ID: 1156467365

View in Genome Browser
Species Human (GRCh38)
Location 18:37356344-37356366
Sequence GAGAGTGACAAAAGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 609}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156467356_1156467365 20 Left 1156467356 18:37356301-37356323 CCAAATAAAATATTCTTCTATTC 0: 1
1: 0
2: 4
3: 51
4: 587
Right 1156467365 18:37356344-37356366 GAGAGTGACAAAAGGGTGGGGGG 0: 1
1: 0
2: 1
3: 49
4: 609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156467365 Original CRISPR GAGAGTGACAAAAGGGTGGG GGG Intronic
900125804 1:1068536-1068558 GAGTGTGACCCCAGGGTGGGAGG - Intergenic
900213761 1:1470082-1470104 GAGAGTCAGCAAAGGGTGGTGGG - Exonic
900721397 1:4178134-4178156 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
900930845 1:5736283-5736305 GAGAGAGAGAGATGGGTGGGTGG + Intergenic
901098271 1:6700293-6700315 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
901155574 1:7135567-7135589 GGGAGTGAAAAAGAGGTGGGAGG - Intronic
901170145 1:7251026-7251048 GAGAGTGAGGCAAGGCTGGGTGG + Intronic
903793487 1:25910630-25910652 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
904118094 1:28176942-28176964 GAGAGTGAGAAAGAGGAGGGAGG + Exonic
904504496 1:30939589-30939611 GAGAGTAACCAAAGGGCAGGTGG - Intronic
904683709 1:32246327-32246349 GAGAGAGAGAGAAGGGAGGGAGG - Intergenic
905485985 1:38296940-38296962 GAAAGTGCCATTAGGGTGGGTGG - Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
905993427 1:42359922-42359944 GTGAGAGACAAAGGAGTGGGAGG - Intergenic
907897346 1:58704118-58704140 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
908016919 1:59850846-59850868 GAGAGTGAGAAGAGGGTAAGAGG + Intronic
908543717 1:65145717-65145739 GAGAGTCAGGAAAGGGTGGTGGG - Intergenic
909181774 1:72433354-72433376 GAGAGTGACAAACAGATGTGGGG + Intergenic
909289516 1:73864610-73864632 GAGGGTGACAGGAGGGTGGAGGG + Intergenic
909350759 1:74650593-74650615 GTAAGTGACTGAAGGGTGGGTGG + Intronic
910452585 1:87362015-87362037 AAGAGTGACAAAATGCTGTGGGG - Intergenic
910842496 1:91573833-91573855 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
910848509 1:91627542-91627564 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
911158566 1:94659803-94659825 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
911246390 1:95523006-95523028 GACAGTATCATAAGGGTGGGGGG + Intergenic
911950709 1:104170655-104170677 GAGAGTGCCAGCAGGTTGGGTGG + Intergenic
912197738 1:107419160-107419182 GAGAGAGGCTAAAGGGAGGGAGG - Intronic
912308511 1:108595565-108595587 GAGAGGGAGGAAAGGGAGGGTGG + Intronic
913244867 1:116862692-116862714 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
914901620 1:151714217-151714239 CAGAGTGACAAAAGAGTGCCTGG + Intronic
916205959 1:162316627-162316649 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
917095889 1:171398498-171398520 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
917749382 1:178040554-178040576 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
917750190 1:178045811-178045833 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
918163731 1:181924862-181924884 GAGAGTGGCAAAAGTGTGGAGGG - Intergenic
918409320 1:184242293-184242315 GATAGTGCTAAAAGGTTGGGTGG - Intergenic
919523790 1:198621972-198621994 GAGAGAGAGAAGAGGGAGGGAGG + Intergenic
920447408 1:206029128-206029150 GAGAGAGAGAGAGGGGTGGGGGG + Intergenic
920907750 1:210187901-210187923 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
920908878 1:210195559-210195581 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
922020661 1:221700969-221700991 GCAAGTGACAATGGGGTGGGGGG + Intergenic
922191535 1:223323170-223323192 GAGAGTGACAAAAAGGAAGGAGG + Intronic
922544867 1:226448971-226448993 CAGAGTGACAACAAGCTGGGTGG + Intergenic
922845724 1:228682450-228682472 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
923113326 1:230910491-230910513 GAGAGAAACAGAAGTGTGGGAGG + Intronic
923863594 1:237916651-237916673 CAGATTGACCAAATGGTGGGTGG - Intergenic
924116532 1:240753185-240753207 GAGAGAGACAGAAGGGAGGGAGG - Intergenic
924127848 1:240874342-240874364 GAGAGTCACAAAAGGGAGTTGGG - Intronic
924270297 1:242325416-242325438 GAGCGAGAGAAAGGGGTGGGGGG + Intronic
924697884 1:246419240-246419262 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1063138787 10:3238899-3238921 GAGAGGGACAAAGGGATGGCAGG - Intergenic
1063529731 10:6819572-6819594 GAGAGGAACAGAACGGTGGGAGG - Intergenic
1063880450 10:10526375-10526397 GAATGTTACAAAAGAGTGGGAGG + Intergenic
1064865006 10:19869457-19869479 GAGAGAGAGAAAGGGGGGGGGGG + Intronic
1065001803 10:21344049-21344071 GAGAGAGAAAGAAAGGTGGGAGG + Intergenic
1065658688 10:27982072-27982094 GAGAGAGACACATGGGTGTGTGG - Intronic
1065659116 10:27987310-27987332 GAAAGTGGGGAAAGGGTGGGAGG - Intronic
1065797766 10:29322845-29322867 GAGAGAGAGAAAAAGGAGGGAGG + Intergenic
1066437617 10:35408391-35408413 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1066525892 10:36279241-36279263 CAGAGGAACAAAATGGTGGGGGG + Intergenic
1066714632 10:38273378-38273400 GAGAGAGAGAGAGGGGTGGGGGG - Intergenic
1068318447 10:55378805-55378827 GAGAGTGAGAAAAAGGAGGGAGG - Intronic
1068381250 10:56255810-56255832 GAGAGTGAGAAAAAGCAGGGTGG - Intergenic
1069133781 10:64738550-64738572 GACAGTGATAAAAGAGTGGGGGG + Intergenic
1069902372 10:71713485-71713507 GGGAGGGACAGAAGCGTGGGAGG + Exonic
1070167463 10:73909625-73909647 GAGAGTGACAGAAGGAAGGCAGG - Intronic
1070210157 10:74309643-74309665 GAGACTGAAAAAAGGGAGAGGGG + Intronic
1070353276 10:75614118-75614140 GAGAGAGACAAAGGGGTGATAGG - Intronic
1070451677 10:76564577-76564599 GAGTGTGATAAGTGGGTGGGTGG - Intergenic
1071550287 10:86561335-86561357 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1071932256 10:90485249-90485271 GTGAGTGACCAAAGGGTGAAAGG - Intergenic
1071988909 10:91080582-91080604 GAAAGTAACAGAAGGGTGGAGGG + Intergenic
1072288058 10:93935679-93935701 GAGAGTGTGAAAAGGGTGGAAGG + Intronic
1072529845 10:96308687-96308709 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1072885014 10:99265265-99265287 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1073014656 10:100388279-100388301 GAGAGTCAGCAAAGGGTGGTAGG - Intergenic
1073191153 10:101651327-101651349 GAGGGTGGGAAATGGGTGGGGGG + Intronic
1073448537 10:103595563-103595585 GAAAGAGAAAAAAGGGAGGGAGG - Exonic
1073973067 10:109066856-109066878 GAGAGTTACCAATGGGTGGGTGG - Intergenic
1074102141 10:110362088-110362110 GACAGAGAGAGAAGGGTGGGGGG + Intergenic
1074255162 10:111794688-111794710 GAGAGGAAAAAAAGGGTGGGGGG + Intergenic
1075403052 10:122174473-122174495 GAGAGGGAGACACGGGTGGGAGG - Intronic
1077277368 11:1720089-1720111 GAGAGTGACAATATGAGGGGTGG + Intergenic
1077757356 11:5047023-5047045 GAGCCTGACAAAAGGGTAGGCGG - Exonic
1077854979 11:6115547-6115569 GAGAGTGAGAAAAAGAAGGGTGG + Intergenic
1078084950 11:8228336-8228358 GAGGCTGAGAAGAGGGTGGGGGG + Intronic
1078935106 11:15942835-15942857 GTGGGCGACAAAAGGGTAGGTGG + Intergenic
1078950015 11:16120110-16120132 GAGAGAGAGAAAGGGGTGGGGGG - Intronic
1079700670 11:23541993-23542015 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1079806236 11:24933808-24933830 GAGAGTCATCAAAGGGTGGTGGG + Intronic
1079835330 11:25326892-25326914 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1080044536 11:27795525-27795547 GACCTTGACAAAAGGGTGGTAGG + Intergenic
1080875382 11:36270157-36270179 GAGAGAGACACACGGGTCGGGGG + Intergenic
1081547383 11:44081086-44081108 GGGGGTGTCAGAAGGGTGGGAGG + Intronic
1081759526 11:45567495-45567517 TACAGTGACAGAAGGCTGGGTGG + Intergenic
1081841404 11:46204097-46204119 GACAGTGAAAAAGCGGTGGGGGG + Intergenic
1082091663 11:48095458-48095480 GAGAGAGAGAGAAGGGTAGGAGG + Intronic
1082669603 11:56018006-56018028 GAGAGTGACAAAAGGGATACGGG - Intergenic
1082935626 11:58653807-58653829 GAGAGAGACAGAAGAGTGTGGGG - Intronic
1083542572 11:63523594-63523616 GGGACTGAAGAAAGGGTGGGGGG - Intergenic
1083961534 11:66017409-66017431 GGGGCTGACAAATGGGTGGGTGG - Intronic
1084724914 11:70935231-70935253 CTGAGTGACAAATGGGTGGGTGG - Intronic
1086985534 11:93244846-93244868 GATAGTTACCAAAGGCTGGGGGG - Intergenic
1087057830 11:93950940-93950962 GAAAGTGACAATAGACTGGGTGG + Intergenic
1087168169 11:95024696-95024718 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1087601799 11:100326757-100326779 GAGAGTGACTAAGGGAGGGGTGG + Intronic
1087983104 11:104641822-104641844 GGGAGTTACACAAGGCTGGGGGG - Intergenic
1088253182 11:107879249-107879271 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1088707266 11:112475019-112475041 GAGGGTGGCAGAAGGGAGGGAGG - Intergenic
1088748915 11:112827444-112827466 CAGAGAGCCATAAGGGTGGGGGG + Intergenic
1088765277 11:112969462-112969484 GAGTCTGACCAAAGTGTGGGAGG + Intronic
1089970961 11:122692956-122692978 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1092173864 12:6390051-6390073 GAGAGAGAAAAAAGGGTCTGGGG + Intronic
1093925879 12:24907825-24907847 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1094023756 12:25941415-25941437 GACATTGACAACAGGATGGGTGG - Intergenic
1094203585 12:27817401-27817423 GAGCGAGACAAAAGGAAGGGAGG - Intergenic
1094606995 12:31957763-31957785 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1095350434 12:41204318-41204340 GAGAGAGACAAAAGGCTTGATGG + Intronic
1095605327 12:44060699-44060721 GAAAGTCACAAAAGCATGGGAGG + Intronic
1096205663 12:49719507-49719529 GAGAGAGAAAGAAGGGAGGGAGG + Intronic
1096537184 12:52282609-52282631 GAGAGTGACCATAGGGCAGGAGG + Intronic
1096753351 12:53777707-53777729 GAGAGAAACAGAAGGCTGGGAGG + Intergenic
1097090427 12:56500316-56500338 CAGATTGACCAAATGGTGGGTGG + Intergenic
1097392496 12:59032800-59032822 GAGAGAGAGAGAAGGGAGGGTGG + Intergenic
1097693991 12:62759819-62759841 GAAAGTGGAAACAGGGTGGGAGG - Intronic
1098377483 12:69832724-69832746 GTGAGTGACAATGGGGAGGGTGG + Intronic
1098638941 12:72817101-72817123 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1098709427 12:73736904-73736926 GAGAATGACAAAACCATGGGGGG - Intergenic
1099415952 12:82386502-82386524 GAGAGAGAGAAAAGGGAGGAAGG - Intronic
1099645658 12:85352018-85352040 GAAGGTGACAAAAAGGTAGGAGG + Intergenic
1099881698 12:88475182-88475204 GAGGGTAAGAATAGGGTGGGTGG + Intergenic
1100114999 12:91293996-91294018 GAGAGTGAGAAAAAGCAGGGTGG + Intergenic
1100370868 12:93967233-93967255 GAGAGGGAGAAAAGGATGGAGGG - Intergenic
1100391787 12:94150243-94150265 GAGAGTGTAAAAAGGGGGGCGGG + Intronic
1100759047 12:97785993-97786015 GAGAGTCATAAAAGGGCTGGAGG - Intergenic
1101111590 12:101491748-101491770 GAAAGTGACAAAATGGAGGATGG - Intergenic
1101352166 12:103941249-103941271 AAGAGAAAGAAAAGGGTGGGGGG - Intronic
1101387534 12:104271143-104271165 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1101396818 12:104355963-104355985 GAGGGTGAGGAAAGGGTGGAAGG + Intergenic
1102147597 12:110666636-110666658 CAGAGGGACAGAAGGGTGGCTGG - Intronic
1102188136 12:110965553-110965575 GAGAGAGGCAGAAGGGAGGGAGG - Intergenic
1102633243 12:114300392-114300414 GAGAGTGACAAAATGGGCTGGGG + Intergenic
1103583696 12:121935636-121935658 GAGTGTGTCAAAAGGCTGGTAGG - Intronic
1103729545 12:123018043-123018065 GAGAGAGAAAAGAGGGAGGGAGG - Intronic
1105244668 13:18638470-18638492 GAGTATGATAAAAGTGTGGGAGG - Intergenic
1105594016 13:21818787-21818809 GGGAGTAACAAAAGGGCGGGAGG + Intergenic
1105899536 13:24743379-24743401 GAGACTGACCACAGGGTGGGTGG - Intergenic
1106096199 13:26646517-26646539 GGGAGTGACACAGGTGTGGGGGG - Intronic
1107542947 13:41410210-41410232 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1107838647 13:44434029-44434051 GAGAGTGACAAAATGGTGACAGG - Exonic
1108433902 13:50382743-50382765 GAGAGTGTCGAGAGGTTGGGAGG + Intronic
1108702723 13:52957480-52957502 GAGAGTCAACAAAGGGTGGTGGG + Intergenic
1108817606 13:54311125-54311147 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1109045473 13:57405683-57405705 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1109527948 13:63600924-63600946 GAGAGTGAAGAAAGGGAGGAGGG - Intergenic
1109546114 13:63840134-63840156 GAGAGAGACAAGATGGCGGGTGG + Intergenic
1110816812 13:79870333-79870355 TAGTGGGATAAAAGGGTGGGAGG - Intergenic
1111110939 13:83708532-83708554 GACAGTGACAAAAGTTTGGCTGG + Intergenic
1111295231 13:86268935-86268957 GAGAGAGAGAGAAGGGAGGGAGG - Intergenic
1113106334 13:106775377-106775399 AAGAGTGAACAATGGGTGGGTGG - Intergenic
1113674511 13:112197992-112198014 GAGAAAGACAAAGGGGTAGGGGG + Intergenic
1114644928 14:24250180-24250202 GAGAGAGACAGAGAGGTGGGTGG + Intronic
1115027866 14:28764928-28764950 GAAAGAGAGAAAAGGTTGGGGGG - Intergenic
1115117205 14:29895445-29895467 GAGAGTGGGAACAGGGAGGGCGG - Intronic
1115149827 14:30271505-30271527 GACAGTTACAAAAGGGGAGGGGG + Intergenic
1115566426 14:34629469-34629491 GAGAGAGACAGAAGGGTGGGCGG + Intronic
1117069908 14:52047241-52047263 GAGAAAGACAAGAGGGTGGGAGG + Intronic
1117652801 14:57924391-57924413 GAGAGAGAGAAAAGGGTGATGGG + Intronic
1117846761 14:59920044-59920066 GAGGGGGATAAAAGGGTGGGGGG - Intronic
1118346233 14:64943050-64943072 GAGAGGAAAAAAAGGGAGGGAGG + Intronic
1118902448 14:69997971-69997993 GAGTGTGAAAAAAGGATGTGTGG - Intronic
1119071101 14:71585132-71585154 AAGAATGAGAAAAGGGAGGGAGG + Intronic
1119939687 14:78627094-78627116 GAGAGAGAGAGAAGGGAGGGAGG - Intronic
1120409979 14:84142124-84142146 GAGAGCAACAAAAGGGTAGGAGG + Intergenic
1120453256 14:84698468-84698490 GAGAGAGAAAAAGTGGTGGGAGG - Intergenic
1121725058 14:96141272-96141294 GAGACAGACAAGAGGGTGGAGGG + Intergenic
1122053934 14:99079489-99079511 GAGGGTGAGAAAAGGGATGGTGG - Intergenic
1122157725 14:99760360-99760382 GCTTGTGACATAAGGGTGGGGGG - Intronic
1122381510 14:101310236-101310258 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
1122856165 14:104561209-104561231 GAGGGTGACAGCAGGCTGGGTGG - Intronic
1122867519 14:104614127-104614149 GAGAGTGATAAATGGATGAGAGG + Intergenic
1124028279 15:25987020-25987042 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1124606636 15:31174362-31174384 GAAAGTGAGAGAAGAGTGGGAGG - Intergenic
1124759356 15:32437243-32437265 CTGAGTGAGAAAAGGGTGGTGGG + Intergenic
1125692866 15:41610897-41610919 GAGAGTCACCAAAGGTTGGTTGG + Intergenic
1126370547 15:47941287-47941309 GAGAGAGAGAAAAAGGTGGAAGG + Intergenic
1126435288 15:48631402-48631424 GACAGTGATAACAGAGTGGGTGG + Intronic
1127309158 15:57737230-57737252 AAGAGTGAGAAAGGGGTGCGGGG - Intronic
1127500889 15:59553314-59553336 GAGAGAGACGAGAGGGAGGGGGG - Intergenic
1128077944 15:64840178-64840200 GAGAGAGAGAGAAGGGAGGGAGG - Intergenic
1128135787 15:65262491-65262513 GAGAGCCACACAATGGTGGGGGG + Intronic
1128388478 15:67166940-67166962 GAGAGAGATAGAAGGGAGGGAGG - Intronic
1128582237 15:68818423-68818445 AAGAGGGACAAAAGGGTTGGGGG - Intronic
1128600040 15:68988442-68988464 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1128946205 15:71823450-71823472 GAGAGAGACAAAAGGGCCAGAGG - Exonic
1129068794 15:72933769-72933791 GAGAGTGACAGAAGAGTAGCAGG + Intergenic
1129120366 15:73392789-73392811 GAGAGAGAGAGAAGGGAGGGAGG + Intergenic
1129776264 15:78238504-78238526 GAGAGGGACAGAAAAGTGGGAGG - Intronic
1130667216 15:85879875-85879897 GAGAGGGACAGAAGGTGGGGTGG - Intergenic
1130725747 15:86437752-86437774 GATAGAAACAGAAGGGTGGGAGG - Intronic
1131366479 15:91846228-91846250 GAGAGAGAGACAAGGGAGGGGGG - Intergenic
1131527978 15:93167714-93167736 GAAAGGGAAAAAAGGGAGGGAGG - Intergenic
1131614008 15:93994729-93994751 GAGAGAGAGAAAAGGAAGGGAGG + Intergenic
1132664714 16:1076172-1076194 GAGAGAGAAAACAGGGTAGGGGG - Intergenic
1132838809 16:1968314-1968336 CAGAGTCAGAAAAGCGTGGGAGG + Intronic
1132845214 16:1998068-1998090 GAGTGTGCCAACAGGGCGGGTGG + Exonic
1132967828 16:2669136-2669158 CAGATTGACCAAATGGTGGGTGG + Intergenic
1133001191 16:2852528-2852550 GAGAGGGATAAAAGGGAGGGTGG + Intergenic
1133577528 16:7108004-7108026 GACAGTGACATAAGATTGGGGGG + Intronic
1135084394 16:19463394-19463416 GAGGGTGAAAACAGGGAGGGAGG + Intronic
1135123517 16:19786803-19786825 GAGAGAGAGAGAAGGGAGGGAGG + Intronic
1135956353 16:26959664-26959686 AAGAGAGACAGAAGGGTGAGAGG - Intergenic
1136016073 16:27402078-27402100 GGGAGTGAGAAAGAGGTGGGAGG - Intergenic
1136551445 16:30984521-30984543 GGGAGTGACACCAGGGTGGAAGG - Exonic
1138453261 16:57106226-57106248 TAGAGTGAGCAATGGGTGGGTGG - Intronic
1139352823 16:66348030-66348052 TAGAGTGACAAGAGTGTGGGTGG - Intergenic
1140191927 16:72825042-72825064 GAGAGTTCCAAGAGGGTGAGTGG - Intronic
1140535129 16:75702970-75702992 GAGAGTGAGCAAAGGGTGGTGGG + Intronic
1140535502 16:75705604-75705626 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1141178303 16:81734976-81734998 GTGGGTGAGAGAAGGGTGGGTGG + Intergenic
1141682555 16:85553175-85553197 GCGGGTGATAAATGGGTGGGAGG + Intergenic
1142909274 17:3073064-3073086 CAGAGTGCCAAAAGGATTGGAGG + Intergenic
1142925286 17:3231174-3231196 CAGAGTGCCAAAAGGATTGGAGG - Intergenic
1143021323 17:3918319-3918341 GGGAGGGAAAAAAGGGAGGGAGG + Intergenic
1143085603 17:4413643-4413665 GAGAGAGAGAGAAGGGAGGGAGG - Intergenic
1143736683 17:8916220-8916242 GAGCGTGTCAAAGGGGTGGGTGG - Intronic
1144417893 17:15069205-15069227 GAGATTGACACAAGGTGGGGAGG + Intergenic
1145818098 17:27810127-27810149 GTGAGTGACAAACGGATGGATGG + Intronic
1146259886 17:31414451-31414473 GAAAGTGACAGAAGCCTGGGTGG - Intronic
1146640908 17:34540692-34540714 GAGATTGACAAAATGGTGATAGG - Intergenic
1146783371 17:35696326-35696348 GATAGTTACCAAAGGATGGGAGG + Intronic
1146839080 17:36137078-36137100 CAGTCTGACAACAGGGTGGGTGG + Intergenic
1146929128 17:36765542-36765564 GACAGTGACAGATGGGAGGGTGG + Intergenic
1146977183 17:37123671-37123693 GCAAGTGACAAGGGGGTGGGTGG - Intronic
1147118485 17:38320789-38320811 CAGAGTGAAAAAAAGCTGGGAGG - Intronic
1147632861 17:41943439-41943461 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1147837916 17:43348243-43348265 CAGATTGACCAAATGGTGGGTGG + Intergenic
1149128569 17:53266675-53266697 AAGAATGAGAAAAGTGTGGGTGG - Intergenic
1149566529 17:57644374-57644396 GAGAGTGGAAAAAAGGTGGATGG - Intronic
1149573964 17:57698094-57698116 AAGAGTGACAGGAAGGTGGGAGG - Intergenic
1150070746 17:62147829-62147851 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1150589453 17:66549356-66549378 GTGACTGATAACAGGGTGGGTGG + Intronic
1150714909 17:67563874-67563896 GAGAGAGAGAAATGGGTGGATGG + Intronic
1150860406 17:68795550-68795572 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1150973409 17:70056632-70056654 TAGAGAGACAGGAGGGTGGGTGG + Intronic
1151195163 17:72426045-72426067 GAGAGTGGGATGAGGGTGGGAGG - Intergenic
1153481876 18:5555243-5555265 GAGAGTGACTAGGGGATGGGAGG - Intronic
1153655092 18:7275021-7275043 GAGAGAGACAGGAAGGTGGGTGG + Intergenic
1153719510 18:7887562-7887584 GAGAAAGACAAAAGATTGGGTGG - Intronic
1154444271 18:14421424-14421446 GAGTATGATAAAAGTGTGGGAGG + Intergenic
1155961689 18:32000827-32000849 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1156467365 18:37356344-37356366 GAGAGTGACAAAAGGGTGGGGGG + Intronic
1156916609 18:42469630-42469652 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1157056268 18:44232684-44232706 GAGAGTGCCAGAAGGGAGGGAGG - Intergenic
1157097748 18:44701572-44701594 GACAGTGAGAAATGGGTGGCAGG + Exonic
1157107989 18:44792733-44792755 GAAAGAGAAAAAAAGGTGGGAGG - Intronic
1157570022 18:48706040-48706062 GAGAGAGAGACAAGGGTGGATGG + Intronic
1158452285 18:57577910-57577932 GAGAGAGACAAAATATTGGGTGG + Intronic
1158622386 18:59044280-59044302 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1158760638 18:60381643-60381665 GAGAGGGAAGAAAGGGTGGAGGG + Intergenic
1158950568 18:62491112-62491134 GAGATTGACATTATGGTGGGTGG + Intergenic
1161570417 19:5027515-5027537 GAGAGAGAAGAAAGGGAGGGAGG - Intronic
1161711721 19:5852410-5852432 GAGAGTTAGCAAAGGGTGGTGGG - Intergenic
1161712566 19:5857534-5857556 GAGAGTTAGCAAAGGGTGGTGGG - Intergenic
1161754237 19:6119833-6119855 GAGAGAGAGAAAGGGGTGGAAGG - Intronic
1161861497 19:6801620-6801642 GAGATAGAAAAAAGGGTGGGTGG - Intronic
1161914646 19:7219462-7219484 GAGAGAGAGAAAAGGGAGGGAGG + Intronic
1162098008 19:8322194-8322216 GAGACTGACAAGAGGGAGGCGGG + Intronic
1163363380 19:16862134-16862156 GTGTGTGACAGATGGGTGGGAGG + Intronic
1163601950 19:18254685-18254707 GAGAGTGACAACATAGTGGCAGG + Intronic
1163837788 19:19585860-19585882 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1164084524 19:21889131-21889153 CAGATTGACCAAATGGTGGGTGG + Intergenic
1164398924 19:27889505-27889527 GAGAGAGACAAATGGGTTGGGGG + Intergenic
1164539103 19:29109074-29109096 GGAAGTGAGAAAAGGCTGGGTGG + Intergenic
1164840572 19:31389622-31389644 GAGAATGGCAATGGGGTGGGGGG - Intergenic
1164941873 19:32257065-32257087 CAGAGTGACAAATGTGTAGGAGG - Intergenic
1165400719 19:35598046-35598068 GTGAATGACATAAAGGTGGGGGG + Intergenic
1166116696 19:40660285-40660307 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1166329582 19:42070219-42070241 GAGAGAGAGAAGAGGGAGGGAGG + Intronic
1166412658 19:42566569-42566591 GAAAGTGACCAGAGGGTGTGGGG + Intergenic
1166679807 19:44759395-44759417 AAGAGAGACAGAGGGGTGGGTGG - Intronic
1166794303 19:45417163-45417185 GAGAGTGACAATTGGGTGAGAGG - Intronic
1166905060 19:46102295-46102317 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1166906067 19:46109180-46109202 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1167110699 19:47458990-47459012 GAGAGAGAGAAAAGGGGGTGGGG - Intronic
1167709804 19:51103762-51103784 CAGATTGCCAAAGGGGTGGGAGG - Intronic
1167850022 19:52194346-52194368 GAGAATGGCAAAGTGGTGGGAGG + Intronic
1168165701 19:54545951-54545973 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
925110046 2:1326602-1326624 TAGATTGCAAAAAGGGTGGGGGG - Intronic
925119336 2:1405256-1405278 GTGAGTGATTAATGGGTGGGTGG - Intronic
925238038 2:2296619-2296641 GAGAGTGAGAAAGGGGCGTGTGG + Intronic
927019178 2:18999536-18999558 GAGAGAGAGAGAAGGGAGGGAGG - Intergenic
927957201 2:27216010-27216032 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
928111383 2:28512080-28512102 GAGAGAGAGAGATGGGTGGGGGG - Intronic
928194604 2:29206191-29206213 GAGAGAGAAGAAAGGGAGGGAGG - Intronic
928403762 2:30998397-30998419 GAGAGAGACAAAAGCATGAGTGG - Intronic
928845361 2:35665307-35665329 GAGAGAGACAGGAGGGTGGGGGG + Intergenic
929297056 2:40260160-40260182 GAGAGAGAAAAAAGGAGGGGAGG - Intronic
929615750 2:43305961-43305983 GAGAGAGAGAGAAGGGAGGGAGG - Intronic
930136261 2:47906178-47906200 GAGAGGGAGAGAAGGGAGGGAGG + Intergenic
930372852 2:50526023-50526045 GCCAGTGAAAAATGGGTGGGAGG - Intronic
930946216 2:57079229-57079251 GAGAGAGAGAAAAGGGGGAGGGG - Intergenic
930955668 2:57199420-57199442 GAGAGTGAGAAGAAGGTGAGGGG + Intergenic
931286282 2:60834655-60834677 CTGAGAAACAAAAGGGTGGGAGG + Intergenic
931536806 2:63286548-63286570 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
931996557 2:67844331-67844353 GAGAGAGAGAAAAGGGAGAGAGG - Intergenic
931999012 2:67866578-67866600 CAGGGTGAGAAAAGGGTTGGGGG + Intergenic
932402704 2:71492700-71492722 GAGAGAAAGAAAAGGGGGGGGGG - Intronic
932627230 2:73307633-73307655 GAGAGGGACAAAAGGGTCAAAGG - Intergenic
932777535 2:74537020-74537042 AATGGTCACAAAAGGGTGGGGGG - Intronic
932821150 2:74902027-74902049 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
933360889 2:81282578-81282600 GAGAGGGAAGAAAGGGAGGGAGG - Intergenic
933427855 2:82135993-82136015 GGGAGGGAGAAAAGGGAGGGAGG - Intergenic
933556234 2:83834477-83834499 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
934726519 2:96623937-96623959 GGGGGTTACAAAAGGATGGGTGG - Intronic
935373845 2:102375406-102375428 GAGGGTGTCAAAGGTGTGGGTGG + Intronic
935624839 2:105163605-105163627 GGAAGTGGCAAAATGGTGGGAGG - Intergenic
936982878 2:118280001-118280023 GGGAGTGAAGAATGGGTGGGGGG + Intergenic
937677284 2:124605964-124605986 GAGAGAGAGAAAAATGTGGGAGG - Intronic
938008946 2:127812967-127812989 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
938101429 2:128500348-128500370 GAGGGTGGGAAGAGGGTGGGAGG + Intergenic
940476504 2:154169031-154169053 GAGAGAGACAGAAAGGAGGGAGG + Intronic
941275291 2:163483293-163483315 GAGAGTGAGAAAAGGGAGAAGGG + Intergenic
941284937 2:163599181-163599203 GAACTTGACAAAAGGGTGAGGGG + Intronic
942398293 2:175575298-175575320 GAGAGAGAAAAAAGAGAGGGAGG - Intergenic
943737993 2:191378359-191378381 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
943801625 2:192067030-192067052 GAGATTGAGAAAAGCCTGGGAGG + Intronic
945064586 2:205938107-205938129 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
946068806 2:217013296-217013318 GAGAGTGAGAGAAGGGAGGCAGG + Intergenic
946131255 2:217608710-217608732 GAGAGAGAGAGAAGGTTGGGTGG - Intronic
946194301 2:218023937-218023959 GAGAGTGACAAAAGAGGGCAAGG + Intergenic
947224477 2:227826618-227826640 GAGAGAGAAGAAAGGGAGGGAGG - Intergenic
947232666 2:227903619-227903641 GAGAGTGACAGATGGCGGGGAGG - Intronic
947323764 2:228952238-228952260 GAGAGGGAGAAGAGGGAGGGCGG + Intronic
947818587 2:233054898-233054920 GAGAGAGAGAGAAGGCTGGGTGG + Intergenic
947921390 2:233877942-233877964 TAGAGTAAGAAAAGGGAGGGGGG - Intergenic
948107424 2:235426818-235426840 AAGAGAGAGAAAAGGGAGGGAGG + Intergenic
948576651 2:238956029-238956051 GAGAGGGACAAAAGGCTCGCAGG + Intergenic
948648946 2:239426853-239426875 GAGGGTGACAGAAGGATGGAAGG - Intergenic
1168892574 20:1304630-1304652 GAGAGAGAAGAAAGGTTGGGAGG - Intronic
1169393327 20:5207923-5207945 AAGAATGAGAACAGGGTGGGAGG + Intergenic
1169561594 20:6807174-6807196 GAGAATAGCAAAAAGGTGGGAGG - Intergenic
1169564695 20:6841277-6841299 GAGAGAGAGAGAAGGGAGGGAGG + Intergenic
1169647640 20:7831734-7831756 TCAAGTGACCAAAGGGTGGGTGG - Intergenic
1169731477 20:8789982-8790004 GACAGAAACATAAGGGTGGGAGG - Intronic
1170711817 20:18798009-18798031 GAGGGTGACTGATGGGTGGGCGG + Intergenic
1171163563 20:22950758-22950780 TTGAGTGACGTAAGGGTGGGAGG + Intergenic
1172216473 20:33239214-33239236 GAGAGTGCAGAAAGGGTGGAAGG - Intronic
1172307505 20:33891657-33891679 GAGAGAGAAAGAAGGGAGGGAGG - Intergenic
1172834977 20:37867640-37867662 GAGAGGGAGAAAAGGATGAGGGG - Intronic
1173165941 20:40687611-40687633 GAGAGAGACGAGAGGGTGGGAGG - Exonic
1173651712 20:44670572-44670594 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1173652640 20:44676655-44676677 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1173812084 20:45962187-45962209 GAGACAGACAAAAGGATGGTGGG + Intronic
1173941377 20:46913987-46914009 CAGAGTGGTAAAGGGGTGGGAGG - Intronic
1174030630 20:47622704-47622726 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1174253099 20:49234031-49234053 GAGAGTCACAAAAGGCCGAGTGG - Intronic
1174814963 20:53679157-53679179 CAAAATGACAAAGGGGTGGGAGG + Intergenic
1175083176 20:56437924-56437946 GCCAGTGACAAATGGGAGGGTGG + Intronic
1175119074 20:56704532-56704554 GAGTGTTACAAAAGAGAGGGTGG + Intergenic
1176451711 21:6868435-6868457 GAGTATGATAAAAGTGTGGGAGG - Intergenic
1176829883 21:13733486-13733508 GAGTATGATAAAAGTGTGGGAGG - Intergenic
1177062379 21:16392054-16392076 GAGAGTGAGCAAAGTGTGGTGGG + Intergenic
1177063170 21:16397830-16397852 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1177197364 21:17917510-17917532 GAGAGTAACAAGAAGGTGGAAGG + Intronic
1177590554 21:23160257-23160279 GACAGAGAGAAAAGGGTGAGGGG - Intergenic
1177650947 21:23961663-23961685 GAGAGTGAGAGGGGGGTGGGGGG - Intergenic
1178605478 21:34033013-34033035 GAGAGAGAGAGAAGGGAGGGAGG - Intergenic
1179352128 21:40621889-40621911 GAGAGAGAGAGAAGGGAGGGAGG + Intronic
1180645745 22:17337442-17337464 GAGACAGACACAAGGGTGGAGGG - Intergenic
1181450636 22:23017536-23017558 CAGAGCGACCAAGGGGTGGGAGG + Intergenic
1181999763 22:26910904-26910926 GAGAGAGAGGAGAGGGTGGGAGG - Intergenic
1182011145 22:27001712-27001734 GAGAGAAAAAAAAAGGTGGGAGG - Intergenic
1182017829 22:27055711-27055733 GAAAGTCACATAAGGGTAGGGGG + Intergenic
1182111717 22:27728242-27728264 GAGAGAGAGAGAAGGGAGGGAGG + Intergenic
1182473242 22:30561436-30561458 GGGGGTGACAGCAGGGTGGGGGG - Intronic
1182822434 22:33228851-33228873 GAGATAGACAAAGGGGTAGGTGG + Intronic
1183337036 22:37255771-37255793 GAGAGAAAGAAAAGGGAGGGAGG + Intergenic
1183377391 22:37473139-37473161 GAGAGTTAAAGAAGGGTGGCTGG + Intronic
1183412171 22:37661227-37661249 GGGAGTGACAGCAGGATGGGTGG - Intronic
1183668713 22:39259598-39259620 AAGAGAGACATCAGGGTGGGTGG + Intergenic
1183850819 22:40586109-40586131 GAGACTGATAAAATGGTAGGTGG + Intronic
1184167823 22:42740919-42740941 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1184541813 22:45130888-45130910 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1185061947 22:48611737-48611759 GTGAGTCAGAAAAAGGTGGGAGG - Intronic
1185409824 22:50675974-50675996 GAGAGTGCCAGAGGGGTGTGTGG + Intergenic
949353736 3:3155022-3155044 GTGAGTGAGAAAAGGCTGGAAGG - Intronic
950230319 3:11270578-11270600 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
950267014 3:11581529-11581551 GGAGGGGACAAAAGGGTGGGAGG + Intronic
950541222 3:13614503-13614525 GAGATGGACAAGAGGATGGGAGG - Intronic
950582005 3:13868510-13868532 GAGAGAGAAAGAAAGGTGGGAGG + Intronic
950698954 3:14726875-14726897 GAGAGGGGCAAAGGGGAGGGCGG - Intronic
951626733 3:24673190-24673212 GAGAGAGAGAAAGGGGTGGGGGG + Intergenic
951889165 3:27552713-27552735 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
951895151 3:27603044-27603066 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
952296564 3:32067809-32067831 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
952297789 3:32076385-32076407 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
952791881 3:37206601-37206623 GAAAGTGGAAAAGGGGTGGGAGG - Intergenic
953779554 3:45854735-45854757 GATAGTGATAAAATGGTTGGTGG - Intronic
954466096 3:50655717-50655739 GACAGGGACAGAAGGGTTGGGGG + Intergenic
955118971 3:56036617-56036639 GAGAGTGAGAAAAAGCAGGGTGG + Intronic
955158915 3:56445667-56445689 GAGAGTGGCAAGAGGGGAGGCGG - Intronic
955228712 3:57080680-57080702 GAGAATGACAAAAGGGTTCTTGG - Intergenic
955401602 3:58595625-58595647 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
955633130 3:60996212-60996234 GAGTGTGACGAGATGGTGGGAGG + Intronic
955746159 3:62142346-62142368 GAGAGTGACAAGGGGCTGGCTGG + Intronic
956189305 3:66593377-66593399 GGGTGTGAAAAAAGGGTGGAGGG + Intergenic
956219308 3:66884744-66884766 GGGAGGGACAGAAGGGAGGGAGG + Intergenic
956367017 3:68515207-68515229 AAGAGTCTAAAAAGGGTGGGTGG + Intronic
956678777 3:71758930-71758952 GAAAGAGAAAAAAGGGAGGGAGG - Intergenic
956825283 3:72992331-72992353 GAGAGAGAGAGAAGGGAGGGAGG - Intronic
957853533 3:85843390-85843412 GAGAGAAAGAAAAGGTTGGGGGG - Intronic
959197426 3:103202374-103202396 GGGAGAGAGAAAGGGGTGGGGGG + Intergenic
959400270 3:105892513-105892535 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
959410528 3:106015777-106015799 GAGACTGACAAAAGGGAATGAGG + Intergenic
959936332 3:112033140-112033162 GAAAGGGAAAAAAGGATGGGGGG + Intergenic
960006256 3:112784119-112784141 GAGAGTTAGCAAAGGGTGGTGGG + Intronic
960792538 3:121449623-121449645 GAGAGAGACAGAAGGGCAGGAGG + Intronic
961084741 3:124057227-124057249 CAGAGTGGCAAAAGTGGGGGCGG - Intergenic
961713032 3:128841692-128841714 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
961731602 3:128969234-128969256 GAGAGTCAGCAAAGGGTGGTGGG - Exonic
961842882 3:129732380-129732402 CAGACTGGCAACAGGGTGGGTGG - Intronic
962454506 3:135552829-135552851 GAGAGGGATACAAGGGTGGGAGG + Intergenic
962926804 3:140001263-140001285 GAGAGAGAAAAAAGGATGGGAGG - Intronic
963419129 3:145037153-145037175 GAGATGGAGAAAGGGGTGGGGGG + Intergenic
963917356 3:150871252-150871274 AAGAAGGACAGAAGGGTGGGTGG + Intronic
964074251 3:152674013-152674035 GAGAGAGAGAAAGCGGTGGGGGG - Intergenic
964176264 3:153828198-153828220 GAAAGTGGAGAAAGGGTGGGAGG + Intergenic
964176322 3:153828382-153828404 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
964941190 3:162158910-162158932 GAGAGTGGAAAAGGGGTGGGAGG + Intergenic
964941309 3:162159285-162159307 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
965288886 3:166850145-166850167 GAGAGTGAGGAAAAGCTGGGTGG - Intergenic
965863025 3:173170014-173170036 GAAATTGACAAATGTGTGGGAGG + Intergenic
966356167 3:179080721-179080743 AAGAGTCACAAAAAGGTAGGGGG - Intergenic
966540091 3:181079447-181079469 GAGAGTAAGCAAAGGGTGGTGGG - Intergenic
966540266 3:181081651-181081673 GAGAGTAAGCAAAGGGTGGTGGG - Intergenic
967516671 3:190377733-190377755 GCGAGTGATAAGAGGGTGAGCGG + Intronic
967838818 3:193987217-193987239 GAAAGTAAAAAAAGGGAGGGAGG + Intergenic
967850217 3:194076818-194076840 GAGACTAATTAAAGGGTGGGAGG - Intergenic
968594720 4:1476454-1476476 GTGAATGATAAATGGGTGGGTGG + Intergenic
969481437 4:7448931-7448953 GAGAGGGAAAAGAGGGAGGGAGG - Intronic
969718390 4:8879446-8879468 GGAAGTGAGTAAAGGGTGGGGGG + Intergenic
970328043 4:14948831-14948853 GAGAGAGAGAGAAGGGAGGGGGG - Intergenic
970838688 4:20441505-20441527 GAGAGAGACAGAAGTGGGGGGGG - Intronic
970889610 4:21028167-21028189 GACAGTGACAATTGGGGGGGAGG - Intronic
971208903 4:24597270-24597292 GAGAGATACAAAGGGGTGAGTGG + Intergenic
972070932 4:35019052-35019074 GAGAGTCAGTAAAGGGTGGTGGG - Intergenic
972760259 4:42096384-42096406 GAGAGTGACAAAAGCCTGATTGG - Intergenic
973270118 4:48254236-48254258 GAGAATGACAAAGAGGTTGGTGG + Intronic
973288159 4:48442691-48442713 GAGAGTGAGAAGTGGGAGGGGGG + Intergenic
974310862 4:60208769-60208791 GAGAGAGTCAGAAGGGTGGGGGG + Intergenic
974624886 4:64412416-64412438 GAAAGAGACAAAAAGATGGGGGG + Intergenic
974881927 4:67769526-67769548 GAGAGAGTCATGAGGGTGGGGGG + Intergenic
975089039 4:70378680-70378702 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
975152624 4:71037195-71037217 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
975755434 4:77567252-77567274 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
975945169 4:79696832-79696854 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
976137806 4:81957715-81957737 GAGAGTTACAGGAGGCTGGGAGG + Intronic
977206921 4:94173573-94173595 GAGAGGGAGGAAAGGTTGGGAGG + Intergenic
977555892 4:98487107-98487129 GAGAGAAACAAAAGGGAGGAAGG + Intronic
977840224 4:101694134-101694156 GGTAGTCAGAAAAGGGTGGGTGG - Intronic
979020233 4:115488526-115488548 GTGAGTGCCCAAAGGGTGAGGGG + Intergenic
979101056 4:116615257-116615279 GAGAGAGAGAAAGGGGAGGGAGG + Intergenic
979215509 4:118159142-118159164 CAGAGGGGCAGAAGGGTGGGTGG + Intronic
979518183 4:121635584-121635606 GAGAATGAGAAGAGGGTGGTGGG - Intergenic
979640947 4:123012213-123012235 GAAAGTGGAGAAAGGGTGGGAGG + Intronic
982335924 4:154238143-154238165 GAGAGAGAAAAGACGGTGGGGGG + Intronic
984281489 4:177675698-177675720 GGGACTAACAAAAGAGTGGGTGG + Intergenic
985645089 5:1081085-1081107 GAGAGAGGGAAAAGGGTAGGGGG + Intronic
985716836 5:1467633-1467655 TAGAGGGACAAAGGGATGGGCGG - Intronic
986119105 5:4814235-4814257 GAGAGAGTGCAAAGGGTGGGAGG - Intergenic
986145157 5:5071246-5071268 GAGAGAGAAAGAAGGGTCGGAGG - Intergenic
986477222 5:8147522-8147544 GAGGATGAGAATAGGGTGGGTGG + Intergenic
987163539 5:15170511-15170533 GAGAGAGAGAGAAGGGAGGGAGG - Intergenic
987950027 5:24662744-24662766 GAGGGTGAAAGAAGGGTGAGGGG + Intergenic
988093842 5:26576088-26576110 GAGAGTCACAATAAGATGGGTGG + Intergenic
988107288 5:26768393-26768415 CTCAGTGCCAAAAGGGTGGGAGG + Intergenic
988174006 5:27696798-27696820 GAGAGGGAGAAAAAGGAGGGAGG + Intergenic
988854212 5:35211588-35211610 AAGAGTTACAAAAGGGGGAGAGG + Intronic
990338349 5:54797039-54797061 AAGAGTGATAAAATAGTGGGGGG + Intergenic
990792786 5:59500594-59500616 GAGGATTCCAAAAGGGTGGGAGG + Intronic
991116676 5:62963171-62963193 GAGAGGAAGAAAAGGGTAGGGGG + Intergenic
991119258 5:62992946-62992968 GAGAGGAAGAAAAGGATGGGGGG + Intergenic
991510000 5:67365782-67365804 GAGAGTGCGAAAAGGCAGGGTGG + Intergenic
992225850 5:74619223-74619245 GTGAGTTACAGAAGGCTGGGTGG - Intergenic
992452261 5:76885417-76885439 GAAAGTGGGAACAGGGTGGGAGG + Intronic
992799726 5:80284927-80284949 GGAAGTGACAAAGAGGTGGGAGG + Intergenic
992829351 5:80579182-80579204 GAGAGAGAAAGAAGGGAGGGAGG + Intergenic
993426137 5:87766208-87766230 GAGAGCCAGAAAGGGGTGGGAGG + Intergenic
993751281 5:91671475-91671497 GAGAGTGTCAGAAGTCTGGGCGG - Intergenic
995320032 5:110824034-110824056 GAGAGTGACTAGGGGGTGGGTGG - Intergenic
996461458 5:123748560-123748582 GAGAGAGAAAACATGGTGGGAGG - Intergenic
997444906 5:133933802-133933824 GAGAGAGAAAGATGGGTGGGAGG - Intergenic
997572129 5:134938482-134938504 GAAGGTCACAAAAGGGTGAGAGG - Intronic
998699565 5:144682828-144682850 GAGAGTCAGGAAAGAGTGGGAGG - Intergenic
998779357 5:145639355-145639377 GAGAAGGGCAAGAGGGTGGGTGG + Intronic
999257539 5:150217930-150217952 CAGAGTGTCAAAAGGGGAGGAGG + Intronic
999731645 5:154479919-154479941 GAGAGTGAATGAAGGGTGGGGGG + Intergenic
1000772023 5:165366280-165366302 GGGAGGGAAAAAAGGGAGGGAGG + Intergenic
1001069473 5:168572412-168572434 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1001389764 5:171369433-171369455 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1002428438 5:179189278-179189300 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1003150852 6:3547829-3547851 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1005695801 6:28351632-28351654 GAGGGAGACAAAAGGGAAGGAGG - Intronic
1005699764 6:28388681-28388703 GACAGTGACAAAAGGGGAAGGGG - Intronic
1006109319 6:31735191-31735213 GAGAGAAACAAAAGGGGGGAAGG + Intronic
1006207000 6:32355383-32355405 GAGAGGGAAAAAAGGGAGGGAGG - Intronic
1006325639 6:33351684-33351706 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1007386604 6:41524297-41524319 GAGGGGGACAGGAGGGTGGGGGG + Intergenic
1008534596 6:52498268-52498290 AAGAGTGAGAAAAACGTGGGCGG + Exonic
1008867286 6:56228052-56228074 GAGAGTGGGAAAGGGGTGAGGGG + Intronic
1009214460 6:60903823-60903845 GAGAGAGACAAAGAGGAGGGAGG - Intergenic
1009604504 6:65849455-65849477 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1009673258 6:66784717-66784739 GAGAGAGAAAAAAGGGTTGCTGG + Intergenic
1011458151 6:87574574-87574596 GAGAGAGAGAATAGGGAGGGAGG + Intronic
1011554977 6:88564444-88564466 GAGATTGACATTGGGGTGGGTGG + Intergenic
1011626346 6:89286712-89286734 GAGACTGCCACGAGGGTGGGTGG + Intronic
1013808396 6:114017810-114017832 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1014114615 6:117657841-117657863 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1014853879 6:126375540-126375562 GGGAAAGACAAAAGGGTGAGAGG - Intergenic
1015040208 6:128707460-128707482 GAGAGTAACAAAAGAGTAGCTGG + Intergenic
1015575933 6:134671124-134671146 TAGACGGACAGAAGGGTGGGTGG + Intergenic
1015739653 6:136440134-136440156 TACAATGACAAACGGGTGGGAGG + Intronic
1015868842 6:137755289-137755311 GAGAAAGAAGAAAGGGTGGGAGG + Intergenic
1015990503 6:138936573-138936595 GAGAGAGACGGCAGGGTGGGGGG + Intronic
1016255893 6:142104888-142104910 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1017133666 6:151129692-151129714 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1017178300 6:151525648-151525670 GAGAGTCAGCAAAGGGTGGTGGG - Intronic
1017921931 6:158880475-158880497 GAGAGTTAGCAAAGGGTGGTGGG + Intronic
1018271202 6:162079686-162079708 GAGGGTGACAATAAGGTGGGTGG - Intronic
1018551403 6:165002090-165002112 GAGAGTGAGCAAAGGCTGCGAGG + Intergenic
1019085603 6:169473307-169473329 AAGAGTGACAAAAGGGAAGGAGG + Intronic
1019616488 7:1965207-1965229 GATGGTCACACAAGGGTGGGTGG + Intronic
1020468597 7:8509659-8509681 GAGAGTGACAAAAGGGGACTAGG + Intronic
1020793925 7:12660101-12660123 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1021458069 7:20851262-20851284 AAGAATGACAAATGGGTGGATGG + Intergenic
1022664190 7:32394848-32394870 GAGAGAGAGAAAAGGGAGGAAGG - Intergenic
1023392156 7:39720889-39720911 GAAAGAAAAAAAAGGGTGGGCGG - Intergenic
1023753830 7:43397508-43397530 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1023769410 7:43541332-43541354 AATAGTGACAAAAGGGTCAGTGG - Intronic
1023916927 7:44596877-44596899 GAGAGAGAGAGAAGGGAGGGAGG + Intergenic
1024360069 7:48459086-48459108 AAGTGTGAGAAAAGGGTGGCAGG + Intronic
1024629391 7:51234935-51234957 GAGAGGGAGAAAAGGATGGAGGG + Intronic
1026380062 7:69790422-69790444 GAGAGGGAGAAAAGGGTGGTGGG + Intronic
1026490647 7:70860393-70860415 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1027157600 7:75779888-75779910 GAAAGTGGAGAAAGGGTGGGAGG - Intronic
1028319321 7:89439387-89439409 GACAGAGACAAGGGGGTGGGAGG - Intergenic
1028767689 7:94578552-94578574 GAGACTGGCAAATGGGTGGGGGG - Intergenic
1029000994 7:97154022-97154044 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1029238392 7:99142669-99142691 GGGAGTGAGAAGAGGGTGGGTGG + Intronic
1029414933 7:100436530-100436552 GGGAGCGACAACAGGGTGGGTGG - Exonic
1029580552 7:101434231-101434253 GAGAGAGACAGGAGGGAGGGAGG - Intronic
1029628836 7:101737725-101737747 GAGAGAGAGAGAAGGGAGGGAGG + Intergenic
1029881065 7:103810315-103810337 CCGAGTGACAAAAGGATGGGAGG - Intronic
1030321970 7:108178846-108178868 TAGAGTGACAATAGGGAGAGTGG - Intronic
1032480006 7:132238802-132238824 CAGAGTCACAAGAGGGGGGGGGG + Intronic
1033084450 7:138329568-138329590 GAGAGTCAGCAAAGGGTGGCGGG - Intergenic
1034461081 7:151198403-151198425 GAGGCGGATAAAAGGGTGGGTGG + Intronic
1034928516 7:155142097-155142119 GAGAGGGAGAAGAGGGAGGGAGG - Intergenic
1036127700 8:6078500-6078522 GAGAGTGACAAAAAATTGGCAGG + Intergenic
1036132388 8:6127985-6128007 GAGAGAGACATAAGCATGGGAGG + Intergenic
1036546239 8:9771966-9771988 GAGAGGGAGAAAGAGGTGGGAGG + Intronic
1037387840 8:18362370-18362392 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1037475513 8:19253052-19253074 AAGAGTTACAAAAGGAAGGGAGG - Intergenic
1037548233 8:19944455-19944477 GAGAGAGAGAAAGGGGTGGGGGG + Intronic
1037941079 8:22951477-22951499 GAGAGTCAGCAAAGGGTGGTGGG + Intronic
1038040587 8:23720810-23720832 GAGAGAGAGAAAAGGGAGGAAGG - Intergenic
1038497773 8:28016579-28016601 TAGAGTGAGAGAAGGTTGGGAGG - Intergenic
1038570546 8:28658345-28658367 GAGGGTGAAAACAGGGTGGATGG - Intronic
1038680166 8:29659519-29659541 AAGAGTCACAAAGGGGTGAGAGG + Intergenic
1039314490 8:36356486-36356508 AAGAGAGACAAAAGGGAAGGAGG + Intergenic
1040305677 8:46210581-46210603 AAGAGAGACAACAGGGTGGCTGG + Intergenic
1040852570 8:51916289-51916311 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1042246623 8:66714503-66714525 GAGAGAGAGATAAGGGAGGGGGG - Intronic
1042310856 8:67378322-67378344 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1043033430 8:75168169-75168191 GAGAGAGAGAATAAGGTGGGAGG + Intergenic
1044056696 8:87579506-87579528 GAGAGAGACAGAAAGGAGGGAGG + Intronic
1045278113 8:100724753-100724775 GTGTGTGACAAAAGAGAGGGAGG - Intergenic
1045325886 8:101117422-101117444 AAGAGTGAGAAAAGGGGGTGGGG + Intergenic
1046657786 8:116913511-116913533 GAGAGTGAGGAAAGGCAGGGTGG - Intergenic
1047130939 8:122018710-122018732 GAGAGTCAGCAAAGGGTGGTAGG + Intergenic
1047158516 8:122349867-122349889 GAGAGAGAGAGAAGGGTGGGGGG - Intergenic
1047710436 8:127546407-127546429 GAGAGTGATAAAAGGTTGCCAGG - Intergenic
1048034570 8:130665364-130665386 GAGAATGTCCAAAGGGTGAGAGG - Intergenic
1048314417 8:133351546-133351568 GATATTGACAATAGAGTGGGAGG - Intergenic
1049319510 8:141988532-141988554 GAGAGTGGGAAAGGGGAGGGAGG - Intergenic
1049465003 8:142747064-142747086 GAGAGTGATGGATGGGTGGGTGG + Intergenic
1049707604 8:144050147-144050169 GGCAGTGAACAAAGGGTGGGAGG - Intergenic
1049880150 8:145056488-145056510 CAGATTGACCAAATGGTGGGTGG - Intergenic
1051273786 9:15379900-15379922 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1051346381 9:16154714-16154736 GTGAGCGACAGAAGGGTGGAGGG - Intergenic
1051388653 9:16539608-16539630 GAGAGAGAGAGAAGGGAGGGAGG + Intronic
1051388663 9:16539645-16539667 GAGAGAGAGAGAAGGGAGGGAGG + Intronic
1051569540 9:18540395-18540417 GAGAGTGACACAGGGATGGAGGG + Intronic
1051647321 9:19281390-19281412 TAGAGTGAGGAAAGAGTGGGGGG - Intronic
1051958568 9:22729755-22729777 CAGACTGACAAAAGGGTGATAGG + Intergenic
1052520462 9:29541487-29541509 GAGAAGGAGAAAAGGGAGGGAGG - Intergenic
1053060230 9:35024768-35024790 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1053076651 9:35139445-35139467 CAGAGAGACAATAGGATGGGAGG + Intergenic
1053353030 9:37425568-37425590 GAGAGTGCCAAGAAGGTGGCTGG - Intronic
1054790928 9:69255970-69255992 GAGAGAGAGAGAAGGGAGGGAGG - Intergenic
1055325079 9:75120399-75120421 GAGAGGGATAAAAGTGAGGGAGG + Intronic
1055919391 9:81442340-81442362 AAGAGTAACAGAAGGGTTGGTGG - Intergenic
1056266672 9:84903734-84903756 GAGAGAGAGAGAAGGGAGGGAGG - Intronic
1056636070 9:88332347-88332369 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1056934099 9:90902771-90902793 CAGATTGACCAAATGGTGGGAGG - Intergenic
1057488422 9:95504761-95504783 GAAAGTTACAAGAGGGTGGTAGG - Intronic
1057762483 9:97888083-97888105 AAGAGTGACAAGAGGGAAGGAGG - Intergenic
1058052217 9:100418405-100418427 GAGAGAGAAAAGAGGGAGGGAGG - Intergenic
1058129079 9:101228935-101228957 GACAGTGACTTGAGGGTGGGTGG - Intronic
1058645396 9:107127279-107127301 GACAGTGACAAGAAGGAGGGAGG + Intergenic
1059099733 9:111458633-111458655 GAGAGGGAGAGGAGGGTGGGGGG + Intronic
1059309919 9:113381282-113381304 GAGAGAGAGAAGAGGGAGGGAGG - Intergenic
1059346758 9:113634317-113634339 GAGAGTGACAGTAGGGCTGGAGG + Intergenic
1059423869 9:114208908-114208930 CAGAGTGAGGAAAGGCTGGGAGG + Intronic
1060466907 9:123914715-123914737 GAGAGTGAAACAAGGGAGGGAGG + Intronic
1061314572 9:129786856-129786878 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1061811466 9:133164633-133164655 GAGAGTGACCCAAGGGGTGGGGG + Intergenic
1203517470 Un_GL000213v1:16082-16104 GAGTATGATAAAAGTGTGGGAGG + Intergenic
1185529542 X:806614-806636 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1185552072 X:990436-990458 AAGAGAGCCAAAAAGGTGGGAGG - Intergenic
1185734270 X:2485533-2485555 GGGAGGGAGAAAAGGGAGGGAGG + Intronic
1186335599 X:8583477-8583499 GAGAATGAGAAAAGTGTGGAAGG + Intronic
1187076270 X:15938423-15938445 GAGAGGGAAAGAAGGCTGGGTGG - Intergenic
1188014146 X:25089440-25089462 GAGAGAGAGAGAAGGGAGGGAGG + Intergenic
1188366734 X:29324743-29324765 GTGAGAGACAAAAGGGCAGGAGG + Intronic
1189558614 X:42170165-42170187 GAGAGGAAGAAAAGGTTGGGTGG + Intergenic
1189808470 X:44758850-44758872 GAGAGAGGGAACAGGGTGGGAGG + Intergenic
1190387825 X:49899922-49899944 GAGAGTCAAGAAAGGGTGGTGGG + Intergenic
1190635724 X:52432030-52432052 GATAGAGACAAAAGGGATGGAGG - Intergenic
1190640135 X:52476253-52476275 GATAGAGACAAAAGGATTGGAGG + Intergenic
1190647537 X:52536612-52536634 GATAGAGACAAAAGGATTGGAGG - Intergenic
1191768938 X:64733653-64733675 GAGAGTGATAAAAAGCAGGGTGG - Intergenic
1192180416 X:68912454-68912476 GAGAGAAATAAAGGGGTGGGGGG - Intergenic
1192264578 X:69529949-69529971 AAGAGTGACAGTAGGGAGGGAGG + Exonic
1192406112 X:70887659-70887681 GAGAAAGACAAAAGGCTGGCTGG + Intronic
1192925288 X:75749220-75749242 GAGAATAAAAGAAGGGTGGGTGG - Intergenic
1194180565 X:90706368-90706390 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1194470612 X:94290756-94290778 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1195042351 X:101026019-101026041 GAGAAGGACAGAAGGGAGGGAGG + Intronic
1195141702 X:101967282-101967304 GAGAGAGGCAAAAGTGTGGCAGG - Intergenic
1195291409 X:103434343-103434365 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
1195291423 X:103434381-103434403 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
1195291437 X:103434419-103434441 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
1195291451 X:103434457-103434479 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
1195651943 X:107294170-107294192 CAGAGTGACAAAAGGTTGCATGG - Intergenic
1195671106 X:107470868-107470890 GAGAGGAACCAAAGGGTGGGTGG + Intergenic
1195697047 X:107674763-107674785 GAAAATGACAGAAGGTTGGGAGG + Intergenic
1195714976 X:107809809-107809831 GAGAGTGAGAAAAAAGGGGGAGG - Intergenic
1195747671 X:108135123-108135145 GAGAGTGACAACAGGTAAGGTGG - Intronic
1196247338 X:113415361-113415383 GAGAGGGAGGAAAGAGTGGGAGG + Intergenic
1198145523 X:133852664-133852686 GAGAGTGGCAAAAGTGCAGGAGG + Intronic
1198687700 X:139245080-139245102 GAGAGGGACAAAAGGATGAGAGG + Intergenic
1198712412 X:139519911-139519933 TAGAATGACAGAAGGGAGGGAGG + Intergenic
1198770912 X:140129056-140129078 GAGAAGGAGAAAAGGTTGGGTGG - Intergenic
1200527227 Y:4288528-4288550 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1202162641 Y:21951708-21951730 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1202228715 Y:22634660-22634682 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic
1202314441 Y:23561507-23561529 GAGAGTCAGCAAAGGGTGGTGGG + Intergenic
1202556361 Y:26109088-26109110 GAGAGTCAGCAAAGGGTGGTGGG - Intergenic