ID: 1156468033

View in Genome Browser
Species Human (GRCh38)
Location 18:37360377-37360399
Sequence ACAGGTTGTGCTCAGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156468033_1156468042 22 Left 1156468033 18:37360377-37360399 CCAGCCTGCTGAGCACAACCTGT 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1156468042 18:37360422-37360444 CTTCAAGTGGACCCCTGAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 99
1156468033_1156468045 25 Left 1156468033 18:37360377-37360399 CCAGCCTGCTGAGCACAACCTGT 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1156468045 18:37360425-37360447 CAAGTGGACCCCTGAGTGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 145
1156468033_1156468044 24 Left 1156468033 18:37360377-37360399 CCAGCCTGCTGAGCACAACCTGT 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1156468044 18:37360424-37360446 TCAAGTGGACCCCTGAGTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 104
1156468033_1156468038 9 Left 1156468033 18:37360377-37360399 CCAGCCTGCTGAGCACAACCTGT 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1156468038 18:37360409-37360431 CTTCTGCAGAGCCCTTCAAGTGG 0: 1
1: 0
2: 0
3: 23
4: 280
1156468033_1156468043 23 Left 1156468033 18:37360377-37360399 CCAGCCTGCTGAGCACAACCTGT 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1156468043 18:37360423-37360445 TTCAAGTGGACCCCTGAGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 120
1156468033_1156468041 21 Left 1156468033 18:37360377-37360399 CCAGCCTGCTGAGCACAACCTGT 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1156468041 18:37360421-37360443 CCTTCAAGTGGACCCCTGAGTGG 0: 1
1: 0
2: 1
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156468033 Original CRISPR ACAGGTTGTGCTCAGCAGGC TGG (reversed) Intronic
900166803 1:1247180-1247202 CCAGGTTGAGTTCAGCTGGCAGG - Intergenic
900194972 1:1371481-1371503 GCAGGGTGAGCTCTGCAGGCTGG + Intergenic
900296203 1:1951980-1952002 ACAGCTTTGGCTCAGCACGCAGG + Intronic
900465406 1:2822832-2822854 GCAGGTTGTGCTCTCCAGACAGG + Intergenic
900697614 1:4021965-4021987 AAAAGTGGTACTCAGCAGGCTGG + Intergenic
900868741 1:5286999-5287021 ACAGGGTGTGCTCACCAGCAGGG + Intergenic
902099123 1:13971041-13971063 TTAGGCTGTGCTCAGCAGGGAGG + Intergenic
902196745 1:14803803-14803825 ACTGGATGTGGTCAGCAGGCAGG + Intronic
902647368 1:17809498-17809520 ACAGGAGGTGAGCAGCAGGCAGG + Intronic
903392242 1:22972718-22972740 CCAGATTGTTCTCTGCAGGCTGG - Intergenic
904617160 1:31756095-31756117 ACAGGGTGTGGGCAGCAGGAGGG + Exonic
905483667 1:38280292-38280314 ACTGCTTGAGCTCAGGAGGCGGG - Intergenic
907272587 1:53299539-53299561 GCAGGCTGTGCCCAGGAGGCTGG + Intronic
907291248 1:53414276-53414298 ACATGTTAAGCTCAGCAGGGAGG - Intergenic
909514854 1:76495925-76495947 ACAAGTTTTGCTCATCAAGCTGG + Intronic
913010374 1:114677460-114677482 ACAGGCGGGGCTCAGCATGCTGG + Exonic
914680148 1:149933391-149933413 AAAGGTTATTCTCACCAGGCAGG + Exonic
915023725 1:152806445-152806467 GGAGGATGTGCTCAGGAGGCAGG - Intronic
916214390 1:162383287-162383309 ACAGCCTGTCCTCAGCAGTCTGG + Exonic
917789358 1:178489516-178489538 ACAGGATGTGGGCACCAGGCAGG + Intergenic
921318434 1:213914450-213914472 ACTGGTGCTGCTGAGCAGGCAGG - Intergenic
921921418 1:220674407-220674429 ACAGGTTATGCAAAGCAGGTGGG + Intergenic
922947539 1:229529861-229529883 CGAGGCTGTGCTCAGCAGCCAGG - Intronic
924431981 1:244005040-244005062 ATTGGTTGTCCTCTGCAGGCAGG + Intergenic
1063939218 10:11109761-11109783 AACGCTTGTGCTCTGCAGGCCGG + Intronic
1066369659 10:34809670-34809692 ACAGGCTGTGCTCAGAAGGCAGG + Intronic
1067781957 10:49214156-49214178 ACAGCATGTGCTCTGAAGGCAGG + Intergenic
1069421504 10:68250640-68250662 AGAGGTTGTGCACTGCAGTCAGG - Intergenic
1069684459 10:70308749-70308771 ACAGGCTGTTTTCAGAAGGCAGG + Intronic
1071234071 10:83623945-83623967 ACAGGTGGTGCTCAGCTCGAGGG + Intergenic
1071516811 10:86303450-86303472 AGAGACTGTGCTCAGCAGGAAGG + Intronic
1075323962 10:121515149-121515171 TCAGCTTGTGCACAGCCGGCTGG + Exonic
1075764354 10:124880654-124880676 ACAGAATGTGCTCAGCGGGGGGG - Intergenic
1076011529 10:126993175-126993197 GCAGGACGTGCACAGCAGGCTGG + Intronic
1077032593 11:476213-476235 ACCGTCTGTGCTCAGCCGGCTGG - Intronic
1080053533 11:27881751-27881773 ACAGGTTGGACTTAGCTGGCAGG - Intergenic
1081416644 11:42823296-42823318 ACAGCTTCTGCTGAGCAGGTAGG - Intergenic
1081807383 11:45897921-45897943 GCAGGGGGTGGTCAGCAGGCAGG - Intronic
1081843248 11:46218935-46218957 AAAAGTTGGGCTCTGCAGGCCGG + Intergenic
1086063990 11:82728153-82728175 ACAGCTTGTCCTCATGAGGCAGG + Intergenic
1091097305 11:132836300-132836322 ACAGATAATGCTGAGCAGGCAGG - Intronic
1091795713 12:3296492-3296514 AAGGGCTGTGCTCAGCAGGCTGG + Intergenic
1092090083 12:5797210-5797232 ACAGGCTGGACTCTGCAGGCAGG + Intronic
1093769107 12:22998999-22999021 GGAGGTGGTGCTCAGCAGGATGG - Intergenic
1101330655 12:103755309-103755331 ACCACCTGTGCTCAGCAGGCTGG + Exonic
1101942737 12:109111895-109111917 ACATTTTGTGGTCAGCAAGCTGG + Intergenic
1101965528 12:109279588-109279610 ACAGGGTGTTCCCAGAAGGCAGG - Exonic
1103582356 12:121924816-121924838 AATGGTGTTGCTCAGCAGGCAGG + Intronic
1103761916 12:123256484-123256506 ACAGGTTGTCCTGACCAGCCTGG + Intronic
1104962594 12:132495316-132495338 ACACGCGGTGCTCGGCAGGCCGG - Intronic
1108264160 13:48687995-48688017 ACAAGTCCTGCTAAGCAGGCTGG + Intronic
1109343734 13:61091533-61091555 ACAGGTTGGGCACTGCAGGGTGG - Intergenic
1110300703 13:73923518-73923540 ACAGGCTGTGCCCATCAGACAGG + Intronic
1112265657 13:97921064-97921086 AAAGCTTGTGCTCAGCTGGGTGG - Intergenic
1113016458 13:105833579-105833601 ATAGAATGTGCTCAGCACGCGGG + Intergenic
1116322350 14:43485061-43485083 AAAGCTTGTGTTCAGCAGACAGG + Intergenic
1118482141 14:66178107-66178129 ACTGGCTGGGCTCAGCAGGGTGG + Intergenic
1119268038 14:73276728-73276750 GCAGGTTGGCCTCAGCAGACAGG - Exonic
1122960321 14:105091167-105091189 AGAGTTTGTCCTCAGCTGGCAGG - Intergenic
1123174658 14:106405087-106405109 ACAGGTTCCACTCTGCAGGCTGG + Intergenic
1202944030 14_KI270726v1_random:10692-10714 ACAGGTTCCACTCTGCAGGCTGG - Intergenic
1126697904 15:51341412-51341434 AGAGGGTTTGCTCAGCTGGCGGG + Intergenic
1127460723 15:59196404-59196426 ACAGGGTGTGCTCAGCTGTGGGG - Intronic
1128604791 15:69028461-69028483 CCAGGCTGGGCTCAGGAGGCCGG - Intronic
1129887183 15:79046876-79046898 CCAGGTGGTGTTCAGCATGCTGG - Exonic
1135067271 16:19320932-19320954 ACAGTTTGTTCCCAGCAGGCTGG - Intronic
1136271429 16:29151087-29151109 AAAGCTTCTGCACAGCAGGCCGG - Intergenic
1137249390 16:46731167-46731189 TCTGGTTGGGCTCAGCTGGCAGG - Intronic
1137757428 16:50913764-50913786 AGAGGTTTTCCTCAGGAGGCTGG + Intergenic
1140113183 16:72020942-72020964 AGTGGTTTTGGTCAGCAGGCGGG + Intronic
1141199679 16:81887600-81887622 TCAGGTGGTGACCAGCAGGCTGG - Intronic
1141453611 16:84122545-84122567 ACAGGATGTGTTCCCCAGGCTGG + Exonic
1142316050 16:89345774-89345796 ACATGCTGTGCACACCAGGCTGG + Intronic
1145916998 17:28580085-28580107 ACAGGCTGTACTCAGCAGAAGGG + Exonic
1147561205 17:41510385-41510407 ACAGGAGGTGCTGGGCAGGCAGG + Intergenic
1147825009 17:43264725-43264747 ACAGGTTTGGACCAGCAGGCTGG - Intergenic
1152577843 17:81150694-81150716 ACAAGGGGTGCTCAGCAGGCTGG + Intronic
1152608157 17:81303270-81303292 CCAGGGTGTGCTGAGCAGGCCGG + Intergenic
1152989001 18:345184-345206 AGATGCTGTGCTCAGCAGTCTGG - Intronic
1156468033 18:37360377-37360399 ACAGGTTGTGCTCAGCAGGCTGG - Intronic
1157944049 18:51958893-51958915 ACTGGTTAGGCTCAGCAGCCAGG - Intergenic
1160789254 19:915735-915757 CAAGGTTGTGCTGACCAGGCTGG + Intergenic
1163761048 19:19137064-19137086 ACTGGTTGAGCTCAGCAGAGAGG - Intronic
1165123900 19:33580757-33580779 ACACATTGTCCTCAGCAAGCTGG - Intergenic
1165335145 19:35164515-35164537 CTAGGGTGTGCTCAGCTGGCTGG + Intronic
926249191 2:11143994-11144016 CCAGGTTGTGGGCAGCAGGCTGG + Exonic
926365454 2:12129047-12129069 AAAGGTTGAGCTCAGAATGCTGG + Intergenic
927179975 2:20438485-20438507 CCACGTTGTGCTGAGCAGCCCGG + Intergenic
928115622 2:28543455-28543477 ACAGGTTCTGCGCTGCAGCCAGG + Intronic
928887721 2:36169248-36169270 ACAGGTGGAGGTCAGCAGACAGG - Intergenic
929895935 2:45960868-45960890 AGAGGTTGTGCTGGGCAGGTAGG - Intronic
930194803 2:48498619-48498641 ACAGGTAGTGCCCAGCTGGTTGG + Exonic
930225763 2:48790965-48790987 ACAGCTTGCACACAGCAGGCCGG - Intergenic
933723295 2:85411611-85411633 AAAGGTATTGGTCAGCAGGCTGG + Intronic
933729776 2:85447718-85447740 ACTTGGAGTGCTCAGCAGGCTGG - Intergenic
934494213 2:94783322-94783344 ACAGGCTGTGCAATGCAGGCAGG + Intergenic
934689299 2:96346137-96346159 ACAGGTTGGGCTCGGCTGACGGG + Intronic
936054070 2:109247535-109247557 ACAGGAAGAGCACAGCAGGCTGG - Intronic
938912412 2:135898013-135898035 ACAGGCTGTGCTGAGGAGGCAGG + Intergenic
940906599 2:159175236-159175258 ACAGGTGGTCCCCAGAAGGCAGG + Intronic
940971953 2:159904736-159904758 GCAGGCCGCGCTCAGCAGGCGGG - Intronic
941126820 2:161594479-161594501 AGAGTTGCTGCTCAGCAGGCAGG + Intronic
942791093 2:179761793-179761815 ACAGGTTGTGTTGCCCAGGCTGG + Intronic
944889085 2:204098423-204098445 ACAGGTTGGGCTCTGCAGCCAGG + Intergenic
948112699 2:235469530-235469552 ACAGGCTCTGCTCAGGATGCAGG + Intergenic
948450730 2:238069505-238069527 GCAGCTGGAGCTCAGCAGGCTGG - Intronic
1174178960 20:48662947-48662969 AGAGGTTGTGCCCAGCTGACTGG + Intronic
1175790062 20:61735433-61735455 ACAGGTTCTGCCCACCAGGGGGG - Intronic
1175813722 20:61872844-61872866 AGAGTTGGTGCTCAGTAGGCAGG + Intronic
1178605957 21:34036678-34036700 GGAGGGTGTGCTCAGCAGGGAGG + Intergenic
1179027454 21:37691440-37691462 GCAGGCTGTGCCAAGCAGGCTGG - Intronic
1179408991 21:41147670-41147692 TCTGGTTGTGCTGAGCAGGGAGG + Intergenic
1179427851 21:41295917-41295939 ACAGGCTGTGCCCTGCAGGCTGG + Intergenic
1179446541 21:41435833-41435855 ACAGGTTGTTCTCAGCCACCTGG - Exonic
1181324302 22:22032898-22032920 ACAGGCTGGGCTCAGGACGCTGG - Intergenic
1183425245 22:37735568-37735590 ATGGGTTGTGGTCAGCAGGGAGG - Intronic
1183674662 22:39292582-39292604 ACAGCAGGTGCTCAGGAGGCAGG - Intergenic
1184191472 22:42898022-42898044 ACTGGTGGGGCTCAGAAGGCTGG + Intronic
1184794624 22:46724725-46724747 AAAGGCTGGGCTCAGCAGGGCGG + Intronic
1184916263 22:47571114-47571136 CCTGGTTTTGCCCAGCAGGCAGG - Intergenic
1185075905 22:48682157-48682179 CCAGGTTGTGGCCAGCAGTCTGG + Intronic
1185314723 22:50174127-50174149 ACAGGGTTTGGCCAGCAGGCAGG + Intronic
949661450 3:6283828-6283850 ACAGGTTGTGGCTAGCAGGCAGG - Intergenic
951117386 3:18880771-18880793 AAAGATTGTTCTCAGAAGGCAGG - Intergenic
951266784 3:20577444-20577466 AGAGGTTGAGTTCAGCAGGCAGG - Intergenic
952571727 3:34725878-34725900 ACAGGCTGTTCTCAGCAGAGAGG - Intergenic
954068048 3:48122570-48122592 GTGGGTTGTGCTCAGCAGCCTGG + Intergenic
954395428 3:50290905-50290927 ACAGGGTGTGATCACCAGGCTGG + Intronic
961003814 3:123391316-123391338 ACAGTCTGTGGTCATCAGGCTGG - Intronic
961791725 3:129381137-129381159 ACAGGGTGGGCTGGGCAGGCTGG + Intergenic
961805749 3:129488090-129488112 ACAGGGTGGGCTGGGCAGGCTGG + Intronic
964527441 3:157630418-157630440 AGAGCTTGTCCTCAGCTGGCAGG + Intronic
965058610 3:163753842-163753864 ACAGATTGTGCTCAGCAAATGGG - Intergenic
965396348 3:168164360-168164382 ACAGGTTGTGGTCAAAATGCAGG + Intergenic
965862790 3:173167420-173167442 ACAGGTTGAGCTGAGCAAGTAGG + Intergenic
966909306 3:184549859-184549881 GCAGGTGGTGCTAAGCAGGTTGG + Intronic
969984808 4:11197282-11197304 GCAAGTTTTTCTCAGCAGGCTGG + Intergenic
970569424 4:17365189-17365211 ACTGGTTGTGTTCACCATGCAGG - Intergenic
981711006 4:147708999-147709021 ACAGGTTGTGGTAAGGAAGCTGG + Intergenic
983089291 4:163485317-163485339 TCAGGATGTGCAAAGCAGGCAGG + Intergenic
983123630 4:163920645-163920667 GCAGGTTGAGCTCAGAGGGCAGG - Intronic
985136229 4:186788593-186788615 AGAGGTTGTGGTCTGCATGCAGG + Intergenic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
988329089 5:29811804-29811826 TCAGGTTGTGCCAAGCAGGCAGG - Intergenic
988600432 5:32634989-32635011 GCAGGTTGTGCTCTGCAGTGGGG - Intergenic
989136949 5:38165528-38165550 ACAGCTTGTGTTCAGGAGCCAGG - Intergenic
994633093 5:102309905-102309927 GCAGGGTGGGTTCAGCAGGCTGG - Intergenic
995336858 5:111009319-111009341 GCAGGTAATGCTGAGCAGGCTGG - Intergenic
997951596 5:138246771-138246793 AGAGATTGTGCTCAGGAGTCAGG + Intergenic
1001858190 5:175031025-175031047 ACAGCATGTGCTCAGCGGTCGGG + Intergenic
1005047784 6:21658555-21658577 CCAGGTTGTGCACACCAAGCAGG + Intergenic
1007703958 6:43780116-43780138 CCAGGTCGTGCTGAGCAGGCTGG + Intronic
1008051597 6:46905281-46905303 ACAGGTTGTACTCTGCACACTGG + Intronic
1009490517 6:64284744-64284766 CCAGGTTGTGTTGAGCATGCGGG - Intronic
1012549050 6:100451167-100451189 ACAGGTAGTGCTGAATAGGCAGG + Intronic
1012683853 6:102218103-102218125 ACATGGTGTGATCAGAAGGCTGG + Intergenic
1013772748 6:113645752-113645774 ACAGTTTATGGTCAGCTGGCTGG - Intergenic
1014218418 6:118775648-118775670 ACAGAGGCTGCTCAGCAGGCAGG - Intergenic
1017689791 6:156952570-156952592 AGTGGTTGTGGGCAGCAGGCCGG + Intronic
1018482846 6:164209163-164209185 AGACATTGTGCTCAGCAGTCAGG - Intergenic
1019219572 6:170463367-170463389 AGGGGAGGTGCTCAGCAGGCAGG + Intergenic
1019639548 7:2096139-2096161 ACAGGCTGTGCTCAGAAGAAAGG + Intronic
1021085372 7:16416537-16416559 ACAGCTTCTGCACAGCAGCCAGG + Intronic
1023862377 7:44224403-44224425 ACAGCTTGTCCTCAGCCAGCAGG - Intronic
1024631568 7:51252703-51252725 TCAGGTTGTCCCCAGCAGGAGGG + Intronic
1025714041 7:63937912-63937934 ACAGCCTGTGCTGAGTAGGCAGG + Intergenic
1025752770 7:64307611-64307633 ACAGGTTGAGATCAGCTGCCCGG - Intronic
1031909413 7:127499349-127499371 ACACGTTGTGTTCTCCAGGCAGG + Intergenic
1032422534 7:131794119-131794141 ACAAGTTGTGCAGAGCAGACAGG - Intergenic
1033558774 7:142511299-142511321 ACAGGACATGCCCAGCAGGCAGG + Intergenic
1033801442 7:144906966-144906988 AGAGGTTGCACTGAGCAGGCTGG + Intergenic
1034114754 7:148574999-148575021 ACAGGTTGTCATGAGAAGGCAGG - Intergenic
1034359511 7:150481691-150481713 ACAGGATGTGCTCAACAGACTGG + Intergenic
1035353374 7:158261892-158261914 ACAGTTAGTGCTCAGGAGGGAGG + Intronic
1036379498 8:8227935-8227957 GCAGGCTGCGCTCAGGAGGCGGG - Intergenic
1036724166 8:11204463-11204485 ACAGTTGGTGCTTAGCAGGCCGG - Intergenic
1037841641 8:22249276-22249298 ACAGGTGGTGCTCATCAAGCAGG + Exonic
1038119895 8:24601357-24601379 TCAGGATGTGCTCTGCAGGTAGG - Intergenic
1039768242 8:40654089-40654111 ACAGGTTATGCAAAACAGGCAGG - Intronic
1041233394 8:55775296-55775318 ATAGGGTGTGCACAGTAGGCAGG + Intronic
1044253812 8:90036366-90036388 ACAGATACTGCACAGCAGGCAGG - Intronic
1047570003 8:126087319-126087341 ACAGATTCTTCTCAGCAGCCTGG + Intergenic
1050583937 9:7090360-7090382 ACAGCTTGTTATCAGCAGGGAGG + Intergenic
1053261150 9:36666057-36666079 ACTGCCTGTCCTCAGCAGGCAGG + Intronic
1056633000 9:88308818-88308840 CCAGGTTTTGGTCAGGAGGCGGG - Intergenic
1056920824 9:90787287-90787309 ACAGGCTGTGCTCAGCACAGGGG - Intergenic
1057547917 9:96031846-96031868 TCAGGATGTGCCCAGCAAGCAGG - Intergenic
1058129373 9:101232673-101232695 ACAGATGTAGCTCAGCAGGCAGG - Intronic
1060493281 9:124100369-124100391 CCAGGCTGTGCCCAGCAGCCTGG - Intergenic
1060602192 9:124885737-124885759 ACAGGAGGGGCTCAGCTGGCAGG + Intronic
1060828243 9:126698567-126698589 ACAGGGTGGGCTCACCAGTCAGG - Exonic
1060928700 9:127474123-127474145 ACAGCTTGTGCTTGGCAAGCTGG - Intronic
1062066991 9:134533929-134533951 CCAGGTTAGGCTCAGCCGGCGGG + Intergenic
1062155616 9:135046608-135046630 GCAGGATGTGGTCAGCAGACTGG - Intergenic
1185468599 X:369674-369696 AGAGGGTGCGCACAGCAGGCAGG + Intronic
1185851233 X:3490599-3490621 ACAGGAAGTGATCAGCAGGTGGG + Intergenic
1186130764 X:6462986-6463008 GCAGTATGTGCGCAGCAGGCAGG + Intergenic
1191608606 X:63087639-63087661 ACTGGGTGTAATCAGCAGGCTGG - Intergenic
1194097895 X:89665992-89666014 ACAGGCTGTGATGAGCAGGGTGG + Intergenic
1195583280 X:106532480-106532502 ACAGGCTGTGCTCAACAATCAGG - Intergenic
1199979909 X:152915207-152915229 AGAGGTGGTGCTCAGGTGGCTGG + Intronic
1200450917 Y:3327381-3327403 ACAGGCTGTGATGAGCAGGGTGG + Intergenic
1202037093 Y:20646599-20646621 ATAAGTTGTCCTCAGCTGGCAGG - Intergenic
1202046373 Y:20740301-20740323 ACAGCTTGAGCCCAGCAGCCTGG + Intergenic