ID: 1156471513

View in Genome Browser
Species Human (GRCh38)
Location 18:37379957-37379979
Sequence CCTTCCACTCAGAGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 217}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156471498_1156471513 21 Left 1156471498 18:37379913-37379935 CCAAGATGCTTTCCTGCTCCGGG 0: 1
1: 0
2: 1
3: 12
4: 108
Right 1156471513 18:37379957-37379979 CCTTCCACTCAGAGGGTGGATGG 0: 1
1: 0
2: 1
3: 11
4: 217
1156471503_1156471513 -5 Left 1156471503 18:37379939-37379961 CCTCACCCTTAGACCCACCCTTC 0: 1
1: 0
2: 0
3: 30
4: 271
Right 1156471513 18:37379957-37379979 CCTTCCACTCAGAGGGTGGATGG 0: 1
1: 0
2: 1
3: 11
4: 217
1156471504_1156471513 -10 Left 1156471504 18:37379944-37379966 CCCTTAGACCCACCCTTCCACTC 0: 1
1: 0
2: 2
3: 18
4: 271
Right 1156471513 18:37379957-37379979 CCTTCCACTCAGAGGGTGGATGG 0: 1
1: 0
2: 1
3: 11
4: 217
1156471501_1156471513 9 Left 1156471501 18:37379925-37379947 CCTGCTCCGGGGTTCCTCACCCT 0: 1
1: 0
2: 0
3: 19
4: 187
Right 1156471513 18:37379957-37379979 CCTTCCACTCAGAGGGTGGATGG 0: 1
1: 0
2: 1
3: 11
4: 217
1156471502_1156471513 3 Left 1156471502 18:37379931-37379953 CCGGGGTTCCTCACCCTTAGACC 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1156471513 18:37379957-37379979 CCTTCCACTCAGAGGGTGGATGG 0: 1
1: 0
2: 1
3: 11
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156471513 Original CRISPR CCTTCCACTCAGAGGGTGGA TGG Intronic
901479413 1:9514486-9514508 TTGTCCACTGAGAGGGTGGAGGG + Intergenic
903478482 1:23636605-23636627 CATTCCAGTCAGAGGGCAGAGGG + Intronic
904970502 1:34415907-34415929 CCTTCCCAACATAGGGTGGAAGG + Intergenic
905624582 1:39479870-39479892 CCTTCCGCTCACGGGGTCGAAGG + Exonic
905906750 1:41623593-41623615 CCCTTCACTCAGTGGGTGCAAGG - Intronic
906696009 1:47823935-47823957 CCTTCCAAACAGAGGGAGCAAGG - Intronic
908428148 1:64029140-64029162 CCTTCCACCCAGCATGTGGAAGG - Intronic
908709807 1:67002377-67002399 CCTTCCCCTCTGAGGGAGTAAGG - Exonic
909765934 1:79355769-79355791 CCTTTCACTCAGATGGTCTAGGG + Intergenic
911045144 1:93621668-93621690 CCCTTCACTCAGTGGGTGGATGG + Intronic
911413977 1:97547330-97547352 CTATCCACTCAGGGAGTGGATGG - Intronic
912459669 1:109822319-109822341 CGGTCCAATCAGAGGGTGGTGGG + Intergenic
912521865 1:110251059-110251081 GCTTCTACCCAGAGGGTGGCAGG + Intronic
913113909 1:115679565-115679587 CATCACACTCACAGGGTGGAGGG + Intronic
916610947 1:166390936-166390958 CCTCCCACTCAGAAGCAGGAGGG + Intergenic
916701961 1:167305839-167305861 CCTTCTACTCAGAGGATGAGTGG - Intronic
917307373 1:173640321-173640343 CCTTCTCATCAAAGGGTGGAAGG + Intronic
917982373 1:180278446-180278468 CCTACCAAGCAGAGTGTGGATGG - Exonic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
920911148 1:210218103-210218125 CTTTTCTGTCAGAGGGTGGAAGG + Intergenic
922118987 1:222643993-222644015 CCTTCCTGTCACAGCGTGGAAGG - Intronic
1063922370 10:10945435-10945457 TCTTCCTCTTACAGGGTGGAAGG - Intergenic
1070661636 10:78310728-78310750 CCTTTGACACAGAGGGTGGCTGG + Intergenic
1070972154 10:80576662-80576684 CCTACCTCTCAAAGGGAGGAGGG - Intronic
1072460390 10:95612959-95612981 CTTTCCAGTCAAAGGATGGAAGG + Intronic
1073100491 10:101003901-101003923 CCTCCCACTCAGACAGTGGCCGG + Exonic
1073133961 10:101209258-101209280 CCTCCCACTCAGTGGGAAGAAGG - Intergenic
1075517072 10:123117915-123117937 CATTCCACAAATAGGGTGGAGGG + Intergenic
1077522787 11:3046204-3046226 CCTTCCTCTCACAGTGTGGATGG + Intronic
1080748362 11:35129245-35129267 ACTTCCATTCAGTTGGTGGAAGG - Intergenic
1080922138 11:36719911-36719933 CCTTCCACCCATTTGGTGGAAGG - Intergenic
1080922139 11:36719911-36719933 CCTTCCACCAAATGGGTGGAAGG + Intergenic
1080971252 11:37279852-37279874 CCTGCCAGCCAGAAGGTGGATGG - Intergenic
1081542986 11:44049511-44049533 CTCTCCAGCCAGAGGGTGGAGGG + Intronic
1083569237 11:63748205-63748227 CCTGCCACTCAGAGAGTTGGAGG + Intronic
1091021623 11:132105142-132105164 CTTTCCTCCCAGTGGGTGGAAGG + Intronic
1092058829 12:5531422-5531444 AATTCCAGCCAGAGGGTGGAGGG + Intergenic
1092724952 12:11475816-11475838 ACTTCCACTCAGAAGGTTAAGGG - Intronic
1094030123 12:26002348-26002370 GCTTGAACCCAGAGGGTGGAGGG + Intronic
1094136243 12:27129920-27129942 CTTTCCACTTAGATGGTGAAGGG + Intergenic
1094185858 12:27641989-27642011 CTTTCCACTTAGATGGTGAAGGG + Intronic
1094850040 12:34378267-34378289 CCTTCCACTCAAAGGGTGCCTGG + Intergenic
1095662447 12:44753263-44753285 GCTTACCCTCTGAGGGTGGATGG - Intronic
1097192408 12:57225850-57225872 CCTTCCACTCTGGGGGCGGAGGG + Exonic
1097324540 12:58261475-58261497 CATTTCACTCCCAGGGTGGAAGG + Intergenic
1104277161 12:127340275-127340297 CCTTCCACACTGAGGGTGAGGGG - Intergenic
1108441615 13:50459241-50459263 CCTACCACCCTGAGGGGGGAGGG + Intronic
1112497420 13:99915988-99916010 GCTGCCATTCTGAGGGTGGAGGG + Intergenic
1114949904 14:27736994-27737016 CTGGCCACTCATAGGGTGGAAGG + Intergenic
1115013701 14:28583669-28583691 CCAGCCACTCAGGAGGTGGAAGG - Intergenic
1115879316 14:37897098-37897120 CACTCCACTGAGAGGGTGCAAGG - Intronic
1117642309 14:57812897-57812919 CCTTCCTCCCTGAGGGTTGAAGG + Intronic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1119427915 14:74547755-74547777 CATGCCCCTCAGAGGGTTGATGG + Intronic
1121217438 14:92259447-92259469 CCTCCCAGTCAGAGGGAGGCTGG - Intergenic
1121999049 14:98630931-98630953 GCCTCCAGTCAGAGGGTGGAGGG - Intergenic
1122945360 14:105006161-105006183 CCTGCCCCTCAGTGGGTGGCTGG + Intronic
1124058201 15:26261869-26261891 CGTGCCACTCAAAGGGTGGCGGG + Intergenic
1124420083 15:29513491-29513513 CCCTCCACGGAGAAGGTGGAGGG - Intronic
1129453616 15:75664282-75664304 CCTTCAAGTCAGTGGGTGAAAGG + Intergenic
1130815848 15:87431880-87431902 CCTTCCACTCACAAAGAGGATGG - Intergenic
1131933459 15:97473647-97473669 CCTGCCACTCAATGGCTGGAAGG - Intergenic
1132837943 16:1964102-1964124 GATTCCACTTAGAGGTTGGATGG - Intronic
1133438940 16:5804564-5804586 CATTCCACCCAGATGGTGGGAGG + Intergenic
1133781253 16:8941035-8941057 CTTTCCAATCAGTGGCTGGAAGG - Intronic
1135307815 16:21381979-21382001 CCTGCCACACAGAGGTTGCAGGG - Intergenic
1135805338 16:25537461-25537483 CATCCCACTCAAAGGGGGGATGG + Intergenic
1136304435 16:29360146-29360168 CCTTTGACTCAAAGGGTGAAAGG + Intergenic
1136304560 16:29361099-29361121 CCTGCCACACAGAGGTTGCAGGG - Intergenic
1141438170 16:84012763-84012785 CCTTCCACTCTGAGGGTCTGTGG - Intronic
1142032253 16:87844436-87844458 CCATCCACCCCGAGGCTGGAGGG + Intronic
1144801913 17:17935023-17935045 GGTTCCTCTCAGAGGGTGGCTGG - Intronic
1145035460 17:19537486-19537508 CCTTCCATTCAAAGGGTGAGAGG + Intronic
1145420507 17:22823258-22823280 CCTTCAACTCACAGAGTTGAAGG + Intergenic
1145424317 17:22875596-22875618 CATTCCACTCACAGAGTTGAAGG + Intergenic
1145425876 17:22897005-22897027 CCTTCAACTCACAGAGTTGAAGG + Intergenic
1145432608 17:22989804-22989826 CCTTCAACTCACAGAGTTGAAGG + Intergenic
1145432956 17:22994566-22994588 CATTCCACTCACAGAGTTGAAGG + Intergenic
1145433903 17:23007640-23007662 CATTCCACTCACAGAGTTGAAGG + Intergenic
1145441548 17:23113528-23113550 CCTTCAACTCACAGAGTTGAAGG + Intergenic
1145442246 17:23123046-23123068 CATTCCACTCACAGAGTTGAAGG + Intergenic
1145443698 17:23143280-23143302 CATTCCACTCACAGAGTTGAAGG + Intergenic
1145462169 17:23409866-23409888 CCTTCAACTCACAGAGTTGAAGG + Intergenic
1145465699 17:23461093-23461115 CATTCAACTCACAGGGTTGAAGG + Intergenic
1145522860 17:24292221-24292243 CATTCAACTCACAGGGTTGAAGG + Intergenic
1145560660 17:24842324-24842346 CATTCAACTCACAGGGTTGAAGG + Intergenic
1145597887 17:25383817-25383839 CATTCAACTCACAGGGTTGAAGG + Intergenic
1145610618 17:25569272-25569294 CATTCAACTCACAGGGTTGAAGG + Intergenic
1145669199 17:26420512-26420534 CATTCAACTCACAGGGTTGAAGG + Intergenic
1145676052 17:26520317-26520339 CATTCAACTCAGAGAGTTGAAGG + Intergenic
1145682942 17:26619882-26619904 CCTTCAACTCACAGAGTTGAAGG + Intergenic
1146263694 17:31437648-31437670 CCCTCCCCTCAGGGTGTGGACGG + Intronic
1146560158 17:33861649-33861671 CCTTCCTCTCAGAGGCAGAAAGG - Intronic
1147893971 17:43738301-43738323 CCCTCCACTCAGAAGATGGGAGG - Intergenic
1148830825 17:50429908-50429930 CCTTCCCCAAAGAAGGTGGATGG + Intronic
1149896342 17:60431479-60431501 CCTGCCACTTAGAAGGTGGCTGG - Intergenic
1150249578 17:63698518-63698540 CCTTCCGCAGAGGGGGTGGAAGG + Exonic
1152521414 17:80858823-80858845 CCATCCACGCAGACGGTGCACGG + Intronic
1156106029 18:33662273-33662295 CCTTGCACTGAGATGGTGCAGGG + Intronic
1156471513 18:37379957-37379979 CCTTCCACTCAGAGGGTGGATGG + Intronic
1156743324 18:40359431-40359453 CCTTTGTCTCAGAGGTTGGAGGG + Intergenic
1161138805 19:2636204-2636226 CCTCCCACTCAGGGGGTGGATGG + Intronic
1161766338 19:6211009-6211031 CCTTCCACTCAGCCAGAGGAGGG - Intergenic
1163810743 19:19429872-19429894 TCTTCCCCACAGAGGGTTGATGG + Intronic
1163827380 19:19531177-19531199 TCTCCCACTCAGAGAGTTGAAGG + Intronic
1164809995 19:31148093-31148115 CATTTCACTCAGTGGGTGGGTGG + Intergenic
1165222933 19:34332015-34332037 CATTTCAGTCAGAGGTTGGAAGG + Intronic
1166998594 19:46731776-46731798 TCTCCCACTTAGAGGCTGGAGGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925286479 2:2719402-2719424 CCTTCCTCACAGAGGGAGGCAGG - Intergenic
925869897 2:8261041-8261063 CCTTCCATGCAGAGAGTGGTAGG - Intergenic
927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG + Intergenic
927491582 2:23524597-23524619 CCTTCAACTCAGAGAGGGGGTGG + Intronic
928675356 2:33645905-33645927 GTTTCCACACAAAGGGTGGAGGG - Intergenic
928768646 2:34677951-34677973 GCTTCCACTCAGATGGAGTAGGG - Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932459698 2:71874241-71874263 TCTTCCACTCAGAGGGAAGGTGG + Intergenic
932697800 2:73971110-73971132 ACTTCTGCTCAGAAGGTGGAGGG + Intergenic
935571137 2:104661135-104661157 CCTGCCTCTGGGAGGGTGGAGGG - Intergenic
938278813 2:130050665-130050687 CCTGCCTCTCAGAGGGTGGGTGG - Intergenic
938329788 2:130441526-130441548 CCTGCATCTCAGAGGGTGGGTGG - Intergenic
938360158 2:130679977-130679999 CCTGCATCTCAGAGGGTGGGTGG + Intergenic
938436561 2:131286684-131286706 CCTGCATCTCAGAGGGTGGGTGG + Intronic
941923046 2:170870707-170870729 CCTTCCACTCTGAGGGAAGGTGG + Intergenic
945048238 2:205800420-205800442 GCTTCCACTCAGGGAGGGGACGG + Intergenic
945172154 2:207008051-207008073 CCTTCCTTTCAGAGGATGAAGGG + Intergenic
946847018 2:223868435-223868457 CCCACCACTCAGTAGGTGGAAGG + Intronic
948790749 2:240375506-240375528 ACTTCCACTCAGAGTATGAAAGG + Intergenic
948892551 2:240914575-240914597 GCTCCCAGCCAGAGGGTGGAGGG - Intergenic
948915037 2:241030178-241030200 GCTTCCCCTCAGAGGGTGCCTGG + Intronic
1174181266 20:48676470-48676492 CCTCCCACTCTGTAGGTGGAAGG - Intronic
1174535016 20:51244774-51244796 CCTTCCCCTCTGAGGGAGGAGGG - Intergenic
1175569699 20:60009550-60009572 CCTGCCCCGCAGAGGGAGGAGGG - Intronic
1176048598 20:63105040-63105062 CCGTCCACACAGAGAGTGGGCGG - Intergenic
1179925344 21:44531092-44531114 CCTTTCACTGACAGGGTGGCTGG + Exonic
1182351753 22:29703655-29703677 TCTTCCCCTCAGAAGGTGGTGGG + Intergenic
1184533582 22:45071728-45071750 CCATCGGCTCAGAGGCTGGAGGG - Intergenic
1184596760 22:45518627-45518649 CTCACCACTCAGCGGGTGGAGGG - Intronic
949581684 3:5394805-5394827 CCTTCCTTTAAGAGGGTGGCTGG + Intergenic
949584379 3:5423557-5423579 CTTTCCACTAAGTGGGTGGGTGG + Intergenic
949860941 3:8504178-8504200 CCTTCAACTCAAAATGTGGAGGG + Intronic
953742739 3:45551533-45551555 CCTGACACTCAGAGCGTGGGTGG + Intergenic
954371967 3:50173779-50173801 CCTTCAGCTCTGTGGGTGGAGGG - Exonic
954727785 3:52630074-52630096 CCGTCAACTCAAAGGGTAGAGGG + Intronic
958201581 3:90324503-90324525 CATTCAACTCACAGGGTTGAAGG - Intergenic
958248765 3:91203204-91203226 CATTCAACTCAGAGAGTTGAAGG - Intergenic
961266997 3:125651442-125651464 CCTTCCACTTAGTAGTTGGATGG - Intergenic
961441994 3:126958758-126958780 CCTCCATCTCAGAGGATGGAAGG + Intronic
961505921 3:127370391-127370413 CCTTCCATTAACAGGGTGGTGGG + Intergenic
961516422 3:127440231-127440253 CCCTACACTCAGAGGCTGAAGGG + Intergenic
963204753 3:142621370-142621392 CCTTGAACACAGAGGGTAGATGG - Intronic
963852546 3:150223042-150223064 ACTACCACTCGGAGGGGGGAGGG + Intergenic
965118739 3:164522646-164522668 CCTTCAACTCAGAGGGGGCCAGG + Intergenic
976274413 4:83261531-83261553 ACTGGCACCCAGAGGGTGGAGGG + Intronic
976585230 4:86789899-86789921 GCTTCCACACACAGTGTGGAAGG + Intronic
978616068 4:110597359-110597381 ACTTCCAGTCAGAGTTTGGAAGG - Intergenic
979945421 4:126825470-126825492 CGGTCCTGTCAGAGGGTGGAGGG + Intergenic
982277944 4:153656032-153656054 CCTTCCTCTCTGAGTCTGGAGGG + Intergenic
985217257 4:187667164-187667186 CCTGCCACTCAGAGGCTGCAAGG + Intergenic
985493999 5:194273-194295 ACGTCCACTCAGAAAGTGGACGG - Intronic
985623412 5:968683-968705 CCTTCCACACAGTGGGGGAATGG + Intergenic
986667493 5:10116018-10116040 CCTTCCACTGAGAGTGATGATGG - Intergenic
986688082 5:10291338-10291360 CCTTCCACTCAGAATCTAGACGG - Intronic
989209975 5:38848562-38848584 CCTCCCACTCAGAAGAGGGAAGG + Intronic
990253725 5:53943365-53943387 TCATCCACTGAGAAGGTGGAAGG + Intronic
994098700 5:95871211-95871233 TCTCCCACTCAAAGGGTAGAGGG + Intergenic
997883866 5:137613791-137613813 TCTTCCTCTGAGGGGGTGGAAGG - Intergenic
998504365 5:142660276-142660298 CCTTCCAGTCAGAGGCTGAGTGG - Intronic
999911428 5:156205089-156205111 CCTCCCACTCTGATGGAGGAAGG - Intronic
1000147344 5:158466428-158466450 GCTTCCACTCTGATGGTGGTTGG + Intergenic
1000835966 5:166154332-166154354 CCTCCCATTCAGAGGGAGTAGGG + Intergenic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1005900169 6:30210461-30210483 CATTCAACTCAGAGGTGGGATGG - Intronic
1005995400 6:30927956-30927978 ATTTCCACCCAGAGGGAGGAGGG + Intergenic
1007412267 6:41671808-41671830 CCTTCCATTCAGAGAGTAGGGGG + Intergenic
1012399108 6:98830356-98830378 AGTTCCACTCAGAGGTTGGAGGG + Intergenic
1013308131 6:108868979-108869001 CCTTACAGTCGGAGGGAGGAAGG - Exonic
1013918823 6:115375224-115375246 CCTTCAAGTCAGAGGGTAAATGG + Intergenic
1015400705 6:132785208-132785230 CCTTCCCCTAAGGGGATGGAGGG + Intronic
1018250294 6:161862734-161862756 CCTTCCATTCAGAGGCGAGAAGG + Intronic
1018441249 6:163815369-163815391 CCTTCCACTTAAATGTTGGAAGG - Intergenic
1018758576 6:166870921-166870943 GCGCCCAGTCAGAGGGTGGAAGG + Intronic
1020257373 7:6509592-6509614 CCATTAACTCAAAGGGTGGAGGG + Intronic
1023344462 7:39257066-39257088 CCTTCCATTGAGAGGGTTGACGG - Intronic
1024864946 7:53895217-53895239 CCATCAACTCAGAGGGAGTATGG - Intergenic
1025129694 7:56368918-56368940 CCTTCCTCTCTCAGGGTGGGAGG + Intergenic
1025349280 7:58633629-58633651 CATTCAACTCACAGAGTGGAAGG + Intergenic
1027433875 7:78143098-78143120 CTTTCCAATCAAGGGGTGGAAGG + Intronic
1035582875 8:751061-751083 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582885 8:751101-751123 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582895 8:751141-751163 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582905 8:751181-751203 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582915 8:751221-751243 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582925 8:751261-751283 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035618812 8:1022530-1022552 CCGTCCACTCCCAGGGAGGATGG - Intergenic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1039186627 8:34924486-34924508 CCTTCCAGCCAGAGGGAGTAAGG + Intergenic
1039840988 8:41292984-41293006 GCTTCCACTCACAGGATGCAGGG - Intronic
1040011087 8:42661699-42661721 CCTTCCACTCTGAGAATGCAGGG - Intergenic
1040105401 8:43538712-43538734 CCTGCCTCTCAGAGGGTGTGTGG + Intergenic
1041371660 8:57167204-57167226 CCTTCCACTCAGGGATTGGTAGG + Intergenic
1042092926 8:65178683-65178705 CCTTGCATTCAGAGGGAGCATGG - Intergenic
1042767247 8:72337027-72337049 CCTTGCACTCTGAGGGTGATGGG - Intergenic
1043381801 8:79710366-79710388 GCTTGAACTCAGAAGGTGGAGGG - Intergenic
1043829348 8:84969441-84969463 CATTCCACTAAAAAGGTGGAAGG + Intergenic
1045381531 8:101632218-101632240 ACTTCCCATCAGAGGCTGGATGG - Exonic
1045483310 8:102610367-102610389 CCTCCCACTCAGAGGGAAAATGG + Intergenic
1052025562 9:23570040-23570062 CGTTGCTCTCAGAGGGTGGTTGG - Intergenic
1052864445 9:33456657-33456679 TCTTCCACTCAGCAGCTGGAGGG - Intergenic
1056215279 9:84400606-84400628 CCATCAGCTCACAGGGTGGACGG - Intergenic
1056995325 9:91452005-91452027 GCTTCCATTCAGATGGTTGAGGG - Intergenic
1057269033 9:93636770-93636792 CCTTCCACCCAGCGGGAGAAAGG - Intronic
1060413020 9:123412313-123412335 CATTCCACCCGGAGGGTGGGTGG - Intronic
1060543993 9:124450022-124450044 CCTTCCTCGCAGCAGGTGGAAGG + Intergenic
1061890390 9:133616257-133616279 TCTTGCCCTCTGAGGGTGGATGG + Intergenic
1062266110 9:135687287-135687309 CCTTCCACTGGGAGGGTGTGGGG - Intergenic
1062339165 9:136086298-136086320 CCTCCCACTCAGAGCTGGGAGGG + Intronic
1187209207 X:17212319-17212341 CCATCACCTCAGAGGGTGGCAGG - Intergenic
1187710871 X:22052782-22052804 CCTTGGACTCAAAGGGGGGAGGG + Intronic
1197800251 X:130340260-130340282 CCTGCTACCCAGAGGGTGAATGG + Exonic
1197856077 X:130915353-130915375 GCTTCAACCCAGAGAGTGGATGG - Intergenic
1198315845 X:135465204-135465226 CCTTCTCCTCAGAGGCTGTAAGG + Intergenic
1199522130 X:148748220-148748242 CTTTACACTGAGAGGGTAGAAGG + Intronic
1200054855 X:153454904-153454926 CCAGCCAGTCAGAGGTTGGAAGG + Exonic
1200115455 X:153767931-153767953 CCATCCACAGAGAGGGGGGATGG - Intronic
1202254761 Y:22909422-22909444 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic
1202407752 Y:24543171-24543193 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202463029 Y:25126910-25126932 CCTTCTATTCAGAGGGATGATGG - Intergenic