ID: 1156468669

View in Genome Browser
Species Human (GRCh38)
Location 18:37363844-37363866
Sequence GGGTCCTGAGCATAAGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156468669_1156468674 -9 Left 1156468669 18:37363844-37363866 CCCCTGTCTTATGCTCAGGACCC No data
Right 1156468674 18:37363858-37363880 TCAGGACCCTGGGTACTCTCTGG No data
1156468669_1156468677 5 Left 1156468669 18:37363844-37363866 CCCCTGTCTTATGCTCAGGACCC No data
Right 1156468677 18:37363872-37363894 ACTCTCTGGCCTCCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156468669 Original CRISPR GGGTCCTGAGCATAAGACAG GGG (reversed) Intronic