ID: 1156466205

View in Genome Browser
Species Human (GRCh38)
Location 18:37349116-37349138
Sequence AGGTGCTGGACACAGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156466191_1156466205 27 Left 1156466191 18:37349066-37349088 CCATGGGGCCTGGAGAGAGCCCT 0: 1
1: 0
2: 5
3: 35
4: 359
Right 1156466205 18:37349116-37349138 AGGTGCTGGACACAGTTTGAAGG 0: 1
1: 0
2: 2
3: 14
4: 203
1156466197_1156466205 8 Left 1156466197 18:37349085-37349107 CCCTGGGAAAAGTCAGGGATGAA 0: 1
1: 0
2: 1
3: 22
4: 298
Right 1156466205 18:37349116-37349138 AGGTGCTGGACACAGTTTGAAGG 0: 1
1: 0
2: 2
3: 14
4: 203
1156466198_1156466205 7 Left 1156466198 18:37349086-37349108 CCTGGGAAAAGTCAGGGATGAAG 0: 1
1: 0
2: 1
3: 43
4: 555
Right 1156466205 18:37349116-37349138 AGGTGCTGGACACAGTTTGAAGG 0: 1
1: 0
2: 2
3: 14
4: 203
1156466194_1156466205 19 Left 1156466194 18:37349074-37349096 CCTGGAGAGAGCCCTGGGAAAAG 0: 1
1: 0
2: 2
3: 41
4: 355
Right 1156466205 18:37349116-37349138 AGGTGCTGGACACAGTTTGAAGG 0: 1
1: 0
2: 2
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156466205 Original CRISPR AGGTGCTGGACACAGTTTGA AGG Intronic
900519601 1:3099168-3099190 GGGTGCTGGACCCAGGTTGAGGG + Intronic
902130118 1:14252921-14252943 AGTTGATGCAAACAGTTTGATGG - Intergenic
902813008 1:18899891-18899913 AGGTGCCAGACACAGTTCCAGGG + Intronic
903488240 1:23707493-23707515 ATGTGCTGGGCACTGTTTAAGGG + Intergenic
904106646 1:28090347-28090369 AGGTTCTGGACAGATTTTGAAGG - Intergenic
906071294 1:43018576-43018598 GGGTGCATGACACAGTGTGATGG + Intergenic
907661322 1:56394998-56395020 AGGTGCTGGAGAGTGGTTGAAGG - Intergenic
907975411 1:59426753-59426775 AGGTTCTAGACACAGTTCTAGGG - Intronic
908022053 1:59908115-59908137 AAGTGCTGGACACCTTTGGATGG + Intronic
908431704 1:64064770-64064792 AGTTGGTGGACAAACTTTGAAGG + Intronic
910447552 1:87314015-87314037 CGGTGCTGTACACTGTGTGAAGG + Intergenic
913961339 1:143339975-143339997 AGGGGCTGGGCACAGCCTGATGG + Intergenic
914055692 1:144165548-144165570 AGGGGCTGGGCACAGCCTGATGG + Intergenic
914123454 1:144800814-144800836 AGGGGCTGGGCACAGCCTGATGG - Intergenic
921957701 1:221001070-221001092 ATGTGCTGGGCACTGTTAGATGG + Intergenic
922021604 1:221710456-221710478 ATGTGCTGGACATTGTTTTAAGG - Intronic
923130152 1:231067970-231067992 AGGGGCAGGACAAAATTTGAAGG + Intergenic
1063435555 10:6026945-6026967 AGGTGCTGGGCAGAGTCTAAGGG - Intronic
1064324812 10:14340145-14340167 AGCTGCTGGTCCCAGGTTGATGG + Intronic
1067682101 10:48447901-48447923 AGGTGCTGAGCATATTTTGAAGG - Intronic
1068654830 10:59563946-59563968 AAGTGCTGAACATATTTTGAGGG + Intergenic
1069325874 10:67230986-67231008 AGGTGCGGGACACAGTCTCCTGG - Intronic
1070131087 10:73655884-73655906 AGGTGCTGGTCACACTATCAGGG - Exonic
1072237966 10:93469483-93469505 GGGTGTTGGACACATTATGATGG - Intronic
1072522395 10:96239934-96239956 AGATGCTGGACACAGATTCCAGG - Intronic
1073131714 10:101193309-101193331 AGGCTCTGGTCACAGTTGGATGG - Intergenic
1073134736 10:101214203-101214225 ATGTGCGGGACACTGTTTCAGGG - Intergenic
1073976566 10:109108550-109108572 AGGTCCTAGGCAGAGTTTGATGG - Intergenic
1076057034 10:127384280-127384302 AGGTGCTGGGCACAGAGTCAGGG - Intronic
1076769807 10:132656749-132656771 AGCAGCTGGAGACAGTTTGGAGG + Intronic
1077404125 11:2375229-2375251 AGGGGCTGGACACAGGTTAGGGG - Intergenic
1078202952 11:9200678-9200700 GGGTTCTGGATATAGTTTGAAGG - Intronic
1079104690 11:17563095-17563117 AGGTGATTGACACAGTTCAAGGG - Intronic
1080396941 11:31898895-31898917 AGATTCTGGACATATTTTGAAGG - Intronic
1080918506 11:36685136-36685158 AGGTGCTGCCTACATTTTGAAGG + Intergenic
1082106086 11:48223262-48223284 AGATTCTGGACATATTTTGAAGG - Intergenic
1082174808 11:49048237-49048259 GGGTGCTTGACACGGTGTGAGGG - Intergenic
1083480907 11:62946100-62946122 AGGTGCTAGGAAAAGTTTGAAGG + Intronic
1083727220 11:64634854-64634876 AGGTGCAGGACACAGTAGGCTGG + Intronic
1083842693 11:65313934-65313956 GGGTGCTGGAGACAGACTGAAGG - Intergenic
1084765474 11:71305536-71305558 GAGTGCTGGACACAGTTGGGAGG - Intergenic
1085982612 11:81743704-81743726 GGGGGGTGGACACATTTTGAAGG - Intergenic
1086221667 11:84452581-84452603 GGGTTCTGGACATAGTTTGAAGG + Intronic
1087055739 11:93934257-93934279 AGGTTCTGGATATACTTTGAAGG - Intergenic
1088515733 11:110631536-110631558 AGGTGCTGGGTGTAGTTTGATGG - Intronic
1088522020 11:110711493-110711515 AGGTGGGGGTCACAGTTTGAGGG - Intronic
1088605779 11:111529927-111529949 AGTTGGTGAATACAGTTTGAGGG - Intronic
1089310050 11:117552029-117552051 AGGTGGGGGACAGAGTGTGATGG + Intronic
1089627342 11:119759861-119759883 AGGTGCTGGAAACAGTGTAGTGG + Intergenic
1090132110 11:124154523-124154545 AGAGGGTGGACACAGTTTGTTGG - Intergenic
1090839571 11:130476393-130476415 AGGAGCTGATGACAGTTTGAGGG + Exonic
1092323242 12:7501250-7501272 AGGTTCTGGACGCATTTGGATGG - Exonic
1096732595 12:53626320-53626342 AGGAGCTGGAGACAGATTGTAGG - Exonic
1097801616 12:63920709-63920731 AGATTCAGGACATAGTTTGAAGG + Intronic
1098927080 12:76362294-76362316 ATGTGCTGGATTCGGTTTGACGG - Intronic
1103238393 12:119393880-119393902 AGGTGCTGGTTAAAGTCTGATGG - Intronic
1104139261 12:125972037-125972059 ATGAGGTGGGCACAGTTTGAAGG + Intergenic
1104362689 12:128148934-128148956 CTTTGCTGGACACAGTTGGAGGG + Intergenic
1107443853 13:40452503-40452525 TCGTTCAGGACACAGTTTGAAGG + Intergenic
1107531798 13:41289636-41289658 AGGTCATGGTCACTGTTTGATGG + Intergenic
1109611462 13:64770897-64770919 TGGTGCTTGATATAGTTTGAAGG + Intergenic
1111257433 13:85689700-85689722 ATGTGCTAGATACAGTTTCAAGG - Intergenic
1112265665 13:97921114-97921136 AGATGCTGGAGGCAGTTTGGAGG - Intergenic
1112621893 13:101061824-101061846 AGGTAGTGGACATAGTTTAAAGG + Intronic
1115114292 14:29861138-29861160 AGGTGCTAGTCATAGTTTGTTGG - Intronic
1115128215 14:30022222-30022244 AGATGCTGGACATATTTTTATGG + Intronic
1119851221 14:77868019-77868041 AGGTGCTGGATACAAGATGAGGG - Intronic
1119960147 14:78846803-78846825 AGGTGCAGGACGCAGTGGGAAGG - Intronic
1121228446 14:92339104-92339126 AGGTGCTGGATGCATGTTGATGG + Intronic
1121805732 14:96820035-96820057 AGGTCATGGTCACTGTTTGATGG - Intronic
1122164214 14:99809483-99809505 AAGTGCTGGACACAGCTTCTGGG - Intronic
1124478529 15:30058170-30058192 AGATCCTGAACACAGTTTGAAGG + Intergenic
1126724247 15:51615009-51615031 AGATTCTGGACGCATTTTGAAGG + Intronic
1127223669 15:56907878-56907900 TGCTACTGAACACAGTTTGAAGG + Intronic
1129140890 15:73597007-73597029 GGGTGCTGGACTCACTCTGAAGG + Exonic
1129884818 15:79030753-79030775 AGGTCCTGGATGCATTTTGAAGG - Intronic
1130676835 15:85960277-85960299 AGGTGGTGAACACAGTTTTGTGG - Intergenic
1131078438 15:89513892-89513914 AAGTGCTGGATACAGTCAGAAGG - Intergenic
1131215425 15:90531079-90531101 AGGCGGGGGAGACAGTTTGAAGG + Intronic
1132036155 15:98486753-98486775 AGATGCTGGTAACAGTTTCATGG - Intronic
1132662303 16:1066898-1066920 AGGTGCGGGACACAGTTAAATGG - Intergenic
1135481895 16:22827520-22827542 AGATGCTGGATACACTTTGAAGG + Intronic
1138510583 16:57506457-57506479 TGGTGCTGGACCCTGTGTGAGGG + Intergenic
1139226264 16:65235576-65235598 AGCTGCAGGACCCACTTTGATGG + Intergenic
1139415645 16:66806743-66806765 AGATGCTGGACACTGTTCTAAGG + Intronic
1144791139 17:17860077-17860099 AGGTCCTGGACCCAGAGTGAGGG + Intronic
1149432624 17:56606387-56606409 AAGTGCTGGACACACTGTAATGG - Intergenic
1151490513 17:74430294-74430316 TGGTGCTGAACACAGTGTGCTGG - Intronic
1152891130 17:82882279-82882301 GGGTGCTGGGCACAGACTGAAGG - Intronic
1154510316 18:15093034-15093056 AGCTGTTGGACAGAGTTTAAAGG - Intergenic
1156466205 18:37349116-37349138 AGGTGCTGGACACAGTTTGAAGG + Intronic
1158475217 18:57773813-57773835 AGGTTCTGGAAACATTTGGAAGG - Intronic
1160229532 18:77036109-77036131 AAGTGCTGGTCACATTTTGGAGG + Intronic
1160229535 18:77036144-77036166 AAGTGCTGGTCACATTTTGGAGG + Intronic
1160229542 18:77036247-77036269 AAGTGCTGGTCACATTTTGGAGG + Intronic
1160229545 18:77036282-77036304 AAGTGCTGGTCACATTTTGGAGG + Intronic
1160229553 18:77036420-77036442 AAGTGCTGGTCACATTTTGGAGG + Intronic
1160229556 18:77036455-77036477 AAGTGCTGGTCACATTTTGGAGG + Intronic
1160229561 18:77036524-77036546 AAGTGCTGGTCACATTTTGGAGG + Intronic
1160229564 18:77036559-77036581 AAGTGCTGGTCACATTTTGGAGG + Intronic
1160229573 18:77036695-77036717 AAGTGCTGGTCACATTTTGGAGG + Intronic
1160229582 18:77036833-77036855 AAGTGCTGGTCACATTTTGGAGG + Intronic
1160229594 18:77037005-77037027 AAGTGCTGGTCACATTTTGGAGG + Intronic
1160229615 18:77037347-77037369 AAGTGCTGGTCACATTTTGGAGG + Intronic
1160321383 18:77899662-77899684 AGGTGCTGGGCACATTTTGATGG + Intergenic
1167328976 19:48842594-48842616 AGATGTTGGGCACAGTTTCAGGG - Intronic
1202695175 1_KI270712v1_random:118225-118247 AGGGGCTGGGCACAGCCTGATGG + Intergenic
927349307 2:22089747-22089769 AGGCCCTGGCCACAGATTGAAGG + Intergenic
931665206 2:64605522-64605544 AGATGTTGCACACAGTTTCAGGG - Intergenic
932955176 2:76343673-76343695 AGGTGCTGGAGACAGTCCTAAGG - Intergenic
932969556 2:76523856-76523878 TTGTGCTGAACACAGTTCGAAGG + Intergenic
933699509 2:85244446-85244468 AGATTCTGGACCCATTTTGAAGG + Intronic
934212915 2:90000313-90000335 AAGTTCTGGACAAAGGTTGAGGG + Intergenic
934276343 2:91575274-91575296 AGGGGCTGGGCACAGCCTGATGG + Intergenic
936615981 2:114048183-114048205 TGGTTATGGGCACAGTTTGAAGG + Intergenic
937605297 2:123793373-123793395 AGATGGAGGACACATTTTGAGGG - Intergenic
939839407 2:147169190-147169212 AGATACTGGATACACTTTGAAGG - Intergenic
941695323 2:168544793-168544815 TGGTGCTGGGAACAGTTGGATGG + Intronic
945918235 2:215727487-215727509 GGGTGCTGAACACAGTTAGAAGG + Intergenic
946037431 2:216755179-216755201 ATGAGCTGGACAAAGGTTGAAGG - Intergenic
946388495 2:219400930-219400952 GGGTGTGGGGCACAGTTTGATGG + Intergenic
946812042 2:223536247-223536269 AGATTCTGGACACACTTTGAAGG - Intergenic
948975501 2:241461241-241461263 AGATCCTGGACACATTCTGAAGG - Intronic
1169677446 20:8169861-8169883 AGGTTCTGGACAAATTTGGAGGG + Intronic
1169730503 20:8780625-8780647 TGGGGCTGAACTCAGTTTGATGG - Intronic
1170367280 20:15611572-15611594 AGGTGCTGGTCACAGTCCCATGG + Intronic
1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG + Intronic
1170682833 20:18542169-18542191 AGGTTCTTGACACATTTTGAAGG - Intronic
1171852472 20:30318338-30318360 GGGTGCTGGACACAGTGTTGGGG - Intergenic
1173505626 20:43584926-43584948 AGCTGCTGGCCACAGTGTCAGGG - Exonic
1174532051 20:51221971-51221993 AGGTGGTGAATACATTTTGAAGG + Intergenic
1174696067 20:52560397-52560419 AGGCTCTGGACACAGTTGCAAGG + Intergenic
1176787548 21:13276364-13276386 AGCTGTTGGACAGAGTTTAAAGG + Intergenic
1177986719 21:27984871-27984893 AGCTGTTGGACAGAGTTTAAAGG + Intergenic
1179210539 21:39321025-39321047 AGATTCTGGATACATTTTGAAGG - Intronic
1184895489 22:47404193-47404215 AGGTGCTGGATACATGTGGAAGG + Intergenic
949978376 3:9481586-9481608 AGATGATGGAAACAGTTTGGAGG + Intergenic
953775283 3:45811409-45811431 AGGTTCTGGATATATTTTGAAGG - Intergenic
958778999 3:98519440-98519462 GGATTCTGGACATAGTTTGAAGG - Intronic
959616599 3:108355862-108355884 AGGTGTTGGATAAAGATTGATGG - Intronic
962710876 3:138084692-138084714 AGGTGTTGGAGACAGGTAGATGG + Intronic
963122440 3:141787661-141787683 AGGTGCTGGACACTGTTAGAGGG + Intronic
968047812 3:195634005-195634027 TCGTGCTGGACACAGTTCTATGG - Intergenic
968062342 3:195735212-195735234 ACATTCTGGGCACAGTTTGATGG - Intronic
968306802 3:197655919-197655941 TCGTGCTGGACACAGTTCTATGG + Intergenic
972226815 4:37023001-37023023 AGGTCATGGTCACTGTTTGATGG + Intergenic
975414846 4:74094418-74094440 AGGTGGTGGTCACAGGGTGAAGG - Intergenic
976911499 4:90312591-90312613 AGATTCTGTATACAGTTTGAAGG + Intronic
976912167 4:90321208-90321230 AGGAGCTGGAAAGAGTTGGAGGG - Intronic
977419522 4:96780506-96780528 ATGTTCATGACACAGTTTGATGG + Intergenic
977529456 4:98183050-98183072 AGATTCTGGATACATTTTGAAGG - Intergenic
978926807 4:114255878-114255900 TGCTGCTGGATTCAGTTTGATGG - Intergenic
980341339 4:131551640-131551662 AAGTGATGGGCACAGTGTGAAGG - Intergenic
980967739 4:139539446-139539468 AGGTGTTGGAGCAAGTTTGATGG + Intronic
980984594 4:139683252-139683274 AGGTTCTGGATATATTTTGAGGG + Intronic
981157043 4:141450379-141450401 AGGTGCAGGACTAAGTTTGTGGG + Intergenic
982375032 4:154680730-154680752 AGGTGGTGGCCACAGTTGGCAGG - Intronic
985504313 5:270453-270475 TCGTGCTGGACACAGTTCTAAGG - Intergenic
986622303 5:9688640-9688662 AGGTGCTGGGGACACTTTGGAGG - Intronic
986720043 5:10554416-10554438 AGGTGTTGGAGACAGTGTGAGGG + Intergenic
987275199 5:16354994-16355016 AGATGGTGGGCACAGTTTCATGG + Intergenic
989174473 5:38509432-38509454 AGGTGCTCGTCTCAGCTTGATGG - Intronic
992111150 5:73495436-73495458 TGGTGCTTTACAAAGTTTGAAGG - Intergenic
993002054 5:82391040-82391062 AGGTGATGGATACAGTATGGGGG + Intergenic
993188838 5:84654884-84654906 AGGTGCTGGATACAGGCTAAGGG + Intergenic
993922529 5:93824932-93824954 AGGTTCTGGCAACAGTTTGGGGG - Intronic
994432595 5:99687018-99687040 AGGTCATGGTCACTGTTTGATGG + Intergenic
997035939 5:130191224-130191246 AGGTGTTGGATACACTTTGGTGG - Intergenic
997623077 5:135312996-135313018 AGGACATGGAAACAGTTTGAAGG + Intronic
999942795 5:156562762-156562784 AGATGCTGAATACAGTTTAAAGG + Intronic
1000436303 5:161214000-161214022 AGGTCATGGTCACAGTTTGGTGG - Intergenic
1001196437 5:169677398-169677420 AACTACTGGACACAGTTTGCGGG - Intronic
1001435367 5:171695517-171695539 AGGCCCTGGCCACAGTTTTAAGG + Intergenic
1004326320 6:14676984-14677006 AGGTTCTGGACATATTTTGAGGG - Intergenic
1005246258 6:23889099-23889121 AGGTCAGGGACACAGTTTCATGG + Intergenic
1005417400 6:25614919-25614941 AGGAGCTGGTCAAATTTTGATGG + Intronic
1011167615 6:84466883-84466905 AGGTGCTGGCCACAGTATTTTGG + Intergenic
1011454372 6:87531588-87531610 AGGTGCTCAACACAGTTTTTAGG - Intronic
1012536532 6:100304907-100304929 AGCTGCTGAACACAGTATTAAGG + Intergenic
1013188684 6:107783758-107783780 AGGTGCTGGTCTGAGTTTGGAGG + Intronic
1013572151 6:111439717-111439739 AGGTCATGGTCACAGTTTGGTGG + Intronic
1013581849 6:111542826-111542848 AGATTCTGGATATAGTTTGAAGG + Intergenic
1013805325 6:113990039-113990061 AGGTGCTGAAAATAGTTTGTTGG + Intronic
1017759665 6:157558191-157558213 AGGTGCTGGCCACTGTCTGCAGG - Intronic
1017903821 6:158741569-158741591 AGGTCCTGGTCACTGTTTGGTGG - Intronic
1020360112 7:7319094-7319116 AGATTCTGGAGATAGTTTGAAGG + Intergenic
1021575963 7:22106246-22106268 AGGTCCTGGTCACTGTTTGGTGG - Intergenic
1022140687 7:27491200-27491222 AGGAGCTGGATTCAGTTTGCTGG + Intergenic
1022205037 7:28155618-28155640 AGGTACTGAACACAGTATGGAGG + Intronic
1024153743 7:46599454-46599476 AGATTCTAGCCACAGTTTGACGG - Intergenic
1027809356 7:82874231-82874253 TTGTGCTGGACACAGTATAAAGG + Intronic
1030654898 7:112156208-112156230 GTGTGCTGGACACAGTGTGAGGG - Intronic
1031280034 7:119787618-119787640 TGCTGCTGGATTCAGTTTGAAGG - Intergenic
1032327791 7:130948148-130948170 ATGTGATGGACACGGGTTGATGG - Intergenic
1033874744 7:145801727-145801749 AGATTCTGGATACACTTTGAAGG - Intergenic
1034637288 7:152577345-152577367 AGAAGCTGGCCACAGTATGAGGG + Intergenic
1035886492 8:3296668-3296690 AGGTCCTGGATACGTTTTGAAGG + Intronic
1037241982 8:16787510-16787532 ATGTACTGGACACATTTTAATGG + Intergenic
1037565892 8:20118216-20118238 ACTTGCTGGGGACAGTTTGAAGG + Intergenic
1040486986 8:47883029-47883051 AGGTGCTGGATACAGTATGTCGG - Intronic
1042383037 8:68141140-68141162 AGGTGCTTCACACAATGTGAAGG + Intronic
1042864659 8:73346532-73346554 AGGGGCAGGACTTAGTTTGATGG - Intergenic
1043228927 8:77773237-77773259 AAGTGATGTACATAGTTTGAGGG - Intergenic
1043872270 8:85446797-85446819 AAGTACTGGAAACAGTTTGGAGG - Intronic
1049301418 8:141872605-141872627 TGGTGGTGGACACAGTGTGTGGG + Intergenic
1049329616 8:142043235-142043257 AGGAGCTGGACACAGAGGGAGGG + Intergenic
1053037021 9:34834411-34834433 TGCTGCTGGACACAGTCTGCTGG + Intergenic
1053070231 9:35096698-35096720 TGGGGCTGGCCCCAGTTTGATGG + Intergenic
1054981894 9:71216765-71216787 AGGTGCTCAACACAGGTTCATGG + Intronic
1057047010 9:91893722-91893744 AGTGGCGGGATACAGTTTGAAGG - Intronic
1057315222 9:93964122-93964144 AGGTGGTGGACACAGCAGGAGGG + Intergenic
1059297458 9:113284368-113284390 AGATGCTGGCCACAGCTTGTTGG + Exonic
1061939688 9:133877216-133877238 AGGCGCTGGCAACTGTTTGAGGG - Intronic
1186231071 X:7454542-7454564 AGGTTCTGGCCACAGATTGGTGG + Intergenic
1189823180 X:44890454-44890476 AGCTCCGGGAAACAGTTTGATGG - Intronic
1192682499 X:73266780-73266802 AAGTGGTGGTCACAGGTTGAGGG + Intergenic
1192887878 X:75355758-75355780 AGGTCATGGACACAGTTTTTTGG - Intergenic
1193558960 X:82993900-82993922 TGATGCTGGATACAGTTTGCTGG + Intergenic
1193571326 X:83148810-83148832 TGCTGCTGGATACAGTTTGCTGG + Intergenic
1194057554 X:89155260-89155282 ATGTCCTGGAGACAGTTTTATGG + Intergenic