGCAAAGGCCCTGAGG + Intronic
1102458540 12:113086322-113086344 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1102528308 12:113527752-113527774 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1102636789 12:114331571-114331593 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1102810672 12:115821412-115821434 CAGCTTGTGCAAAGGCCCTGTGG + Intergenic
1102811342 12:115826859-115826881 CTGCATGTGCAAAGGCCCTGGGG - Intergenic
1102912791 12:116731282-116731304 CTGATGGTGCAGAAGTCATGGGG - Intronic
1102955205 12:117054483-117054505 CTGTGTGTGCAAAGGCCCTGTGG - Intronic
1102985306 12:117272897-117272919 CTGCCTGTGCAAAGGCCCTGAGG - Intronic
1103019010 12:117518767-117518789 CTGCAGGTGCAAAGGCCCTGGGG - Intronic
1103032708 12:117630283-117630305 CAGCATGTGCAAAAGCCCTGGGG + Intronic
1103038400 12:117674956-117674978 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1103041455 12:117698879-117698901 CTGTATGTGCAAAGGCCCTGGGG - Intronic
1103197396 12:119056642-119056664 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1103201074 12:119088383-119088405 CTGCTTGGTGAGGAGCCCTGTGG - Intronic
1103267004 12:119639058-119639080 CGGCAAGTGCAGAGGCCCTGAGG - Intronic
1103361036 12:120353781-120353803 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1103390747 12:120571301-120571323 TTGCTTGTGAAGCAGCCCAGGGG + Intronic
1103414718 12:120736587-120736609 TGGCATGTGCAGAGGCCCTGTGG + Intronic
1103417311 12:120751680-120751702 TGGCTTGTGCAGATGCCCTGTGG + Intergenic
1103568455 12:121829013-121829035 CTGCGTGTTCAAAGGCCCTGGGG + Intronic
1103888639 12:124221874-124221896 CAGCAAGTGCAGAGGCCCTGAGG - Intronic
1103919123 12:124390346-124390368 CAGCTGGTGCAAAGGCCCTGGGG - Intronic
1103963274 12:124622519-124622541 CTGCAGGTGCAAAGGCCCTGAGG - Intergenic
1103994307 12:124819269-124819291 CAGCCTGTGCAAAGGCCCTGTGG + Intronic
1104371176 12:128225207-128225229 CTGGGTGTGCAAAGGCCCTGTGG + Intergenic
1105798209 13:23879181-23879203 CTGCAAGTACAGAGGCCCTGAGG + Intronic
1105829254 13:24149732-24149754 CGGCTTGTACAAAGGCCCTGCGG + Intronic
1106005515 13:25766738-25766760 CTGGGTGTGCAGGTGCCCTGGGG - Intronic
1106169037 13:27272879-27272901 CTGCTTCTGCAGAAGCTGGGTGG + Intronic
1106310052 13:28546192-28546214 GAGCTTGTGCAAAGGCCCTGAGG + Intergenic
1106556102 13:30809946-30809968 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1107064219 13:36195333-36195355 CAGCATATGCAGGAGCCCTGGGG + Intronic
1107379061 13:39836179-39836201 CACCTTATGCAGAGGCCCTGGGG - Intergenic
1107436836 13:40387921-40387943 TGGCTTGTGCAAAGGCCCTGAGG + Intergenic
1107869502 13:44734276-44734298 GTGAGTGTGCAGATGCCCTGGGG - Intergenic
1108637637 13:52351545-52351567 CAGCATGTGCAGAGGCCCTGAGG + Intergenic
1108830276 13:54469219-54469241 CTGCTTGTGGAGAGGACATGTGG + Intergenic
1108886865 13:55197151-55197173 CTGCTTTTGCAGTATCCCAGAGG + Intergenic
1110646084 13:77886180-77886202 CTGTATGTGCAAAAGCCCTGAGG + Intergenic
1111618289 13:90690064-90690086 CTGCATGTGCAGAATCCATCTGG + Intergenic
1114173564 14:20298796-20298818 CTGCTTGGGCATAGGCACTGAGG + Exonic
1114734113 14:25025649-25025671 TTTCTTTTGCAGTAGCCCTGAGG - Intronic
1115643457 14:35350342-35350364 CTGCCCCTGCAGATGCCCTGTGG - Intergenic
1115909114 14:38235967-38235989 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1117014944 14:51508486-51508508 CTGCTTGTCCTGGAGCCTTGAGG + Intronic
1118160942 14:63289618-63289640 CTTCTTGTGAAGGAGACCTGCGG - Intronic
1118330913 14:64815345-64815367 CTGCTTGGGCTGCAGCCCTCGGG - Intronic
1118818959 14:69332658-69332680 CTGCCAGTGCCAAAGCCCTGAGG - Intronic
1118838785 14:69495710-69495732 CTGCAGGTGCAAAGGCCCTGAGG - Intronic
1118912841 14:70076141-70076163 CAGGTAGTGCAGAGGCCCTGAGG - Intronic
1119526072 14:75323449-75323471 CAGTAGGTGCAGAAGCCCTGAGG - Intergenic
1119545527 14:75468946-75468968 TTTCTTGTGCAAAGGCCCTGAGG + Intronic
1121324545 14:93012383-93012405 CAGCTTGTGCAAAGGCGCTGAGG + Intronic
1121497528 14:94404738-94404760 CTGCATATGCAAAGGCCCTGAGG + Intergenic
1121630986 14:95421823-95421845 CAGCCTGTGCAAAGGCCCTGTGG - Intronic
1121661032 14:95635258-95635280 ATGCATGTACAAAAGCCCTGAGG - Intergenic
1121843734 14:97155504-97155526 CAGCATGTGCAAAGGCCCTGTGG - Intergenic
1122245857 14:100403016-100403038 CTGCTAATACAGAAGCCCTGAGG - Intronic
1122442761 14:101743936-101743958 CAGCTGGTGCAAAGGCCCTGGGG - Intergenic
1122738685 14:103858420-103858442 CTACTGGAGCAGACGCCCTGGGG - Intergenic
1122969169 14:105145486-105145508 CTGTTTGTCCAGCTGCCCTGAGG - Intronic
1125234129 15:37491757-37491779 TTGCTGGTGCAAAAGTCCTGGGG + Intergenic
1125249457 15:37682879-37682901 CAGCTTGTGCAAAGGCCCTGAGG - Intergenic
1125544893 15:40495997-40496019 CAGCATGTGCAGAGGCTCTGTGG - Intergenic
1125548761 15:40528613-40528635 CTGGTAATGCAGAAGGCCTGAGG + Intergenic
1125767630 15:42145945-42145967 CTGCTTGGGCACAAGCACCGTGG - Intronic
1128380147 15:67106343-67106365 CAGCATGTGCACAGGCCCTGAGG - Intronic
1128637935 15:69315080-69315102 CAGCTTGTGCAGAATCCCTTGGG + Intronic
1128680907 15:69650657-69650679 CAGCATGTACAGAAGCCCTAAGG - Intergenic
1128798780 15:70483678-70483700 CTGCTTGAGCAGATGGCCTAGGG + Intergenic
1130032277 15:80326921-80326943 CTGCTTGGGCACAAGCCCAGTGG - Intergenic
1130034456 15:80344451-80344473 CTGCTTGAGCACAAGCACTGTGG + Intergenic
1130059286 15:80558058-80558080 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1130256864 15:82329871-82329893 CTGCCTGTGCACTGGCCCTGCGG + Intergenic
1130598084 15:85260117-85260139 CTGCCTGTGCACTGGCCCTGCGG - Intergenic
1130965055 15:88690933-88690955 CAGCTTGTGCAAAAGCTTTGAGG + Intergenic
1131047708 15:89326638-89326660 CCGCTTGGGCAGGAGCTCTGTGG + Exonic
1131339030 15:91578978-91579000 CTCACTGTGCAGGAGCCCTGAGG - Intergenic
1132043429 15:98545086-98545108 CTGTGTGTGCAAAGGCCCTGAGG - Intergenic
1132157405 15:99505381-99505403 ATGCTTCTGCAGGAGCACTGGGG - Intergenic
1132175286 15:99709269-99709291 CAGCTCGTGCAGAAGCCCATGGG - Intronic
1133253848 16:4504018-4504040 TTGCCTGAGCAGAAGCCCCGAGG + Intronic
1133369790 16:5239043-5239065 CAGCGTGTGCAAAAGCCCAGAGG - Intergenic
1133770057 16:8862677-8862699 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1133854421 16:9536352-9536374 CATCTTGTGCAAAGGCCCTGGGG + Intergenic
1133928959 16:10216678-10216700 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1134115154 16:11542644-11542666 CTGATTGAACAGAGGCCCTGGGG + Intergenic
1134239507 16:12495060-12495082 CTGCATGTGCAAAGGTCCTGAGG - Intronic
1134451860 16:14368614-14368636 CTGGCTGTGCAAAGGCCCTGGGG - Intergenic
1134505816 16:14806015-14806037 CTGCATGTGCAAAGGCCCAGAGG - Intronic
1134547860 16:15124278-15124300 GTGATTGGGCAGAAGGCCTGTGG - Intronic
1134574764 16:15322924-15322946 CTGCATGTGCAAAGGCCCAGAGG + Intergenic
1134626445 16:15726031-15726053 CAGCGTGTGCAAAGGCCCTGTGG - Exonic
1134678887 16:16110041-16110063 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1134727680 16:16433542-16433564 CTGCGTGTGCAAAGGCCCAGAGG - Intergenic
1134830969 16:17322574-17322596 CAGCATGTGCAGAGGTCCTGAGG - Intronic
1134939756 16:18278285-18278307 CTGCATGTGCAAAGGCCCAGAGG + Intergenic
1135142839 16:19936208-19936230 CAGCAAGTGCAAAAGCCCTGGGG - Intergenic
1135161248 16:20098403-20098425 CAGCATGTGCAAAGGCCCTGGGG + Intergenic
1135633376 16:24053739-24053761 CAGCTGGTGCAAAGGCCCTGTGG + Intronic
1135640402 16:24115031-24115053 CAGCATGTGCAAAGGCCCTGTGG + Intronic
1135664998 16:24328297-24328319 GTGCTCGTGCAAAGGCCCTGAGG + Intronic
1135938612 16:26801849-26801871 CAGCATGTGCAAAGGCCCTGGGG - Intergenic
1135971648 16:27076246-27076268 CTGCTGGTGCAAATGCTCTGGGG - Intergenic
1136020379 16:27436347-27436369 CTGCCAGTGCAAAGGCCCTGTGG + Intronic
1136108787 16:28051661-28051683 CTGCACGTGCAAAGGCCCTGGGG + Intronic
1136309696 16:29399205-29399227 GTGATCGGGCAGAAGCCCTGTGG - Intronic
1137001189 16:35232564-35232586 CTGGTTGGCCAGAAGCCCAGTGG + Intergenic
1137286033 16:47016626-47016648 CTGGTATTACAGAAGCCCTGGGG - Intergenic
1137583882 16:49652171-49652193 CTGCATGTCCAGCAGCCATGTGG - Intronic
1137774170 16:51041742-51041764 CCGCATGTGCAGGAGCTCTGAGG - Intergenic
1137896601 16:52219428-52219450 CTGCATGTGCAAAGGCCCTGTGG - Intergenic
1138309305 16:56009560-56009582 CTCCTTGAGCAGCAGCCCTCTGG + Intergenic
1138421440 16:56901852-56901874 CTGAACGTGCAGAAGCCCTGAGG - Intronic
1138573697 16:57892744-57892766 CAGCATGTGCAGAGGCCCTGGGG - Intronic
1138606663 16:58094230-58094252 CAGCATGTGCAGAGGCCCTGGGG - Intergenic
1139647055 16:68338950-68338972 CTCCTTGTGGCAAAGCCCTGTGG - Intronic
1139872625 16:70119581-70119603 GAGCATGTGCAAAAGCCCTGAGG - Intronic
1140342157 16:74174984-74175006 CGGCCTGTGCAAAAACCCTGAGG + Intergenic
1140363151 16:74361734-74361756 GAGCATGTGCAAAAGCCCTGAGG + Intergenic
1140663362 16:77208593-77208615 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1140709590 16:77664431-77664453 GAGCTTGTGCAAAGGCCCTGTGG - Intergenic
1140733181 16:77874532-77874554 CAGCATGTGCAAAGGCCCTGTGG - Intronic
1141005114 16:80344747-80344769 CTGCATGTGCAAAGGCCCTGAGG + Intergenic
1141076579 16:81011159-81011181 CAGCATGTGCAAAAGTCCTGAGG - Intronic
1141138703 16:81483289-81483311 CAGCATGTGCAAAGGCCCTGGGG + Intronic
1141178160 16:81734335-81734357 CAGCCAGTGCAGAAGCCCAGAGG + Intergenic
1141376439 16:83535183-83535205 CAGCATGTGCAGAGGCCCTGGGG + Intronic
1141603373 16:85139417-85139439 GTGCATGTGCAAAGGCCCTGAGG + Intergenic
1141674576 16:85510824-85510846 CGGCAGGTGCAGAGGCCCTGAGG - Intergenic
1141678210 16:85528872-85528894 GAGCTGGTGCAGAGGCCCTGGGG + Intergenic
1142176901 16:88649656-88649678 CAGCTTGTGCCGAGGCCCTGGGG + Intronic
1142229100 16:88891265-88891287 CTGCACGTGCAGAGGCCCTGAGG - Intronic
1142499714 17:325477-325499 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1142821853 17:2475265-2475287 GTGCTTGTCCAGTAGCACTGGGG - Intronic
1143094000 17:4467050-4467072 CAGCCTGTGCGGAGGCCCTGAGG + Intronic
1143274355 17:5699183-5699205 CTGCATGTGCAAAGGCCCTGAGG - Intergenic
1143303706 17:5929622-5929644 CTGCTTGTTCAAAGGCCTTGCGG + Intronic
1143630197 17:8134701-8134723 CTGCTAGCACAAAAGCCCTGAGG + Intergenic
1143731142 17:8883538-8883560 CTGCATGTGCAAAGGCCCTGTGG - Intronic
1143777710 17:9210192-9210214 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1143798339 17:9356762-9356784 CTGCTTCTGCTGCAGCCCAGGGG + Intronic
1143900452 17:10170440-10170462 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1143946804 17:10600260-10600282 CAGCAAGTGCAGAGGCCCTGGGG + Intergenic
1144030557 17:11318410-11318432 CAGCTTGTGCAAAGGCCCTGTGG - Intronic
1144447490 17:15344457-15344479 ATGCATGTGCAAAGGCCCTGAGG - Intergenic
1144750160 17:17642877-17642899 CTGCTTCTGGAGGAGCCCAGTGG - Intergenic
1144762006 17:17712371-17712393 CAGCTAGTGCAAAGGCCCTGAGG + Intronic
1144823200 17:18089776-18089798 CAGCTAGTGCAAAGGCCCTGAGG + Intronic
1145266400 17:21381537-21381559 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1145767818 17:27471484-27471506 TGGCTTGTGCAAGAGCCCTGAGG + Intronic
1146173803 17:30652005-30652027 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1146347259 17:32068026-32068048 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1146964170 17:37010779-37010801 CTGCTTCTGCATATGCACTGCGG - Intronic
1147047797 17:37767678-37767700 CTGCAAGTGCAAAGGCCCTGGGG - Intergenic
1147218477 17:38914489-38914511 CTGTTGGTGCAGATGACCTGAGG + Intronic
1147537829 17:41332454-41332476 TGGCTTGTGCAAAGGCCCTGAGG - Intergenic
1148910658 17:50940644-50940666 CAGCAAGTGCAGAGGCCCTGTGG - Intergenic
1149494412 17:57108066-57108088 CTGCTTCTGCAGGCACCCTGGGG + Intronic
1150132484 17:62676606-62676628 CTGTTTATGGGGAAGCCCTGGGG - Intronic
1150253341 17:63722595-63722617 CAGCTTCTGCAGCAGCCCTAAGG - Intronic
1151440726 17:74127145-74127167 CAGCATGTGCAAAGGCCCTGTGG - Intergenic
1151893143 17:76963033-76963055 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1151959811 17:77399754-77399776 CTGATTCTGCAGAAGCCCCAGGG - Intronic
1152316485 17:79583626-79583648 CTGCCTGTGCAAAGGCCCTGAGG + Intergenic
1152656614 17:81522884-81522906 CTGCATGTGCAAAGGTCCTGGGG + Intronic
1153526344 18:5998330-5998352 CTGCGTCTGCAGAGGCTCTGTGG + Intronic
1155187900 18:23403483-23403505 CGGCATGTGCAAAGGCCCTGTGG + Intronic
1155313105 18:24544370-24544392 CTTGTTTTGCAGAAGCTCTGGGG - Intergenic
1156465665 18:37346744-37346766 CTGCTTGTGCAGAAGCCCTGGGG + Intronic
1157514275 18:48299738-48299760 CAGCATGTGCAAAGGCCCTGTGG + Intronic
1157815263 18:50725410-50725432 CTGCTCCTGAGGAAGCCCTGAGG - Intronic
1158408060 18:57177973-57177995 CTGCATGTGCAAGTGCCCTGAGG + Intergenic
1158477175 18:57790541-57790563 CCGCATGTGCAAAGGCCCTGGGG - Intronic
1158629105 18:59096527-59096549 CTGTTTGTTCAGAAACCGTGTGG - Intergenic
1158926569 18:62270139-62270161 CTGCTGCTTCAGAAGCCATGTGG - Intronic
1159910102 18:74138005-74138027 GTCCTTGTGCAGAAACCGTGGGG - Intronic
1160004984 18:75063065-75063087 CTTCTTCTGCAGAAGCGCTCAGG - Intronic
1160752038 19:738913-738935 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1160856712 19:1221094-1221116 CTGCTGGACCAGAGGCCCTGTGG - Intronic
1161098739 19:2409707-2409729 CAGCATGTGCAAAGGCCCTGGGG + Intronic
1161128758 19:2575448-2575470 CTGCGTGTCCACACGCCCTGAGG - Intronic
1161154632 19:2726320-2726342 CAGCATGTGCAAAGGCCCTGGGG - Intronic
1161164408 19:2778455-2778477 CAGCACGTGCAAAAGCCCTGGGG - Intronic
1161222839 19:3125969-3125991 CAGCTTGTGCAAAGGTCCTGGGG + Intergenic
1161226176 19:3146986-3147008 CAGCTTGTGCAAAGGCCCTGGGG - Intronic
1161258915 19:3324807-3324829 CAGCCTGTGCAAAGGCCCTGGGG - Intergenic
1161267514 19:3371286-3371308 CTGAATCTGCAGCAGCCCTGAGG - Intronic
1161397640 19:4052851-4052873 CAGCCAGTGCAGAGGCCCTGAGG - Intronic
1161416807 19:4151829-4151851 CAGTTTGTGCAAAGGCCCTGAGG - Intergenic
1161427300 19:4210544-4210566 CTGGTGGTGCAAAGGCCCTGAGG - Intronic
1161506350 19:4645931-4645953 CAGCCTGTGCAAAGGCCCTGGGG - Intronic
1161519355 19:4714927-4714949 CAGCATGTGCAAAGGCCCTGCGG - Intronic
1161522252 19:4731111-4731133 CAGCCTGTGCAAAGGCCCTGCGG - Intergenic
1161533840 19:4806583-4806605 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161605655 19:5213378-5213400 CAGCCTGGGCAGAGGCCCTGGGG - Intronic
1161644318 19:5443903-5443925 TAGCTTGTGCAAAGGCCCTGAGG + Intergenic
1161650343 19:5480478-5480500 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161658828 19:5533442-5533464 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161664236 19:5565220-5565242 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1161858149 19:6777597-6777619 CTGCCAGTGCAAAGGCCCTGAGG + Intronic
1161874137 19:6894518-6894540 CAGCATGTGCAAAGGCCCTGTGG + Intronic
1161977526 19:7614740-7614762 CAGCTAGTGCCGAGGCCCTGAGG - Intronic
1162064914 19:8119438-8119460 CAGCATGTGCAAAGGCCCTGGGG - Intronic
1162101883 19:8343638-8343660 CAGCATGTGCAGAGGCCCTGCGG - Intronic
1162124262 19:8490781-8490803 CTGCTTGTGCTGCCGCCCTTGGG + Intronic
1162152902 19:8658091-8658113 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1162153118 19:8659457-8659479 CTGCAGGTGCCGAGGCCCTGCGG + Intergenic
1162156367 19:8680856-8680878 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1162309400 19:9896611-9896633 TTGCTTATGCAAAGGCCCTGGGG - Intronic
1162309792 19:9899407-9899429 CTGCATGTGCAGAGGCCCTGAGG - Intronic
1162400655 19:10444631-10444653 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1162429903 19:10622145-10622167 CAGCTAGTGCAAAGGCCCTGAGG + Intronic
1162822758 19:13233179-13233201 CTGCCTGTGTAAAGGCCCTGAGG - Intronic
1162829986 19:13278359-13278381 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1162832507 19:13294982-13295004 CAGCATGTGCAAAGGCCCTGGGG - Intronic
1162850981 19:13430950-13430972 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1162856502 19:13472578-13472600 CAGCATGTGCAAAGGCCCTGGGG - Intronic
1162857112 19:13477146-13477168 CAGCTGGTGCAAAGGCCCTGAGG - Intronic
1162924309 19:13922381-13922403 CTGCATGTGCAAAGGCCCTGAGG - Intronic
1162963763 19:14145586-14145608 CAGCCGGTGCAAAAGCCCTGAGG + Intergenic
1162988613 19:14288035-14288057 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1163345797 19:16741267-16741289 CAGCATGTGCAAAGGCCCTGTGG - Intronic
1163479189 19:17544593-17544615 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1163484104 19:17576402-17576424 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1163576185 19:18112123-18112145 CTGCATGTGCAAAGGTCCTGTGG + Intronic
1163627955 19:18401677-18401699 CAGCATGTGCAAAGGCCCTGTGG + Intergenic
1163670874 19:18627754-18627776 CTGCATGTGCAAAGGCCCTGGGG - Intergenic
1163695399 19:18761079-18761101 CTACATGTGCAGAGGCCCTGAGG - Intronic
1163704340 19:18803646-18803668 GAGCTTGTGCAAAGGCCCTGGGG + Intergenic
1163720873 19:18897636-18897658 CAGCTAGTGCAAAGGCCCTGAGG - Intergenic
1163748098 19:19059909-19059931 GGGCTTGTGCAAAGGCCCTGGGG - Intronic
1163770179 19:19186274-19186296 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1163808750 19:19417109-19417131 CTGCTTCGGCAGATACCCTGTGG + Intronic
1164235410 19:23328410-23328432 CAGCTGGTACAAAAGCCCTGAGG + Intronic
1164269583 19:23659784-23659806 CTGCTTTTCCAGAGGCCCAGAGG + Intronic
1164892787 19:31839391-31839413 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1165323891 19:35102872-35102894 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1165462233 19:35950830-35950852 GGGCTTTTGCAGAAGCCCAGGGG + Intergenic
1165951263 19:39475008-39475030 CTGCATGTGCAGAGGCCTGGAGG + Intronic
1165996434 19:39847089-39847111 CTGCAGATGCAGAGGCCCTGAGG + Intergenic
1166240896 19:41493004-41493026 CTGCACGTGCAAAGGCCCTGAGG + Intergenic
1166767769 19:45262690-45262712 CAGCTTGTGCAAAGGCCCTGAGG + Intronic
1166840896 19:45696261-45696283 CAGCAAGTGCAGATGCCCTGAGG - Intronic
1166934110 19:46320741-46320763 CTGCATGTGCAAAGGCCCTGAGG - Intronic
1167004461 19:46766649-46766671 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1167108078 19:47442494-47442516 CAGCCAGTGCAAAAGCCCTGAGG - Intronic
1167154746 19:47731107-47731129 CAGCATGTGCAAAGGCCCTGGGG + Intronic
1167400043 19:49259639-49259661 CTGCTTCTGCTGAAGGCCTCAGG - Intergenic
1167487889 19:49773832-49773854 CTGCCTGTGCAAAGGCCCTGAGG + Intronic
1167517510 19:49931717-49931739 CTGTATATGCAGAAGCCCTCAGG + Intronic
1167562226 19:50232784-50232806 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1167599789 19:50447940-50447962 CAGCGTGTGCAAAGGCCCTGAGG - Intronic
1167631182 19:50627189-50627211 CAGCCTGGGCAGATGCCCTGAGG - Intronic
1167654789 19:50756462-50756484 CAGCTTGTGCAAAGGTCCTGAGG - Intergenic
1167702071 19:51054716-51054738 CAGCTAGTGCAAAGGCCCTGAGG - Intergenic
1167708590 19:51096920-51096942 CTGCTGGTGCAAAAGCCTGGAGG - Intergenic
1167794499 19:51700878-51700900 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1168229980 19:55024741-55024763 CTACTGAAGCAGAAGCCCTGGGG + Intronic
1168324070 19:55529451-55529473 CAGCAAGTGCAGAGGCCCTGGGG + Intergenic
1168481278 19:56722387-56722409 CTGCATGTGCAAAGGTCCTGAGG - Intergenic
1168719747 19:58548552-58548574 CTGCTTGCTCAGGGGCCCTGGGG - Exonic
925306421 2:2850485-2850507 GGGCTTCTGCAGAAACCCTGAGG - Intergenic
926219931 2:10928556-10928578 CAGCATGTGCAAAAGCCCTGTGG - Intergenic
926581346 2:14634550-14634572 CTGGTGGTGCAGAACGCCTGCGG + Exonic
927824881 2:26301426-26301448 CTGCCTGTGCAGAAGCCAAATGG + Intergenic
928256021 2:29723263-29723285 CTGCCAGTGCAAAGGCCCTGGGG - Intronic
929454441 2:42055961-42055983 GTCCTTCTGCTGAAGCCCTGGGG + Intronic
929596830 2:43181315-43181337 CAGCATGTACAAAAGCCCTGAGG + Intergenic
929887451 2:45891613-45891635 CGGCTTCTGTAGAAGACCTGGGG + Intronic
931932192 2:67151193-67151215 CTGCTTTTGCAGTATCCCTTTGG - Intergenic
933992067 2:87640928-87640950 CAGCTTGTGCAAAGGCCCTGGGG + Intergenic
934854858 2:97723377-97723399 CTGCATGCGCAGAGGCCCTGAGG - Intronic
934857169 2:97736729-97736751 CCGCCTGTGCAGAGGCCCTGAGG + Intronic
935277310 2:101486065-101486087 CAGCTTGTGCAAAGGCACTGAGG - Intergenic
936073590 2:109387495-109387517 CAGCATGTGCAAAGGCCCTGTGG - Intronic
936260436 2:110955724-110955746 CAGCCTGTGCAAACGCCCTGAGG - Intronic
936301776 2:111309890-111309912 CAGCTTGTGCAAAGGCCCTGGGG - Intergenic
937225401 2:120366043-120366065 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
937328260 2:121005207-121005229 CAGCCAGTGCAGAGGCCCTGGGG - Intergenic
937476226 2:122217870-122217892 CTGCTTGTTCTTGAGCCCTGTGG + Intergenic
937990015 2:127657051-127657073 CAGCTGGTGCTGATGCCCTGGGG - Intronic
938161439 2:128988054-128988076 CAGCATGTGCAAAAGCCCTTTGG + Intergenic
939677292 2:145088302-145088324 CTGCACGTGCAGAAGCCCAGGGG + Intergenic
941474070 2:165926509-165926531 CAGCTGGTGCAGAAGCCCAAAGG - Intronic
941787446 2:169513842-169513864 CTCCTTGTGCCCATGCCCTGGGG - Intronic
942302305 2:174573649-174573671 CAGCAGGTGCAGAGGCCCTGAGG + Intronic
942659622 2:178250609-178250631 CAGCCGGTGCAGAAGCCCTGAGG - Intronic
946137173 2:217656928-217656950 CTGCTTCTGCAGCAGCCTTCAGG - Intronic
946352711 2:219165723-219165745 CTGCATATGCAAAGGCCCTGTGG - Intronic
946436008 2:219654910-219654932 CTGCTTCTGGTGAAGCCCTCAGG + Intergenic
947386493 2:229595727-229595749 CTGCCGGTGCAAAGGCCCTGGGG - Intronic
947708997 2:232299480-232299502 CAGTGAGTGCAGAAGCCCTGGGG - Intronic
948058792 2:235028830-235028852 CTGCATGTGCAAAGGCCCCGTGG + Intronic
948173745 2:235927355-235927377 ATGCTGGTGCAGCAGCTCTGAGG - Intronic
948254434 2:236555866-236555888 TTGCTTCTACAGAAGCCCTGTGG - Intergenic
948433273 2:237934341-237934363 CTGCAGGTGCAAAGGCCCTGGGG - Intergenic
948547206 2:238741426-238741448 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
948723792 2:239919742-239919764 CTGCAGGTGGAGAAGCCCTTTGG - Intronic
948983123 2:241505155-241505177 CTGCTTCTGCAGATCACCTGAGG - Intronic
1168829645 20:838662-838684 CAGCTGGTGCAAAAGCCCTGAGG + Intronic
1168908411 20:1425415-1425437 CAGCAAGTGCAGAGGCCCTGGGG - Intergenic
1169291674 20:4358583-4358605 GTACTTTTGCACAAGCCCTGTGG + Intergenic
1169563294 20:6825412-6825434 CAGCATGTGCAAAAGGCCTGAGG + Intergenic
1169717158 20:8632704-8632726 CAGCAGGTGCAAAAGCCCTGAGG + Intronic
1169737652 20:8854332-8854354 TTGCTTGTTCAGAGCCCCTGAGG - Intronic
1169853505 20:10078604-10078626 CTGCTTGGGAAAAAGCCCTCTGG - Intergenic
1170183224 20:13556694-13556716 CTGCATGTGCAGAGGCCCTGTGG - Intronic
1170541010 20:17388046-17388068 CAGCTTGTGCAAAGACCCTGAGG + Intronic
1170580334 20:17694392-17694414 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1171147449 20:22797746-22797768 TTGTTTGTGCAAAGGCCCTGAGG - Intergenic
1171180757 20:23088855-23088877 CAGCATGTACAGAAGCCCTGGGG + Intergenic
1171250851 20:23645908-23645930 CAGTTTGTGCAAAGGCCCTGAGG - Intergenic
1171390941 20:24801386-24801408 CTGTTTGTCCAGAGGCCCTCAGG + Intergenic
1172189706 20:33054571-33054593 CCGCATGTGCAAAGGCCCTGGGG + Intergenic
1172359186 20:34300508-34300530 CTGCTTGGGTTAAAGCCCTGAGG - Intronic
1172765557 20:37348890-37348912 GTGCATGTGCAAAGGCCCTGAGG + Intronic
1172831375 20:37838131-37838153 CAGCAAGTGCAGAAGCCCCGAGG + Intronic
1172890157 20:38258672-38258694 CAGCATGTGCAAAGGCCCTGGGG + Intronic
1172916306 20:38446614-38446636 CTGCTTGGGCAGGGGCCCGGCGG + Intergenic
1173968135 20:47129457-47129479 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1174056701 20:47803143-47803165 CCGCATGTGCAAAGGCCCTGTGG + Intergenic
1174123790 20:48287927-48287949 CTGCTTGTGCAAAGGCCCTGGGG + Intergenic
1174163897 20:48571151-48571173 CTGCAAGTGCAAAGGCCCTGAGG + Intergenic
1174189646 20:48731169-48731191 CTGCGTGTGCAAAGGCCCTGAGG - Intronic
1174200667 20:48804480-48804502 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1174268213 20:49347367-49347389 CAGCGTGTGCAAAGGCCCTGAGG - Intergenic
1174373558 20:50110847-50110869 CTGTTAGTGCAAAGGCCCTGTGG - Intronic
1174374120 20:50114073-50114095 CAGCTTGTGCAAAGGCCCTTGGG + Intronic
1174410562 20:50332228-50332250 CTGCATGTGCAGAGGTCCCGAGG - Intergenic
1174567733 20:51478856-51478878 TGGCTTGTGCAAAGGCCCTGAGG - Intronic
1174571042 20:51501495-51501517 CAGCCAGTGCTGAAGCCCTGAGG - Intronic
1174802455 20:53575792-53575814 CTGACTGTTCAGAAGCCCTATGG - Exonic
1175165404 20:57040237-57040259 CTGCATGTGCAGAGGCCTTGTGG + Intergenic
1175225140 20:57440190-57440212 CAGCGTGTGCAAAGGCCCTGGGG - Intergenic
1175261504 20:57677057-57677079 CTGCATGTGCAAAGGCCTTGGGG - Intronic
1175314592 20:58038604-58038626 CTGCAGGTGCAAAGGCCCTGGGG - Intergenic
1175321805 20:58093403-58093425 CTGCTGGATCAGAAGCTCTGGGG - Intergenic
1175417419 20:58811021-58811043 CAGCATGTGCAAAGGCCCTGGGG - Intergenic
1175450988 20:59067944-59067966 CTCCATGTACAGAGGCCCTGGGG + Intergenic
1175576776 20:60066312-60066334 AAGCTTGTGCAAAGGCCCTGTGG - Intronic
1176266256 20:64210999-64211021 CTGCCTGTGCGGAAGCCCTGAGG - Intronic
1176370414 21:6058837-6058859 GTGTGTGTGCAGGAGCCCTGAGG + Intergenic
1177411929 21:20740158-20740180 TTGCTTGTGCAGCTGCCCAGTGG + Intergenic
1178425310 21:32474368-32474390 CAGCTTGTGCAAAGGCCCAGGGG - Intronic
1179455367 21:41495837-41495859 CAGCAGATGCAGAAGCCCTGGGG - Intronic
1179753105 21:43479704-43479726 GTGTGTGTGCAGGAGCCCTGAGG - Intergenic
1180801130 22:18632442-18632464 CTGCTTATGCAGAGGCACTGGGG + Intergenic
1180852360 22:19028001-19028023 CTGCTTATGCAGAGGCACTGGGG + Intergenic
1181079402 22:20403954-20403976 CAGCATGTGCAGAAGCTCAGAGG - Intronic
1181220590 22:21362819-21362841 CTGCTTATGCAGAGGCACTGGGG - Intergenic
1181746020 22:24955482-24955504 TAGCTTGTGCAGAAGCCTGGAGG + Intronic
1181786468 22:25230947-25230969 CAGCATGTGCAAAGGCCCTGTGG + Intronic
1181818638 22:25458773-25458795 CAGCATGTGCAAAGGCCCTGTGG + Intergenic
1181972068 22:26698374-26698396 CAGCATGTGCAAAGGCCCTGTGG - Intergenic
1182275979 22:29188942-29188964 CTGTCTGAGCAGAGGCCCTGAGG + Intergenic
1182360899 22:29745853-29745875 CAGAGTGAGCAGAAGCCCTGGGG + Intronic
1182426276 22:30274607-30274629 CGGCATGTGCAAAGGCCCTGAGG - Intergenic
1182706393 22:32283232-32283254 CTGCAAGTGCAAAGGCCCTGGGG - Intergenic
1182709375 22:32310995-32311017 CAGCTAGTGCAAAGGCCCTGTGG - Intergenic
1183097342 22:35560997-35561019 CAGCATGTGCAAAAGTCCTGTGG - Intergenic
1183236437 22:36622289-36622311 CTGCATTTCCACAAGCCCTGCGG - Intronic
1183251289 22:36732141-36732163 CGGCTGGTGCAAAGGCCCTGCGG - Intergenic
1183251369 22:36732734-36732756 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1183324673 22:37184781-37184803 CAGCTGGTGCAGGGGCCCTGGGG - Intronic
1183334868 22:37240843-37240865 CAGCTTGAGCAAAGGCCCTGGGG + Intronic
1183367729 22:37416212-37416234 CTGCTTCAGGAGAACCCCTGGGG + Intronic
1183384104 22:37505113-37505135 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1183390130 22:37540990-37541012 CTGCCTGTGCAAATGCCCAGAGG - Intergenic
1183565617 22:38612411-38612433 CAGCATGTGCAAAGGCCCTGAGG - Intronic
1183602291 22:38846937-38846959 CCGCTAGTGCAAAGGCCCTGGGG + Intergenic
1184074036 22:42164853-42164875 CTGTGTGTGCAGAAGCCCAGAGG + Intronic
1184302569 22:43570869-43570891 CTTGCTGTGCAGAAGGCCTGGGG - Intronic
1184419299 22:44370277-44370299 CAGTTTGTGCAAAAGCCCTGAGG + Intergenic
1184657511 22:45949237-45949259 CTGCCTGTGCACAGCCCCTGAGG - Intronic
1184742433 22:46436789-46436811 CAGCTGGTGCAAAGGCCCTGGGG - Intronic
1184876858 22:47281785-47281807 CTGCCTGTGCAGAAGAGGTGGGG - Intergenic
1184967928 22:47995257-47995279 GTGCGTGTGCAGCAGGCCTGTGG + Intergenic
949387327 3:3517618-3517640 CTGCTTCTGGTGAAGCCCTCAGG - Intergenic
949868849 3:8570057-8570079 ATGCATGTGCAAAGGCCCTGTGG + Intergenic
949870475 3:8583717-8583739 CTGCTTCTGGACCAGCCCTGGGG + Intergenic
949871776 3:8595362-8595384 CTGCTTGTACAGGGTCCCTGGGG - Intergenic
950199979 3:11035901-11035923 CAGCTTGTGCAAAGGCCCAGCGG + Intronic
950478439 3:13228766-13228788 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
950532662 3:13561529-13561551 CAGTATGTGCAAAAGCCCTGAGG - Intronic
950556894 3:13701414-13701436 CTGCAAGTGCAAAGGCCCTGTGG - Intergenic
950659840 3:14460507-14460529 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
951284323 3:20790795-20790817 CTGCTTGTGGTGAAGCAGTGAGG - Intergenic
951861022 3:27252754-27252776 CTGCATGTGCAAAGGCCCTGTGG + Intronic
951868437 3:27333646-27333668 TTGCTTGTGCCTAAGCCCTGAGG - Intronic
951868469 3:27333829-27333851 TTGCTTGTTCCTAAGCCCTGGGG - Intronic
952406886 3:33013127-33013149 CAGCTTGTGCAAAGGCCATGGGG - Intronic
952970021 3:38644887-38644909 CTGCAAGTGCAAAGGCCCTGAGG - Intronic
953019733 3:39105888-39105910 CAGCTTGTGCAGAGGCCCCGAGG - Intronic
953691147 3:45120767-45120789 CAGCATGTGCAAAGGCCCTGAGG - Intronic
954008645 3:47614996-47615018 CAGCCAGTGCAGAGGCCCTGAGG - Intronic
954663862 3:52240085-52240107 CTGCATGTGCAAAGGCCCAGAGG + Intergenic
954778756 3:53044846-53044868 CTCCTTGAGCACAAGCTCTGGGG + Intronic
954881093 3:53836417-53836439 CAGCATGTGCAAAGGCCCTGGGG - Intronic
954943176 3:54393591-54393613 CTGCTTCTGCTTAAGCTCTGAGG - Intronic
955103411 3:55873716-55873738 CTGCCTATGCAAAGGCCCTGTGG - Intronic
955498547 3:59561809-59561831 CTGCTTGTGCAGCAGCACTTTGG - Intergenic
955540741 3:59973419-59973441 CAGCATGTGCAGAGGGCCTGTGG - Intronic
955703581 3:61705802-61705824 ATGCTTGAGCAGAGGCCGTGAGG + Intronic
955796698 3:62644684-62644706 CAGCTTGTGCAAAGGTCCTGTGG - Intronic
956188175 3:66582450-66582472 CTGCTTGTGAACAAGCCCCTCGG + Intergenic
956285987 3:67610765-67610787 CTCCATGTGATGAAGCCCTGTGG - Intronic
956780219 3:72597632-72597654 CAGCAAGTACAGAAGCCCTGGGG + Intergenic
956878586 3:73488439-73488461 CAGCCTGTGCAGAGACCCTGTGG - Intronic
957073130 3:75581041-75581063 CAGCGTGTGCAAAAGCCCAGAGG + Intergenic
958637753 3:96766435-96766457 CTCCTTGTGCAGACACCCTTGGG - Intergenic
958809270 3:98840960-98840982 TTGCTTCAGCAGAATCCCTGAGG - Intronic
959937761 3:112047396-112047418 TTGCTCTTGCAGAAGTCCTGGGG + Intronic
960068100 3:113397266-113397288 TAACTTGTGCAGAAGTCCTGTGG + Intronic
960338130 3:116443633-116443655 CTGATAGTGCATAAACCCTGGGG - Intronic
961107532 3:124254902-124254924 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
961280952 3:125765739-125765761 CAGCGTGTGCAAAAGCCCAGAGG - Intergenic
961451922 3:127006067-127006089 CTGCTCGTGCAGGAGACCAGCGG + Exonic
961490495 3:127253920-127253942 CAGCCTGTGCAGAGACCCTGAGG - Intergenic
961552067 3:127675095-127675117 CTGCAGGTGCAAAGGCCCTGGGG - Intronic
961636358 3:128335440-128335462 CTGCAGGTGCAGAGGCCATGAGG + Intronic
961728826 3:128952052-128952074 CTGCATGTGTAGCAGGCCTGTGG - Intronic
961786262 3:129348884-129348906 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
961823014 3:129584862-129584884 CTGCCAGTGCAAAGGCCCTGAGG - Intronic
961873441 3:130003846-130003868 CAGCGTGTGCAAAAGCCCAGAGG + Intergenic
962408902 3:135124162-135124184 CGGCATGTGCAAAGGCCCTGAGG - Intronic
963045902 3:141102564-141102586 CAGCATGTGCAAAGGCCCTGTGG + Intronic
963068457 3:141282245-141282267 CAGTTTGTGCAAAGGCCCTGAGG - Intronic
963255938 3:143145043-143145065 CTGCAAGTGCAAAGGCCCTGAGG - Intergenic
963591575 3:147267366-147267388 CTGCTTGTCAACAAGCCCTTTGG + Intergenic
964764983 3:160170934-160170956 CAGCATGTGCAAAGGCCCTGGGG + Intergenic
965953178 3:174335370-174335392 CTGCATGTGTAGAAGTCCTGAGG - Intergenic
966044808 3:175534954-175534976 CTACTTGTTCAGAAGTCCTCAGG + Intronic
967373185 3:188771982-188772004 CTCCTTGTGCAGAAATTCTGGGG - Intronic
967820194 3:193832946-193832968 CTGCTTGTGCAAATGTCCCGTGG + Intergenic
968543174 4:1178539-1178561 CTGCACGTGCAAAGGCCCTGAGG - Intronic
968811876 4:2803727-2803749 TAGCTTGTGCAAAGGCCCTGGGG - Intronic
968861520 4:3175250-3175272 TAGCTGGTGCAGAAGGCCTGGGG + Intronic
968977956 4:3831517-3831539 CTCCTTGTGCCCCAGCCCTGTGG + Intergenic
969016737 4:4108335-4108357 CAGCGTGTGCAAAAGCCCAGAGG + Intergenic
969050200 4:4367644-4367666 CTGTTGATGCAGGAGCCCTGTGG + Intronic
969155845 4:5209089-5209111 CTCCATGTGCAGAAGTGCTGAGG - Intronic
969345512 4:6567412-6567434 CTGCAAGTGCAAAGGCCCTGAGG - Intergenic
969465869 4:7356044-7356066 CAGCTGGTGCAAAGGCCCTGGGG - Intronic
969544911 4:7819629-7819651 CAGCTGGTGAAAAAGCCCTGCGG + Intronic
969565187 4:7973158-7973180 GTGCATGTGCAAAGGCCCTGGGG + Intronic
969737229 4:8999980-9000002 CAGCGTGTGCAAAAGCCCAGAGG - Intergenic
969796424 4:9531568-9531590 CAGCGTGTGCAAAAGCCCAGAGG - Intergenic
970007105 4:11422044-11422066 CTGCTTGTGCAAAAGCACTCTGG - Intronic
970675921 4:18450288-18450310 GAGCTTGTTCAAAAGCCCTGTGG + Intergenic
970827173 4:20290006-20290028 CTGCATGTGCAAAGACCCTGTGG - Intronic
971225942 4:24751695-24751717 CTGTCTGTGCAAAGGCCCTGAGG - Intergenic
971354227 4:25879792-25879814 CAGCTCGTGCAAAGGCCCTGTGG - Intronic
971584342 4:28386139-28386161 CTGCTTGTGCTTAATCCCAGTGG + Intronic
972047103 4:34680176-34680198 TTGCATTTGCAGAAGGCCTGGGG + Intergenic
972294464 4:37723275-37723297 CTGCATGTTCAAAGGCCCTGTGG - Intergenic
973840944 4:54859988-54860010 CAGCTTACACAGAAGCCCTGTGG + Intergenic
974353497 4:60781340-60781362 ATGCTTTTACAAAAGCCCTGTGG - Intergenic
975403624 4:73965285-73965307 CTGCCAGTGCAGAAGCTATGGGG + Intergenic
976116946 4:81738045-81738067 CAGCTTGTGCAAAGGCCCTGTGG - Intronic
976269195 4:83213783-83213805 CTGCATGTGCAAAGGTCCTGAGG + Intergenic
976604594 4:86970816-86970838 GAGCTTGTGCATAGGCCCTGAGG + Intronic
980267824 4:130542855-130542877 CTTCTTGCGCAGAAGCATTGAGG + Intergenic
981047547 4:140279115-140279137 CAGCTTGTGCAAAGGCCCTGTGG - Intronic
981646639 4:147005815-147005837 CAGCTAGTGCGAAAGCCCTGTGG + Intergenic
984599420 4:181709550-181709572 CTGCAAGTGCAAAGGCCCTGTGG + Intergenic
986445767 5:7819916-7819938 CTGCTTGGTCAGCAGCTCTGGGG - Intronic
986537278 5:8803712-8803734 CTGCTTTTGCTGAATCCCAGAGG + Intergenic
987009003 5:13740685-13740707 CAGCTAATGCAGAGGCCCTGAGG - Intronic
988502296 5:31793381-31793403 CTGCAGGTGCAAAGGCCCTGGGG - Intronic
988816015 5:34835862-34835884 CAGCAAGTGCAAAAGCCCTGAGG - Intergenic
989689821 5:44127920-44127942 CTACTTGTGCAGAAGTTCGGAGG + Intergenic
990042186 5:51388819-51388841 CTGCTTGTGGGGAAGCACAGAGG + Intronic
990794339 5:59523208-59523230 CTGCAAAAGCAGAAGCCCTGTGG + Intronic
991728305 5:69559184-69559206 CTGCAAGTGCAAAGGCCCTGAGG - Intergenic
991804734 5:70414331-70414353 CTGCAAGTGCAAAGGCCCTGAGG - Intergenic
991866650 5:71068691-71068713 CTGCAAGTGCAAAGGCCCTGAGG + Intergenic
992178916 5:74177805-74177827 CAGCAAGTGCAGAGGCCCTGTGG - Intergenic
992245788 5:74820946-74820968 CTGAAAATGCAGAAGCCCTGAGG - Intronic
995600593 5:113791164-113791186 CTGCTCTTGCTGAAGCCCTCTGG + Intergenic
995994729 5:118284104-118284126 TTGCTTGTGCAAAGGCCCTGGGG + Intergenic
996184273 5:120457474-120457496 CCACTTGTCCAGAAACCCTGAGG - Intergenic
997101689 5:130976271-130976293 CTGGTTGTGCAGCAGCACAGTGG + Intergenic
997341642 5:133149803-133149825 CTGTCTGGGCAGCAGCCCTGCGG + Intergenic
998000403 5:138620646-138620668 CTGCTTGATCAGAGACCCTGAGG - Intronic
998384127 5:141746573-141746595 CAGTTTGTGCAAAGGCCCTGTGG + Intergenic
998522739 5:142815661-142815683 CAGCCTGTGCAAAGGCCCTGTGG - Intronic
998545798 5:143026536-143026558 CAACATGTGCAGAGGCCCTGAGG + Intronic
999147502 5:149406025-149406047 ATGCAAGTGCAAAAGCCCTGAGG + Intergenic
999296306 5:150461560-150461582 CTGCTGGTGCAGCATCCCCGGGG + Intergenic
999323911 5:150631428-150631450 CAGCCAGTGCAGAGGCCCTGAGG + Intronic
999447034 5:151648335-151648357 CAGCTTGCGCAAAGGCCCTGAGG + Intergenic
999724175 5:154421293-154421315 CAGCTAGTGCAAAGGCCCTGAGG + Intergenic
999922377 5:156335722-156335744 CTGCTTATGCTGAAACCTTGGGG + Intronic
999971132 5:156864526-156864548 CTGTATGTGCAAAGGCCCTGAGG + Intergenic
1000022293 5:157328479-157328501 CTGCTTGTGCAAGGACCCTGCGG + Intronic
1000382438 5:160641251-160641273 CTGTATATGCAAAAGCCCTGTGG + Intronic
1000986827 5:167869640-167869662 CTGCTAGTGCAGAAGCTGCGAGG - Intronic
1001284508 5:170412733-170412755 CATCTGGTGCAGAGGCCCTGAGG - Intronic
1001400759 5:171445159-171445181 CGACATGTGCAAAAGCCCTGTGG + Intronic
1001563859 5:172687071-172687093 CTGCCTGGGCTGAGGCCCTGTGG - Exonic
1001635722 5:173208715-173208737 CAGCTCGTGCAAAGGCCCTGAGG - Intergenic
1001654591 5:173339912-173339934 GTGCAAGTGCAGAGGCCCTGGGG + Intergenic
1001698833 5:173692062-173692084 CTGCCTGTGCAAAGGCCCTGAGG + Intergenic
1001742413 5:174064952-174064974 CAGCTTGTGCAAAGGCCCTGAGG + Intronic
1001747084 5:174100146-174100168 CTGCTTGGGCAGAATCCCATGGG + Intronic
1002048274 5:176554210-176554232 CTGTGTGTGGAGGAGCCCTGGGG - Intronic
1002063172 5:176638624-176638646 CTGCAAGTGCAAAGGCCCTGAGG + Intronic
1002415132 5:179116365-179116387 TTGCATGTGCAAAGGCCCTGTGG - Intronic
1003169440 6:3709543-3709565 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1003444441 6:6171844-6171866 CTGTATGTGCAAAGGCCCTGGGG - Intronic
1003973235 6:11319098-11319120 GTGGTTGTGCAGATGCCATGTGG + Intronic
1004052329 6:12098297-12098319 CTGCTTTGACAGAATCCCTGAGG + Intronic
1004145118 6:13058761-13058783 GAGCTTGTGCAAAGGCCCTGTGG + Intronic
1004796309 6:19089622-19089644 CAGCTTGTGCAAAGACCCTGTGG + Intergenic
1005016554 6:21380092-21380114 CAGCATCTGCAAAAGCCCTGGGG - Intergenic
1005194455 6:23266723-23266745 CAGCTGGTGAAGCAGCCCTGAGG + Intergenic
1005354443 6:24969047-24969069 GTGCTTGTGAAAAAGCCCTTAGG + Intronic
1005734151 6:28730039-28730061 CGGCTGGTGGAGAAGCCCCGAGG - Intergenic
1006427796 6:33976968-33976990 CAGCCAGTGCAGAGGCCCTGAGG - Intergenic
1006781629 6:36636391-36636413 CAGCATGTGCAAAGGCCCTGGGG + Intergenic
1007218788 6:40262306-40262328 CTGCTGGAGCAGATTCCCTGGGG + Intergenic
1007348371 6:41250245-41250267 CTGCATGTGCAAAGGTCCTGAGG + Intergenic
1007384994 6:41514448-41514470 CTGCTTGTGCAATGGTCCTGAGG - Intergenic
1008326217 6:50185146-50185168 CTGGTTGAGCAGAAGTCCTCAGG - Intergenic
1010007341 6:71010423-71010445 TCTCTTGTGCAGAAGACCTGAGG + Intergenic
1010181062 6:73086923-73086945 CAGCTTGTGCAAAGGCCCTGAGG + Intronic
1010611548 6:77959785-77959807 CAGCTAGTGCAAAGGCCCTGAGG - Intergenic
1013301290 6:108807336-108807358 CTACCAGTGCAGAAACCCTGGGG - Intergenic
1013781122 6:113729638-113729660 CAGCAAGTGCAAAAGCCCTGAGG - Intergenic
1015209947 6:130685672-130685694 CAGCTTGTGCAAAGGTCCTGGGG + Intergenic
1016097914 6:140060798-140060820 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1017241814 6:152178863-152178885 CTGATTGTTCACAAGCACTGTGG + Intronic
1017752394 6:157500207-157500229 CAGCTAGTGCAAAGGCCCTGAGG + Intronic
1018342204 6:162862815-162862837 CTGCTTGTGCAGACTGGCTGGGG + Intronic
1018446988 6:163867134-163867156 CTGCTTATGAAGAATCCCGGAGG + Intergenic
1018715953 6:166532885-166532907 AAGCTTGTGGTGAAGCCCTGGGG + Intronic
1018728833 6:166633993-166634015 CAGCTTGCGCAAAGGCCCTGGGG + Intronic
1019540584 7:1549487-1549509 CTGCCTGGCCAGAAGCCCTGGGG + Intronic
1019911600 7:4103732-4103754 CTGCTTGTGGACTTGCCCTGAGG - Intronic
1020112734 7:5456587-5456609 CAGCTTGTGCAAAGGCCCTGGGG + Intronic
1020182954 7:5936358-5936380 ATGCTTGTGAGCAAGCCCTGCGG + Intronic
1020299958 7:6788399-6788421 ATGCTTGTGAGCAAGCCCTGCGG - Intronic
1020382701 7:7564546-7564568 TAGCTAGTGAAGAAGCCCTGAGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1021803601 7:24332931-24332953 CAGCATGTGCAAAGGCCCTGGGG + Intergenic
1021939424 7:25665122-25665144 CTGCCTGTGCAAAGGTCCTGAGG + Intergenic
1022249350 7:28591896-28591918 CAGCAAGTGAAGAAGCCCTGAGG + Intronic
1022422207 7:30234124-30234146 CTACTTGTGGAGAAGGCCTTTGG + Intergenic
1022652143 7:32287331-32287353 CAGCCTGTGCAGAGGCCCTGTGG - Intronic
1022690763 7:32650527-32650549 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1022918329 7:34984361-34984383 CAGCATGTGCAAAGGCCCTGAGG + Intronic
1023570353 7:41565443-41565465 CTGCTTTGGCTGAAGACCTGTGG - Intergenic
1023837084 7:44074514-44074536 CTGGTGGTGCTGGAGCCCTGGGG + Exonic
1023859151 7:44206771-44206793 CTCCTTGAGCAGAAGCACAGGGG - Intronic
1024095872 7:45982415-45982437 GAGGGTGTGCAGAAGCCCTGAGG + Intergenic
1024780173 7:52838398-52838420 CCCCTTGTGCACATGCCCTGAGG - Intergenic
1025155516 7:56602652-56602674 CAGCTGGTACAGAAGCCCTAAGG - Intergenic
1025762752 7:64409891-64409913 CAGTTGGTACAGAAGCCCTGAGG + Intergenic
1026290160 7:68998874-68998896 CTGGTTCAACAGAAGCCCTGAGG - Intergenic
1026390494 7:69896813-69896835 CAGCTTGTGCAAAGGCCTTGAGG - Intronic
1026960288 7:74403695-74403717 CTGCATGTGCCAAGGCCCTGAGG - Intronic
1027617475 7:80441351-80441373 GTGCATGTGCAAAGGCCCTGAGG - Intronic
1028568967 7:92265372-92265394 GTGCGTATGCAGAAGCCCTAAGG + Intronic
1029075206 7:97929135-97929157 CAGCGTGTGCAAAAGCCCAGAGG + Intergenic
1033467452 7:141608406-141608428 CTGCATGTCCAAAGGCCCTGAGG + Intronic
1034162171 7:149001860-149001882 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1034214953 7:149398114-149398136 CTGTTTCTGCAGAAACCCTGTGG - Intergenic
1035763525 8:2086837-2086859 ATGCTTGTGCACAAGCCGTATGG + Intronic
1036242318 8:7091243-7091265 CAGCGTGTGCAAAAGCCCAGAGG - Intergenic
1036258471 8:7222769-7222791 CAGCGTGTGCAAAAGCCCAGAGG + Intergenic
1036259531 8:7228913-7228935 CAGCGTGTGCAAAAGCCCAGAGG + Intergenic
1036307092 8:7610611-7610633 CAGCGTGTGCAAAAGCCCAGAGG - Intergenic
1036308149 8:7616739-7616761 CAGCGTGTGCAAAAGCCCAGAGG - Intergenic
1036310526 8:7681365-7681387 CAGCGTGTGCAAAAGCCCAGAGG + Intergenic
1036311575 8:7687483-7687505 CAGCGTGTGCAAAAGCCCAGAGG + Intergenic
1036359005 8:8064740-8064762 CAGCGTGTGCAAAAGCCCAGAGG - Intergenic
1036658603 8:10693215-10693237 CAGCTTGTGCAAAGGCCCTGTGG - Intronic
1036661704 8:10713494-10713516 CAGCTTATGCAAAAGCACTGGGG + Intergenic
1036830420 8:12015887-12015909 CAGCCTGTGCAAAAGCCCAGAGG + Intergenic
1036891953 8:12602212-12602234 CAGCGTGTGCAAAAGCCCAGAGG + Intergenic
1036893009 8:12608348-12608370 CAGCGTGTGCAAAAGCCCAGAGG + Intergenic
1036899500 8:12660187-12660209 CAGCGTGTGCAAAAGCCCAGAGG + Intergenic
1036900564 8:12666334-12666356 CAGCGTGTGCAAAAGCCCAGAGG + Intergenic
1037231322 8:16662283-16662305 CAGCTTGTGCAAAGGCCATGAGG - Intergenic
1037426986 8:18766827-18766849 CTGCATGTGCAGGTGGCCTGTGG - Intronic
1037446578 8:18971562-18971584 CTCCTTGTGCTGAAGCCCGGGGG - Intronic
1037594714 8:20345449-20345471 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1037733246 8:21547007-21547029 CTGCATGGGCAGAAGCACTGAGG + Intergenic
1037783319 8:21886223-21886245 CTGCTTGTAAAGAATCTCTGCGG + Intergenic
1037788479 8:21917261-21917283 CTGCAAGTGCAAAGGCCCTGAGG + Intergenic
1037820857 8:22133890-22133912 CTGCTGCTGGAGAAGTCCTGGGG - Intergenic
1038570506 8:28658106-28658128 CTGCCCGTGCAGAAGCCACGTGG + Intronic
1039483443 8:37892852-37892874 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1039800233 8:40948201-40948223 CTGCTAGTGCAAAGGCCCAGAGG - Intergenic
1039870885 8:41544158-41544180 CAGCCTGTGCAAAGGCCCTGAGG + Exonic
1040539672 8:48340881-48340903 GTGCTTGAGCAGAAACTCTGGGG + Intergenic
1040614565 8:49021163-49021185 TAGCTTGTGCAAGAGCCCTGAGG - Intergenic
1041298546 8:56387834-56387856 CAGCTTGTGCAAAAACCCTCAGG + Intergenic
1041555417 8:59149124-59149146 CAGCTAGTGCAAAGGCCCTGAGG - Intergenic
1042611022 8:70601304-70601326 CAGCATGTGCAGAGACCCTGTGG - Intronic
1042659829 8:71142220-71142242 CTGCTTGTACAGTAGAACTGGGG + Intergenic
1042798505 8:72690928-72690950 CTGAATGTGTAGAAGTCCTGAGG + Intronic
1043528859 8:81127911-81127933 CAACTTGTGCAAAGGCCCTGAGG + Intergenic
1044387887 8:91611689-91611711 TAGCTTGTGCAAAGGCCCTGAGG + Intergenic
1044710172 8:95049624-95049646 CAGCAAGTGCAAAAGCCCTGTGG - Intronic
1044789762 8:95835355-95835377 CTGCATGTGCAGTAGGCCAGAGG + Intergenic
1045033357 8:98158123-98158145 TTGGCTGTGGAGAAGCCCTGGGG + Exonic
1045036127 8:98177926-98177948 CAGTTCGTGCAGAAGCCCTGCGG + Intergenic
1045219550 8:100185087-100185109 CAGCATGTGCAAAGGCCCTGTGG - Intronic
1045550911 8:103171594-103171616 CTGTTTTTGCAGTTGCCCTGGGG + Intronic
1045771424 8:105744741-105744763 CAGCATGTGCAAAAGGCCTGTGG + Intronic
1046970964 8:120223061-120223083 CTGCATGTGCTAAGGCCCTGAGG + Intronic
1047422278 8:124717063-124717085 GAGCATGTGCAGAAGCCCTGAGG - Intronic
1047495267 8:125404569-125404591 CTGCGTGTGCAAAGGTCCTGTGG + Intergenic
1048293656 8:133198852-133198874 CAGCATGTGCAAAGGCCCTGGGG - Intronic
1048428496 8:134344663-134344685 CAGCATGTGCAAAGGCCCTGAGG + Intergenic
1048804388 8:138226500-138226522 CAGCATGTGCAAAGGCCCTGTGG + Intronic
1049150469 8:141032086-141032108 CTGCCCGTGCAAAGGCCCTGAGG + Intergenic
1049235682 8:141511086-141511108 CAGCGTGTGCAAAGGCCCTGTGG - Intergenic
1049657863 8:143806686-143806708 CTGCCTGTGCACCAGGCCTGGGG - Intronic
1049699881 8:144005717-144005739 CAGCCAGTGCAGACGCCCTGGGG - Intronic
1049827719 8:144680327-144680349 CTCCTTGTGCAGAGGCTGTGCGG - Intergenic
1050027814 9:1354052-1354074 CAGCTAGTGCAAAGGCCCTGGGG + Intergenic
1050285935 9:4102092-4102114 CTTCTGGTGGAGAAACCCTGGGG - Intronic
1051362319 9:16292105-16292127 TGGCTTGTGCAAAGGCCCTGTGG + Intergenic
1052266211 9:26576762-26576784 CTGCTTCTGCTGAAGTCCTTGGG + Intergenic
1052308719 9:27040629-27040651 CTGGCTGTGCAAAAGTCCTGTGG + Intronic
1052990415 9:34516151-34516173 CAGCTGGGGCAGATGCCCTGAGG + Intronic
1053493825 9:38533843-38533865 CTGCAAGTGCACAGGCCCTGGGG - Intergenic
1055069905 9:72155502-72155524 CTGCCTGTGCAAAGGTCCTGGGG + Intronic
1055848663 9:80598211-80598233 GTGCATGTGCAAAGGCCCTGTGG - Intergenic
1057605546 9:96495878-96495900 CTGTTTGTACAGATGCCGTGTGG - Intronic
1057800480 9:98188127-98188149 CAGCTGGGGCAAAAGCCCTGAGG - Intronic
1058169488 9:101663105-101663127 CTGCAGGTGCAGAATCCCCGAGG - Intronic
1058599951 9:106658462-106658484 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1058901883 9:109449208-109449230 CCGCTTGTGCAGAGCCCCTGTGG - Intronic
1059206091 9:112467414-112467436 CTGCTAATGCTGAATCCCTGAGG + Intronic
1059411930 9:114137996-114138018 CTGGTTATGCAAAAGTCCTGGGG - Intergenic
1059449459 9:114361235-114361257 CAGCTTGTGCAAAGGCCCTGTGG - Intronic
1059459142 9:114418671-114418693 CTGCATGTGCAAAGGCCCTGAGG - Intronic
1059859910 9:118448202-118448224 CAGCATGTGCAAAAGCCCTGAGG - Intergenic
1060208211 9:121694865-121694887 AGCCTTGTGCAAAAGCCCTGGGG + Intronic
1060396965 9:123322982-123323004 CTGCATGTGTAGAGACCCTGAGG - Intergenic
1060734278 9:126056507-126056529 CAGCTAGTGCAAAGGCCCTGAGG + Intergenic
1060765436 9:126292178-126292200 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1060936172 9:127517435-127517457 CAGCCTGTGCAAAGGCCCTGGGG - Intronic
1060984030 9:127809678-127809700 CTCCGTGTTCCGAAGCCCTGGGG - Exonic
1061011782 9:127960237-127960259 CAGCAAGTGCAGAGGCCCTGAGG + Intronic
1061392616 9:130326195-130326217 CTACATGTGCACAAGCCCTGAGG - Intronic
1061725186 9:132578718-132578740 CTGCTTGTTCAGAAGCCACCTGG - Intergenic
1062528874 9:136991106-136991128 CAGCATGTGCAGAGGCCCAGGGG + Intergenic
1186237708 X:7531494-7531516 CTGTCTGTGCAAAGGCCCTGGGG + Intergenic
1186925177 X:14325823-14325845 CAGCTAGTGCAAAGGCCCTGAGG - Intergenic
1187243213 X:17531742-17531764 CAGCTTGTGCAAAGGCCCTGTGG - Intronic
1188830040 X:34885237-34885259 CTGGTTCTGGAGAAGCTCTGGGG - Intergenic
1189488115 X:41447975-41447997 CTCTTTGGGCAGAAGCTCTGTGG - Intronic
1192226004 X:69228376-69228398 CTGCATGTACAGAAATCCTGGGG + Intergenic
1194666405 X:96682056-96682078 TAGCATGTGCAGAAGCCCTGTGG - Intergenic
1195304156 X:103562656-103562678 CAGCATGTGCAAAGGCCCTGAGG - Intergenic
1195666732 X:107438324-107438346 CAGCTAGTGCAAAGGCCCTGAGG - Intergenic
1195927532 X:110040738-110040760 CTGCTTGGGCTGAAGTCCTAAGG + Intronic
1198095591 X:133376940-133376962 CTGCTTGTCCAGTTGCTCTGAGG - Intronic
1199719711 X:150534009-150534031 CAGCATGTGCAAAGGCCCTGTGG + Intergenic
1199988485 X:152969765-152969787 CAGCAAGTGCAAAAGCCCTGGGG + Intronic
1201456873 Y:14177875-14177897 TTACTTGTGCAAAGGCCCTGGGG + Intergenic
1201697289 Y:16839991-16840013 ATGCTTGTGCTGAAGCCTTTTGG - Intergenic
1201782797 Y:17741956-17741978 CTGCTTGAGCAGAGGTCATGGGG - Intergenic
1201818756 Y:18164031-18164053 CTGCTTGAGCAGAGGTCATGGGG + Intergenic