ID: 1156470068

View in Genome Browser
Species Human (GRCh38)
Location 18:37371829-37371851
Sequence TCAGGGGCCCAGGAAGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 368}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156470060_1156470068 19 Left 1156470060 18:37371787-37371809 CCCTGGGGATGGTATCAAGGGTG 0: 1
1: 0
2: 1
3: 13
4: 141
Right 1156470068 18:37371829-37371851 TCAGGGGCCCAGGAAGAACAAGG 0: 1
1: 0
2: 2
3: 43
4: 368
1156470061_1156470068 18 Left 1156470061 18:37371788-37371810 CCTGGGGATGGTATCAAGGGTGA 0: 1
1: 0
2: 1
3: 11
4: 101
Right 1156470068 18:37371829-37371851 TCAGGGGCCCAGGAAGAACAAGG 0: 1
1: 0
2: 2
3: 43
4: 368
1156470057_1156470068 24 Left 1156470057 18:37371782-37371804 CCAGGCCCTGGGGATGGTATCAA 0: 1
1: 0
2: 0
3: 17
4: 150
Right 1156470068 18:37371829-37371851 TCAGGGGCCCAGGAAGAACAAGG 0: 1
1: 0
2: 2
3: 43
4: 368
1156470056_1156470068 25 Left 1156470056 18:37371781-37371803 CCCAGGCCCTGGGGATGGTATCA 0: 1
1: 0
2: 1
3: 27
4: 186
Right 1156470068 18:37371829-37371851 TCAGGGGCCCAGGAAGAACAAGG 0: 1
1: 0
2: 2
3: 43
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156470068 Original CRISPR TCAGGGGCCCAGGAAGAACA AGG Intronic
900125415 1:1066977-1066999 TGGGGGGCTCAGGAAGAACCAGG + Intergenic
900464054 1:2815527-2815549 TCAGGAGCTCAGGAAGAACTGGG + Intergenic
900695449 1:4006651-4006673 TCAGGGACCCAGGCAGAGCCAGG - Intergenic
900828899 1:4949777-4949799 GCAGGGTCACAGAAAGAACAAGG - Intergenic
900889430 1:5438731-5438753 TCAGAGGCCTAGGAGGAAAAAGG - Intergenic
900916778 1:5644955-5644977 TCAGGTGCCCAGGATGCACCAGG + Intergenic
900920776 1:5668828-5668850 TCATGGGCCCAGGCAAATCACGG - Intergenic
900955291 1:5882993-5883015 TCTGAAGCCCAGGAAGAACAGGG + Intronic
900956060 1:5887169-5887191 TCACGGGCCCAGGAGGAAACCGG - Intronic
901631152 1:10648844-10648866 TCAGGGTCCCAGGAAGGGCCTGG + Intronic
902547949 1:17201910-17201932 GCAGGGGCCCAGGCAGGTCATGG + Intergenic
903019474 1:20383964-20383986 TCTGGGGCCCAGGAAGGATTTGG - Intergenic
903348019 1:22700073-22700095 TCAGGGGCCCAGGCAGCCCCTGG - Intergenic
903474350 1:23609176-23609198 TCAGAGACCCAAGAAGAATAGGG + Intronic
906013095 1:42547994-42548016 TCAGGGGCCAAGCAAAAAGATGG + Intronic
907819810 1:57956173-57956195 TCAGGGTCCCAGCAAGAAACTGG + Intronic
908436707 1:64114030-64114052 TCAGGGGCAGAGGGAGAAAATGG - Intronic
910175635 1:84427408-84427430 TAAGGGGCAAAGGAAGAAAATGG + Intergenic
910742611 1:90536540-90536562 TCAGTGGAGCAGGACGAACAAGG - Intergenic
911889448 1:103348620-103348642 TCATGGTTCCAGGAAGAACTGGG + Intergenic
912201759 1:107465704-107465726 TCCAGGGACCAGGGAGAACATGG + Intronic
914802642 1:150972548-150972570 CCAGGGGGCCTGGAAAAACAGGG - Intronic
915492813 1:156260815-156260837 AGAGGGGCTCAGGAAGAACAAGG + Intronic
915827368 1:159092489-159092511 TCTGAGGACAAGGAAGAACACGG + Intronic
916455076 1:164962737-164962759 TCAGTGGTCCAGGAAGGAGAGGG - Intergenic
916825020 1:168434872-168434894 TCAGGGGCTGGGGAAGAGCATGG + Intergenic
917216193 1:172680786-172680808 GCAGGGGCCAAGGCAGAGCAGGG - Intergenic
918171542 1:182002859-182002881 TCTGGCGCCCAGGAAGAATCAGG + Intergenic
920228820 1:204456949-204456971 CAAGGGGCCCAGGCAGAAAAAGG + Intronic
920848955 1:209615631-209615653 TCAGGGGCCCAGGGATAATTAGG - Intronic
921430965 1:215065585-215065607 TTAGGTGCCCAGGAACCACATGG + Intronic
922543743 1:226438602-226438624 ACAGGGGGCCAGGAAGAAAGTGG + Intergenic
922966913 1:229698018-229698040 TCAGGTCACCAGAAAGAACAAGG - Intergenic
923836667 1:237618467-237618489 TCAGGACCCAAGGAACAACATGG + Intronic
1062823709 10:553167-553189 ACTGGGGCCCAGGAAGAGCTGGG + Intronic
1062884881 10:1009014-1009036 TGAGGAGTCCAGGAAGAAGAGGG + Exonic
1064453135 10:15461653-15461675 TCAGTGACCCAGAAAAAACAAGG + Intergenic
1064783581 10:18869497-18869519 TCAGGACCCCTGGAAGAAGATGG - Intergenic
1066616504 10:37300366-37300388 TCAGGGCCCCAGGAAGAAGGGGG - Intronic
1067287159 10:44914940-44914962 TGAGGTGGCCAGGAAGAGCATGG + Intronic
1067459717 10:46448827-46448849 TTTGGGGCCCAGGAAGGATACGG + Intergenic
1067627470 10:47935786-47935808 TTTGGGGCCCAGGAAGGATACGG - Intergenic
1067787121 10:49258561-49258583 TGAGGGGGCCAGGAAGAAAGAGG + Intergenic
1070143889 10:73759880-73759902 TCAGAGGCACAGGAAATACAAGG - Intronic
1071676724 10:87661628-87661650 GCAGGAGCCCAGGAAGAGGAGGG + Intronic
1073428579 10:103471407-103471429 TCAGCACCCCAGGAAGTACAGGG - Intergenic
1075549484 10:123381650-123381672 TCAGGGCCACAGGAGGAGCAAGG + Intergenic
1076467402 10:130693427-130693449 TCAGGTTCCCAGGAGGAATATGG - Intergenic
1076773093 10:132677781-132677803 TTAGGAGCCCAGGAAGGACCGGG - Intronic
1076880282 10:133236460-133236482 GCAGGGTCCGAGGAAGACCAGGG + Intergenic
1077044752 11:539822-539844 GGAGGGGCTCAGGAAGAACAGGG + Intronic
1077113738 11:873406-873428 CCAGGCTCCCAGGAGGAACAAGG + Intronic
1078902708 11:15656222-15656244 TCCCAGGACCAGGAAGAACAGGG + Intergenic
1080245113 11:30171179-30171201 TCAGGCTACAAGGAAGAACATGG - Intergenic
1080273661 11:30478640-30478662 TCAGGAGTCCAGGAACAAGATGG - Intronic
1080583910 11:33665174-33665196 TCCTGGGTCCAGGAAGAATAAGG + Intronic
1081661300 11:44889942-44889964 TCTGGGTCACAGGGAGAACAGGG - Intronic
1081976435 11:47238285-47238307 GCAGTGGCCCACGAAGAAGATGG + Intronic
1082689234 11:56279534-56279556 TTAGGGACTCAGGAAGGACAAGG - Intergenic
1085324208 11:75594258-75594280 ACAGGGCCCCTGGCAGAACATGG + Intronic
1085475603 11:76786966-76786988 TCAGGGACCAGGGAAGAAAAAGG - Intronic
1085513979 11:77101863-77101885 CCAGGGGCCGAGGAAGAATCTGG - Intronic
1086281522 11:85195064-85195086 TCTGAAGCCCAGGAAGAACAAGG + Intronic
1088135716 11:106553092-106553114 TCCTGGGACCAGGAAGAACGAGG - Intergenic
1088969123 11:114756113-114756135 TAATGGGCCCAGGAAGAAAGAGG - Intergenic
1089025484 11:115265354-115265376 CCAGAGGCCCAGGAAGACTAAGG - Intronic
1089444624 11:118542128-118542150 TCTGGGGGCCGGGAAGTACACGG + Intronic
1089554806 11:119310501-119310523 TCAGGGCCACAGGAAGAGAAGGG + Intronic
1089785349 11:120903467-120903489 GCAAGGGCCCAGGAAGTGCAGGG - Intronic
1090678930 11:129032087-129032109 TCTGGGGTCCAGGAAGAATCAGG - Intronic
1091155287 11:133366368-133366390 TCAGGGGATCAGGAAAAAGAAGG + Intronic
1092163266 12:6327717-6327739 TCAGGGGAGGAGGAAGAAGAGGG + Exonic
1094250191 12:28351018-28351040 TTGTGGGGCCAGGAAGAACACGG - Intronic
1096241583 12:49962676-49962698 TGAGGGGCCCAGGAGGAAGGTGG - Intronic
1096777309 12:53972142-53972164 GTAGGGGTCCAGGAAGAATATGG - Intergenic
1097320263 12:58218138-58218160 TCAGGGATCCTGGAAAAACAGGG + Intergenic
1097939450 12:65287734-65287756 TTAGGGGGCCAGGAAGAGGAGGG + Intronic
1098004997 12:65986821-65986843 TTAAGGGCTCAGGAAGGACAAGG + Intergenic
1099455876 12:82862235-82862257 TCATGACCCCAGGAAGTACATGG + Intronic
1100695998 12:97093664-97093686 TCAGGGTCCAAGCAAGAAAACGG - Intergenic
1101280086 12:103244459-103244481 TCAGGGGCTCAGGCTGAACATGG - Intronic
1101312035 12:103589728-103589750 TCAGCAGCCCAGTGAGAACATGG + Intronic
1101492635 12:105223430-105223452 TCAGGGAACCACCAAGAACAAGG + Intronic
1101557406 12:105823171-105823193 CCAGGGACCCAGGAAGAACAAGG + Intergenic
1101581917 12:106049377-106049399 TCTTGGGCCCAGGAAGCATAAGG - Intergenic
1102804642 12:115769021-115769043 TCAGGGTCCCAGCAAGAAGCAGG + Intergenic
1103578873 12:121899592-121899614 TCAGGGGCCAAGGAAGACAGTGG - Intronic
1104604546 12:130178420-130178442 TTAAGGGCCCAGGAAGCACAGGG + Intergenic
1104996468 12:132660885-132660907 CCAGGAGCCCAGGAAGCACGGGG + Intronic
1105068078 12:133217265-133217287 TCAGAGGCCCAGGCTGCACAAGG - Intergenic
1105245369 13:18645470-18645492 GAAGGGGTCCAGGGAGAACATGG - Intergenic
1106024962 13:25947716-25947738 TCACGGCCCCAGGAAGAAGAGGG - Intronic
1106846011 13:33738502-33738524 TCAGAGACCCTGGAAGCACATGG - Intergenic
1107101446 13:36597792-36597814 CCAGGGGCCCAGGGAAAACCTGG + Intergenic
1107294404 13:38894412-38894434 TCTGGCGTCCAGGAAGAACCAGG - Intergenic
1108159075 13:47618990-47619012 TCAGGTGTCCAGGAAGAATCAGG - Intergenic
1108468263 13:50740947-50740969 AGAGGGGCCCAGGATGAACAAGG - Intronic
1108580844 13:51826984-51827006 ACAGGCACCCAGGAAGCACAGGG - Intergenic
1109603510 13:64662855-64662877 TCAGGATCCCAGAAAGGACAGGG - Intergenic
1109808915 13:67482814-67482836 TCAGGTGCCCAGGTAGGAAAAGG - Intergenic
1111072240 13:83184105-83184127 TCCGGGGCCCAGGAAGCCCCTGG - Intergenic
1111640870 13:90968274-90968296 GCTGTGGCCCAGGAAGAAGAGGG - Intergenic
1112032409 13:95469698-95469720 TCATGAGCCCAGGATGAGCAAGG + Intronic
1113232692 13:108232466-108232488 TCAGGGGTCCATGAAGCCCATGG + Exonic
1113260144 13:108552796-108552818 TCTGGGGGCCAGGAAGCCCAAGG + Intergenic
1113454107 13:110435438-110435460 TCAGGGGCCCAACAGGTACAAGG + Intronic
1113503339 13:110795204-110795226 TCAGGCACTCAGGGAGAACACGG - Intergenic
1113885473 13:113656495-113656517 GCGGGGGCCCAGGAAGTGCAGGG - Intronic
1113950631 13:114069505-114069527 TCAGGGGGCCAGGAGACACAGGG + Intronic
1114194540 14:20465646-20465668 ACTGAGGCCCAGGAAGAGCAAGG - Intergenic
1114584931 14:23802631-23802653 TCTGGAGCCCAGGAAGATCAAGG + Intergenic
1115093096 14:29602248-29602270 TCGGGGGCCCAGGGAGGGCAGGG + Intronic
1116330502 14:43591829-43591851 GCAGGGGCACAGCAAGAACAAGG + Intergenic
1116658937 14:47683051-47683073 TCAGGGAACCAGAAAGAACCAGG + Intergenic
1118782037 14:69014922-69014944 TCAGTGGCCCAGGGAGTACCTGG - Intergenic
1119312625 14:73662374-73662396 TAAGGAGCACAGGAAAAACAGGG - Intronic
1119473296 14:74912353-74912375 TCTGGGGTCCAGGTGGAACAGGG - Intronic
1119473304 14:74912390-74912412 TCTGGGGTCCAGGTGGAACAGGG - Intronic
1119671640 14:76524336-76524358 TCAGGTCCCAAGGAACAACATGG - Intergenic
1120186361 14:81397512-81397534 TCAGGGGCTCAGTAACCACATGG + Intronic
1120232231 14:81852380-81852402 TTAAGGACTCAGGAAGAACAAGG + Intergenic
1121560550 14:94872077-94872099 TCAGGGGCACAGGAGGACAAAGG - Intergenic
1122267612 14:100554047-100554069 TCAGGGGAGCAGGAAGGGCATGG - Intronic
1122412100 14:101530851-101530873 TGAGGGGGCCAGGAAGAAAATGG - Intergenic
1122465859 14:101933110-101933132 TGAGGGGCAGAGGAAGGACATGG + Intergenic
1123405665 15:20018265-20018287 ACCAGGGCCCAGGAAGGACAAGG - Intergenic
1123514995 15:21024913-21024935 ACCAGGGCCCAGGAAGGACAAGG - Intergenic
1125752426 15:42037549-42037571 TCCTGTGACCAGGAAGAACAAGG - Intronic
1125859654 15:42986900-42986922 TCAGGGGCCGAGGCAGCCCAGGG - Intronic
1127318277 15:57817790-57817812 TCAGAGGCCCAGAAGGAAGAGGG - Intergenic
1127686679 15:61352417-61352439 TCAAGGGGCCAAGAATAACAAGG + Intergenic
1127983690 15:64052038-64052060 GCAGGGCCCCAGGCAGAGCAGGG - Intronic
1128559048 15:68652466-68652488 TCCAGGCCACAGGAAGAACAGGG + Intronic
1128581195 15:68811352-68811374 CTAGGTGCCCAGGAGGAACAAGG + Intronic
1128585531 15:68846330-68846352 TATGGGGCACAGGAAGTACAAGG + Intronic
1129165942 15:73777525-73777547 ACAGAGCCCCAGAAAGAACATGG - Intergenic
1130036286 15:80364638-80364660 ATAGGGGCCCAGGAAGCTCATGG + Intronic
1130226589 15:82063366-82063388 AAAGGGGCCCAAGAAGAACTAGG + Intergenic
1131017537 15:89070550-89070572 CCATGGGCCAAAGAAGAACAGGG + Intergenic
1131086014 15:89576044-89576066 ACAGGGGGCCAGGAGGAAGACGG - Exonic
1132377121 15:101336140-101336162 GCAAGGGCCCTGGAACAACAGGG + Intronic
1132645444 16:997357-997379 TCGGGGGCCCAGGGAGAAGCAGG - Intergenic
1132747492 16:1443069-1443091 TCAGAGGCCCAGGAAAGCCATGG - Intronic
1132833635 16:1941940-1941962 ACAGGAGCCCAGGAAGAAAGAGG + Intronic
1133598852 16:7319592-7319614 TCTGAGGCCCAGGAAAAGCATGG - Intronic
1135413294 16:22250866-22250888 CGATGGGCTCAGGAAGAACAGGG + Intronic
1136127371 16:28193898-28193920 GGAAGGGCCCAGGAAGAAGAAGG - Intronic
1136605045 16:31327932-31327954 TCAGGGGACCAGTTAGAAGAAGG + Intronic
1136652750 16:31686923-31686945 TCAGGGGGACGGGAAGAATACGG + Intergenic
1137403266 16:48170660-48170682 TCAGGGGCACAGCAAAGACAAGG - Intronic
1137927445 16:52554067-52554089 TCAGGGGATCAGAAAGAAAAGGG - Intergenic
1138449428 16:57084594-57084616 GCAGGGGGCCAGGAACAACCTGG - Intergenic
1139397764 16:66654162-66654184 TCATCACCCCAGGAAGAACATGG + Intronic
1139470007 16:67173389-67173411 TCAGGGGACCAGGAAGGGCCAGG + Intronic
1140218727 16:73028410-73028432 TCAGATCCCCAAGAAGAACAGGG + Intronic
1140448848 16:75053848-75053870 ACAGGAGCCCAGGAACAACCTGG - Intronic
1141404052 16:83775913-83775935 TCTGGGGCCCAGGAAATATAGGG - Intronic
1142266655 16:89067042-89067064 TCGGGGGACCAGGAGGGACACGG - Intergenic
1142315867 16:89344624-89344646 TGAGGGGCCCAGGAAGAAAGAGG + Intronic
1144294925 17:13865099-13865121 TCAGTGGCATAGGAAGAAGATGG + Intergenic
1144671771 17:17136842-17136864 CCAGGGGCCCAGGCAGAATGCGG - Intronic
1144778589 17:17796878-17796900 CCAGGGGGCCATGAAGACCAAGG + Exonic
1145995791 17:29104148-29104170 TCAGGGGCTCCCGAAGCACATGG - Intronic
1146269854 17:31477580-31477602 CCAGAGACCAAGGAAGAACAAGG - Intronic
1146579629 17:34025174-34025196 TCAGGGGCTCAGAAGGAACAAGG - Intronic
1146762706 17:35492370-35492392 ACAGGGGCCCAGGAAGCCCAAGG - Intronic
1147034396 17:37669757-37669779 TCAGGGGACCAGCAAGTGCATGG + Intergenic
1147474421 17:40696640-40696662 TACGGGCCCCAGGAAGAACCAGG - Intergenic
1148048989 17:44759940-44759962 TCAGAGCCCCAGGAAGCCCACGG + Intronic
1148687799 17:49510321-49510343 GCGGGGACACAGGAAGAACACGG + Intronic
1148715639 17:49713838-49713860 TCTAGAGCCCAGGAAGAGCAAGG + Intronic
1148848276 17:50541596-50541618 TGAGGGACCCAGGAAGGACTCGG - Exonic
1149334425 17:55620909-55620931 TCAGTGTCCCAGTAAGAAGAGGG + Intergenic
1150282654 17:63938415-63938437 TCAGGGGGCCAGGCAGGATAAGG - Intergenic
1150745890 17:67816254-67816276 TCAGGAGCCCAAGAAGTATAAGG + Intergenic
1151533186 17:74720800-74720822 TCAGGTGTCCAGGAAGAATCAGG + Intronic
1151557086 17:74852038-74852060 TGACGGGCCCAGGGTGAACACGG + Exonic
1151566091 17:74899185-74899207 ACTGGGGCACAGGAAGAAAATGG - Intergenic
1151703483 17:75755202-75755224 CCTGGGGCCCAGGTAGTACAGGG + Intronic
1152163287 17:78683242-78683264 GGAGGGGTCCAGGAAGAAGAAGG - Intronic
1152713120 17:81884773-81884795 GAAAGGGACCAGGAAGAACAGGG + Intergenic
1152922779 17:83074051-83074073 AGAGGGGCACAGCAAGAACAGGG + Intergenic
1153131073 18:1856278-1856300 TCAGGGGTCCAGGAACAAAGGGG - Intergenic
1153649719 18:7229340-7229362 TCAGGGTCCCAGGAGCAGCAGGG + Intergenic
1155154487 18:23147203-23147225 GCAGGGGTGCAGGAAGAAGAAGG - Intronic
1156470068 18:37371829-37371851 TCAGGGGCCCAGGAAGAACAAGG + Intronic
1157154743 18:45254797-45254819 TATGGGGCGCAGGAAGAACGTGG - Intronic
1157287716 18:46388545-46388567 TCAAGGGCGCAGGAAGCACACGG + Intronic
1158025494 18:52892081-52892103 TCAGTGGGCCAAGAGGAACATGG - Intronic
1158091786 18:53723327-53723349 TCAGGGGGCCAGGATCAAAAGGG - Intergenic
1159839412 18:73380409-73380431 TCAGTGGCCAACCAAGAACAAGG + Intergenic
1160474111 18:79167262-79167284 TCCGGCATCCAGGAAGAACAAGG + Intronic
1160759633 19:776731-776753 TCCGGGGCCCAGGGAGAACGAGG - Intergenic
1160973597 19:1781210-1781232 CCACTGGCCCAGGAAGAAGACGG - Intergenic
1161088454 19:2345616-2345638 GCACGGGCCCAGGAAGAATGAGG - Intronic
1161257857 19:3319882-3319904 CCAGGAGCCCAGGAAGGGCAGGG - Intergenic
1161682621 19:5687617-5687639 TCGGAGGCCCAGGACGCACATGG - Exonic
1161864664 19:6825237-6825259 TCAGGGGGCCAGGAAGGAAAGGG - Intronic
1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG + Exonic
1162157900 19:8692188-8692210 TCAGGGCCATAGGAAGAACTTGG + Intergenic
1164462816 19:28463481-28463503 CCAGGGGCTCTGGAAGACCAAGG + Intergenic
1164717431 19:30403786-30403808 TCAAGAGCACAGGAAGAACGAGG - Intronic
1164769987 19:30801240-30801262 CCAAGGGCTCAGGGAGAACAGGG + Intergenic
1165123974 19:33581099-33581121 CCAGGAGCCCAGGGAGACCATGG - Intergenic
1166377203 19:42334230-42334252 TCAGGGCCCCAGGGGAAACAGGG - Intronic
1166544460 19:43625849-43625871 GCTGGGGACCTGGAAGAACAGGG - Intronic
1167106003 19:47430146-47430168 CCAGAGGCCCAGGAAGAGCGCGG + Exonic
1167461139 19:49625348-49625370 TCAGTGTCCCAGGGAGACCAGGG - Intronic
1168213642 19:54909559-54909581 TCAGGGCTCCAGGTAGCACATGG - Intronic
925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG + Intronic
925270635 2:2604769-2604791 GCAGGGGCCCAGCAAGGATAGGG + Intergenic
926802702 2:16673675-16673697 TCAGGAGCCCAGGAAGTAATAGG - Intergenic
927557517 2:24046303-24046325 TCAGAGGGCCAGGAGGACCAAGG + Intronic
927702402 2:25276704-25276726 TCAGGGGCCCAGGTGGAAGGAGG - Intronic
927755178 2:25702502-25702524 ACTGGGACCCAGGAAGAGCATGG - Intergenic
927982906 2:27386010-27386032 TCAGAGGCCTAGGAATAATAAGG + Intronic
929561155 2:42957501-42957523 TCAGGGGCCAAGGTAGGAGAAGG - Intergenic
930877999 2:56241482-56241504 TCAGAGGCCCAGAAAGATAATGG - Intronic
931748837 2:65313588-65313610 ACAGGGGGCCAGGAAAGACAAGG + Exonic
932293754 2:70607412-70607434 ACAGAGCCCCAGGGAGAACAGGG + Intergenic
932459768 2:71874709-71874731 TCAGGGGCCAAGGAAGAAAAGGG + Intergenic
932475421 2:72002984-72003006 TCAGGGGACCAGGGAGGCCAGGG - Intergenic
932617982 2:73248012-73248034 TCAGGGGGGCAGGAAGAGAAAGG - Intronic
932739796 2:74282830-74282852 TCAGAGGCCCAGGAAGGGGAAGG - Intronic
933425969 2:82112633-82112655 TCTGGTGTCCAGGAAGAACTGGG - Intergenic
935121569 2:100187539-100187561 TTATCGGCCCAGGAAGAAAAGGG + Intergenic
936518328 2:113196522-113196544 TCTGGGGCCCAGGAATAACTAGG - Intronic
939002916 2:136756849-136756871 TCAGGGACCCAGGTTGAAAAGGG - Intergenic
941153938 2:161952304-161952326 TCAAGGGCTCATGAAGAACAAGG - Intronic
943024546 2:182611282-182611304 TGAGGAGCGCAGGAAAAACAAGG + Intergenic
946279458 2:218656281-218656303 GCAGGGTCCCGGGAAGGACAGGG + Exonic
947594235 2:231400674-231400696 TCAGATGCCCAGGAAGGAAAAGG + Exonic
948336422 2:237210960-237210982 TCAGGGAGCCAGGAAGGTCATGG + Intergenic
948505480 2:238424762-238424784 TCAGAGGACCTGGAAGAAGAGGG + Intergenic
948632217 2:239309630-239309652 CGAGGGGCCCAGGGAGAAGATGG + Intronic
948838510 2:240637587-240637609 TCAGGGAGACAGGAAGAACTGGG + Intergenic
1169316294 20:4593310-4593332 ACAGGGGCACAGGAAGAAGGAGG - Intergenic
1169717744 20:8639409-8639431 TCAGGAGCTCAGGGATAACAAGG + Intronic
1171459828 20:25292231-25292253 ACAGGGGCCCAGGCTGGACACGG - Intronic
1172252995 20:33492960-33492982 TCAGGAGCCCAGCCAAAACATGG - Intronic
1172514241 20:35522166-35522188 TGAGGGTCCCAGGAAGGAAAGGG - Intergenic
1172760190 20:37316061-37316083 TCAGACGCCCAGGTAGAACCTGG - Intronic
1173458281 20:43221468-43221490 TCAGGCCCCCAGGAAGCTCATGG - Intergenic
1173646184 20:44634479-44634501 TAAGGTGCCCAGTAAGCACAGGG - Intronic
1173669654 20:44789877-44789899 TAATGGGCCCAGGGAGAAGAAGG + Intronic
1175348818 20:58303013-58303035 TCAAGGGCCCAGGCAGAAGAGGG - Intergenic
1175514543 20:59560533-59560555 TGAGGGGCTCAGGAACAACATGG + Intergenic
1175748257 20:61476836-61476858 TCAGTGGCCCAGACAGACCATGG - Intronic
1176238983 20:64067258-64067280 GCAGGGTTCCAGGTAGAACAAGG + Intronic
1178221794 21:30668990-30669012 CCAGAGGCCTAGGAAGAAAAAGG + Intergenic
1178671527 21:34595631-34595653 TCAGGTTCCCAGGAAGGCCAGGG + Intronic
1179035088 21:37752732-37752754 TCAGGGTTGCAGGAAGAACTAGG - Intronic
1180007131 21:45028012-45028034 TCTGGGGCCCAGGGGGAGCAGGG - Intergenic
1180613719 22:17114057-17114079 TCAGGAGCTCAGGAAGTACTTGG + Exonic
1180835310 22:18926720-18926742 TCCGGGGGCCAGGGAGACCATGG - Intronic
1181172470 22:21017419-21017441 GCAGGGGCCAAGGGAGAAGAGGG - Intronic
1182875335 22:33686701-33686723 TCAGGAGACCAGGAAGAGAAGGG - Intronic
1183978091 22:41524718-41524740 ACAGGGGTCTGGGAAGAACATGG + Intronic
1184278147 22:43422064-43422086 TCAGGGTCCCAGGAAGAGCCCGG - Intronic
1184797724 22:46741503-46741525 CCAGGGGCCCAGGAAGAGAAGGG - Intergenic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1184810068 22:46825260-46825282 TCAGACCCCCAGGAAGAAAAAGG - Intronic
1184855539 22:47144512-47144534 ACAGGGGCTCAGTAAGCACAGGG - Intronic
1185141166 22:49102096-49102118 TCAAGGTCTCAGGAATAACAGGG - Intergenic
1203285398 22_KI270734v1_random:152019-152041 TCCGGGGGCCAGGGAGACCATGG - Intergenic
949966972 3:9364923-9364945 TCTGGAGGGCAGGAAGAACAAGG - Intronic
950432549 3:12959222-12959244 CCAGGGGCCCAGCAAGACGAGGG + Intronic
950932199 3:16801445-16801467 TCCTGTGCCCAGGAAGAACTGGG - Intergenic
955827676 3:62965411-62965433 TCATGGGCACAAGAAGACCAGGG - Intergenic
956728835 3:72178123-72178145 TCTGGGGCCCAGGGAAAGCACGG + Intergenic
959579184 3:107966921-107966943 TCAGGGCCACAGTAAGAGCAGGG - Intergenic
959583257 3:108003245-108003267 TTCTTGGCCCAGGAAGAACAGGG + Intergenic
960705348 3:120475885-120475907 TCAGGGGCCTAGTGAGATCATGG - Intergenic
961963769 3:130880922-130880944 GCAGGGGGCCTGGAAGGACAGGG + Intronic
962615562 3:137122858-137122880 TCACGGGCACAGCAAGATCAAGG + Intergenic
962751936 3:138439999-138440021 TCAGAGGCCCAGAGAGGACAAGG - Intronic
966822140 3:183933445-183933467 TCCTGGGTCCAGGAAGCACAGGG + Intronic
966993461 3:185256769-185256791 TTAAGGACTCAGGAAGAACAAGG + Intronic
967139110 3:186538659-186538681 TTTGGGCCCCAGGAAGAATATGG + Exonic
968120202 3:196120547-196120569 GCAGGCGCCCGGGAAGAATAAGG + Intergenic
968592556 4:1466229-1466251 TCTGGGGCCCAGGAAGTGAACGG - Intergenic
969085467 4:4653030-4653052 TCAGGGGGCCAGGGTGGACAGGG - Intergenic
969193512 4:5542891-5542913 TCAGTGGCCCTGGAACACCAAGG - Intronic
969285965 4:6201933-6201955 TCAGGGGGTCAGGAGGAACTAGG + Intergenic
969534604 4:7747998-7748020 ACAGGGGCCCAGGAAGCACTGGG + Intergenic
969656512 4:8501812-8501834 GCTGGGGCCCAGAAAGGACAGGG - Intergenic
969849244 4:9943478-9943500 TCGGGGGCCCAGGAGGGCCAGGG + Intronic
972128724 4:35802504-35802526 TCATGTGACTAGGAAGAACAAGG - Intergenic
972611878 4:40663164-40663186 TCAGGGGCCCATGAAGAAATAGG + Intergenic
972957614 4:44411865-44411887 TCAGGGTCTCAGAAAGAACAAGG + Intronic
973058881 4:45694177-45694199 TAACGAGCCCAGGAAGAAAAAGG - Intergenic
973580396 4:52338946-52338968 GGAGGGGCCCAGGAACAACTGGG + Intergenic
975643519 4:76524354-76524376 TCAGGACCTCATGAAGAACAAGG + Intronic
981158201 4:141465098-141465120 TTAGAGGCTCAGGAATAACAAGG - Intergenic
981224625 4:142278627-142278649 TCATGGCCCCAGGAAGAAAGTGG + Intronic
981853333 4:149257463-149257485 TCAGGAGATCAGGATGAACAGGG - Intergenic
982126662 4:152189716-152189738 CCAGGGGCCCAGTGAGCACAGGG - Intergenic
983622541 4:169775386-169775408 GCAGGGGCCTCGGAAGAGCAAGG + Intergenic
983934334 4:173490429-173490451 TCAGAGGCCCAGGAACCAGAAGG + Intergenic
985619136 5:944490-944512 TAAGGAGCCCTGGAAGCACAGGG - Intergenic
985619179 5:944740-944762 TAAGGAGCCCTGGAAGCACAGGG - Intergenic
987391649 5:17381744-17381766 TCAGGGTCCTAGAAACAACAGGG - Intergenic
988009169 5:25461572-25461594 CCAGAGGCCCAGGAGGAAAAAGG + Intergenic
992064333 5:73091705-73091727 TTATGTGCCCAGGAAGAAAACGG + Intergenic
994741593 5:103625772-103625794 TCAGGGGGCTAGGAAGAGAAAGG + Intergenic
995325465 5:110885116-110885138 TTAAGGACTCAGGAAGAACAAGG - Intergenic
996528810 5:124505512-124505534 TCAGGGGTCCAGGAAAACCTGGG - Intergenic
996761121 5:126986906-126986928 TCTGGAGGCCAGGAAGAAGATGG + Intronic
998473139 5:142398904-142398926 TCAGGTTCCCAGGGGGAACAAGG - Intergenic
999287541 5:150403074-150403096 TCAGAGGACCAGGAAGGACTAGG - Intronic
1000155799 5:158550223-158550245 TCAGGGGCCCAAGAAGATTCTGG - Intergenic
1001804855 5:174574883-174574905 TCAAGGGCACAGGAAGAAGTGGG - Intergenic
1002023126 5:176378090-176378112 TCAAGGGCTCAGGAAGGACCAGG + Exonic
1002055013 5:176593819-176593841 ACAGGGGCCCAGGTATAACACGG + Intronic
1002465479 5:179406199-179406221 ACAGGGGCCCAGTAAGAAGCTGG - Intergenic
1003152187 6:3562273-3562295 TCTGGGGCTCAGGAAGACCCAGG + Intergenic
1003203949 6:3990400-3990422 ACAGGGACACAGGAAGAAAATGG - Intergenic
1004934193 6:20491563-20491585 ACAGGGGCCCGGGAAGCCCAAGG - Exonic
1005927191 6:30453443-30453465 GGAGGGACCCAGGAAGGACATGG - Intergenic
1005960244 6:30688617-30688639 TCAGTGGGAGAGGAAGAACAGGG + Exonic
1006411016 6:33873182-33873204 CCGGGAGCCCAGGAAGATCAAGG + Intergenic
1007341674 6:41194591-41194613 CCAGGGACCCAGGAGGACCATGG - Exonic
1008452178 6:51665821-51665843 TGAGAGGCTAAGGAAGAACAGGG + Intronic
1009991510 6:70848117-70848139 TCATGGGCCCACTAATAACATGG - Intronic
1010651605 6:78462290-78462312 TCAGAGTCCAATGAAGAACAAGG - Intergenic
1010733243 6:79412930-79412952 TCCAGTGTCCAGGAAGAACAAGG + Intergenic
1010931384 6:81807819-81807841 TAAGGGGCCAAAGAAGAAAAAGG - Intergenic
1012247197 6:96938919-96938941 GCAGGGGCCCAGGAAGCTAATGG + Intronic
1014867792 6:126553132-126553154 TCAGGGCCCCTGGAAAAAGATGG + Intergenic
1015842731 6:137491141-137491163 TCAGGGACCCAGGAAAGACAGGG + Intergenic
1016327119 6:142915374-142915396 TGAGGAGCCCAGGAACAACTAGG + Intronic
1016854594 6:148654547-148654569 TTAAGGACTCAGGAAGAACAAGG - Intergenic
1017543580 6:155427729-155427751 TTTGGGGCTCTGGAAGAACAGGG - Intronic
1018197428 6:161367392-161367414 TCAAGGGCCCAGGCAGATCTTGG + Intronic
1018577307 6:165273145-165273167 TCAGGGGAGGAGGGAGAACAAGG + Intergenic
1018729198 6:166636218-166636240 ACAGGGGCCCAGGCAGAGGAAGG - Intronic
1019092388 6:169550107-169550129 ACAGGGGGCCAGGAGGCACAAGG + Intronic
1019759710 7:2801355-2801377 TCAGGGGGCCAGGTAGGACTTGG + Intronic
1021617528 7:22518234-22518256 TTAGGGGCTCAGGAAGTAGAAGG - Intronic
1022693490 7:32681575-32681597 TTAGGGGCTCAGGAAGTAGAAGG - Intergenic
1022927119 7:35067717-35067739 TTAGGGGCTCAGGAAGTAGAAGG - Intergenic
1023871007 7:44263064-44263086 TCTGGGGGACAGGAAAAACAAGG + Exonic
1023888558 7:44377091-44377113 TCAGGGACACAGGAGGCACAAGG - Intergenic
1025582342 7:62736339-62736361 TCTGAAGCCCAGGAAGAACAAGG + Intergenic
1026509370 7:71015750-71015772 TCAGGGAGCCAAGAAGAGCAGGG + Intergenic
1026858137 7:73768494-73768516 TGAGGGTCCCAGGAAGGAGATGG + Intergenic
1028375150 7:90137875-90137897 TTAGGGGCTCAGGAAGCAGAAGG + Intergenic
1028378506 7:90173455-90173477 GCAGAGGCACAGGAAGAAAAGGG + Intronic
1029300773 7:99580716-99580738 GCAGGGGCCTCGGAAGAGCAAGG + Intronic
1029493298 7:100883985-100884007 GAAGGGGCCCAGGAAAGACAGGG - Intronic
1030434800 7:109502809-109502831 TCAGGACCCAAGGAACAACATGG - Intergenic
1030822452 7:114112008-114112030 GCAGAGTCCTAGGAAGAACAGGG + Intronic
1033149280 7:138899261-138899283 TCAGGGGCCCAGAATCACCATGG + Intronic
1033444613 7:141409358-141409380 TGAGTGTCTCAGGAAGAACAAGG + Intronic
1034732362 7:153399114-153399136 CCAGAGGCCCTGGAAGACCACGG + Intergenic
1035548201 8:499833-499855 TGAAGGGCCCAGGAAGGACATGG + Intronic
1035560179 8:598423-598445 TCTGGGATCCAGGAAGAAGAGGG - Intergenic
1036824690 8:11966983-11967005 TCAGTGGCTCAGGAAGAATCAGG + Intergenic
1037026866 8:14049787-14049809 TCAGGGGCTCAAGACCAACATGG - Intergenic
1037309102 8:17536157-17536179 TCAGGGCCCCAGGAATACCAAGG - Intronic
1037813346 8:22099202-22099224 TCAGGCGCCGCGCAAGAACACGG + Intronic
1039620270 8:38990936-38990958 TCAGGGTCACAAGAGGAACATGG + Exonic
1039740894 8:40381470-40381492 GCAGGGGCCACGGAAGACCAAGG + Intergenic
1040494775 8:47956819-47956841 TCAGGGCCCCAGGGAGCCCAGGG + Intronic
1040572682 8:48624430-48624452 ACAGGGGCCCAGGCAGAGCTTGG - Intergenic
1041682209 8:60605141-60605163 AAAGGGGCCCAGGAAGAGCTCGG + Intronic
1042196772 8:66237827-66237849 TCCTGTGTCCAGGAAGAACAAGG + Intergenic
1042468136 8:69152136-69152158 TCAGGTGCCTAGGAGGAAGAGGG - Intergenic
1044636228 8:94327345-94327367 TCAGAGTCTCAGGAAGAACAGGG - Intergenic
1044824535 8:96183666-96183688 TGAGTGGCCCAGGGAGACCAAGG - Intergenic
1045062961 8:98424522-98424544 CCAGGGGCCCAGGCAGAGCCTGG + Intronic
1045402680 8:101834574-101834596 TCAGGTACCCCTGAAGAACAGGG - Intronic
1047207802 8:122817548-122817570 TCAGAGGGCCAGGAAGAAAAAGG + Intronic
1047296797 8:123577353-123577375 TGAGGGGCCCAGAGAGGACATGG - Intergenic
1047742212 8:127815632-127815654 TCAGGGGCGGAGGAGGCACAGGG + Intergenic
1047927178 8:129693242-129693264 TCAGGGGCACAGGATCCACAAGG + Intergenic
1048063386 8:130943650-130943672 TCAGGAGCTCAGGAAGGACAAGG + Intronic
1048889851 8:138937176-138937198 ACAGGGACCCAGCAAGGACATGG + Intergenic
1049342045 8:142118406-142118428 TGAGGGGCCCAGGGACATCAGGG - Intergenic
1049519163 8:143079510-143079532 CCAGCGGCCCAGTGAGAACACGG + Intergenic
1049670499 8:143867422-143867444 GCAGGGGTCCAGGAGGAACCCGG + Exonic
1049777903 8:144414918-144414940 TCAGGGGCCCAAGCAGACCCCGG + Intronic
1050276484 9:4006521-4006543 TGAGGGGTGCAGGAAGGACAGGG + Intronic
1051029708 9:12658932-12658954 TCAGGGGCCCTGGAAGGCCCAGG - Intergenic
1051437711 9:17051002-17051024 ACAGGGGACCAGGAAGAGGAAGG - Intergenic
1052092240 9:24342956-24342978 TCAGTGACCCAGGTAGAATATGG + Intergenic
1052343116 9:27382396-27382418 TCAGGGCACCAGGAATAACTAGG - Intronic
1052356651 9:27511900-27511922 TCAGGTGCCCAGGAAGGAGAGGG - Intronic
1054908392 9:70430995-70431017 TCAAGGACCCAGGAAGGAAAAGG + Intergenic
1055558903 9:77503033-77503055 TCAGGGCCCAAGGAAGGACACGG - Intronic
1056305076 9:85282531-85282553 TTAGGGGCCAAGGAAGAAGTGGG - Intergenic
1056397886 9:86198023-86198045 TCAGGGGCACAGGAACACAAGGG + Intergenic
1057127924 9:92633905-92633927 TCACAGACCCAGGAAGTACAGGG + Intronic
1057168358 9:92945694-92945716 GCTGGGACCCAGGAAGGACAGGG + Intergenic
1057213843 9:93217632-93217654 TCAGGGCCACAGGAGGACCATGG - Intronic
1057272907 9:93660656-93660678 TCAGGGGCCCCTGGGGAACAAGG - Intronic
1057434307 9:95025247-95025269 TCACGGGAGAAGGAAGAACAAGG - Intronic
1058648614 9:107154301-107154323 TCAGGAGCCCAGGCAGAGGAAGG + Intergenic
1060995426 9:127872888-127872910 ACAGGGTCCCAGGAGGAACAGGG + Intronic
1061540087 9:131273496-131273518 TCAGGGGCAGAGAGAGAACAAGG + Intronic
1062466545 9:136684101-136684123 TCAGGGTCCCAGACAGAAAAGGG - Intronic
1203760248 EBV:9232-9254 CCAGGGGCCCAGGAAGACTACGG - Intergenic
1186232378 X:7469425-7469447 TCAGCTGCCCACAAAGAACATGG - Intergenic
1187430054 X:19214361-19214383 TCATGGGCCCATAAAGAACCAGG + Intergenic
1187590016 X:20707310-20707332 TCAGGGGCTCAGGACAGACAGGG + Intergenic
1187733283 X:22278468-22278490 TCAGGGGCTGAGGAAGAACTAGG - Intergenic
1188847834 X:35095872-35095894 TCAGGAGCCCAGGCACAGCATGG + Intergenic
1192498901 X:71635731-71635753 ACAGAGGCCTAGGAAGAAAAGGG + Intergenic
1192598059 X:72432370-72432392 TCAGGGGCCCCTGTAGACCACGG - Intronic
1193508020 X:82366517-82366539 TCAAGGACTCAGGAAGGACAAGG + Intergenic
1195178471 X:102333712-102333734 TCCTGTGCCCAGGAAGAATAAGG + Intergenic
1195180393 X:102353371-102353393 TCCTGTGCCCAGGAAGAATAAGG - Intergenic
1195558803 X:106259083-106259105 TTAGGGACTCAGGAAGGACAAGG + Intergenic
1197064338 X:122220773-122220795 TCAGGGGCCCAGGACCAGCATGG + Intergenic