ID: 1156471753

View in Genome Browser
Species Human (GRCh38)
Location 18:37381479-37381501
Sequence CCTGCAAGGCTCCCACCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 334}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156471753_1156471758 -9 Left 1156471753 18:37381479-37381501 CCTTGAGGTGGGAGCCTTGCAGG 0: 1
1: 0
2: 1
3: 27
4: 334
Right 1156471758 18:37381493-37381515 CCTTGCAGGCACCCTAGGGTAGG 0: 1
1: 0
2: 0
3: 20
4: 186
1156471753_1156471759 -8 Left 1156471753 18:37381479-37381501 CCTTGAGGTGGGAGCCTTGCAGG 0: 1
1: 0
2: 1
3: 27
4: 334
Right 1156471759 18:37381494-37381516 CTTGCAGGCACCCTAGGGTAGGG 0: 1
1: 0
2: 0
3: 8
4: 114
1156471753_1156471763 30 Left 1156471753 18:37381479-37381501 CCTTGAGGTGGGAGCCTTGCAGG 0: 1
1: 0
2: 1
3: 27
4: 334
Right 1156471763 18:37381532-37381554 ACATGAACATTCCTTTAGAATGG 0: 1
1: 0
2: 1
3: 38
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156471753 Original CRISPR CCTGCAAGGCTCCCACCTCA AGG (reversed) Intronic
900223861 1:1523720-1523742 TCGGGAAGCCTCCCACCTCAGGG - Intronic
900241488 1:1619592-1619614 CCTGCAGGGCCCCCACCCCAAGG - Intronic
900498256 1:2986703-2986725 CGTGCAAGGCTGCCCCCTCGGGG + Intergenic
900547736 1:3237841-3237863 CCTGCAGGGCTGCCACCGCCTGG - Intronic
900843744 1:5079398-5079420 CCTGCAAAGGACTCACCTCAGGG + Intergenic
901690462 1:10969886-10969908 CCTGCAATGCTCCTCCCCCATGG - Intronic
903956155 1:27027469-27027491 CCAGGCACGCTCCCACCTCAGGG + Intergenic
903978362 1:27166992-27167014 CCTGCCAGACCCCCACCTCGGGG + Intergenic
907769312 1:57444083-57444105 TCAGCAGGGTTCCCACCTCAAGG + Intronic
908082234 1:60593346-60593368 CCTGCCAGGCTCACCCCTCTGGG + Intergenic
910024094 1:82628221-82628243 CATGCAAGCATCCCACCCCAAGG - Intergenic
911657775 1:100464218-100464240 CATGCCAGGCTCCCTCCTCCTGG + Intronic
913583626 1:120251352-120251374 CCCACAAGGCTCCCATCCCAGGG - Intergenic
913624550 1:120646968-120646990 CCCACAAGGCTCCCATCCCAGGG + Intergenic
913958754 1:143323688-143323710 CCTACAAGGCTCCTACCACCTGG + Intergenic
914053071 1:144149068-144149090 CCTACAAGGCTCCTACCACCTGG + Intergenic
914126126 1:144817473-144817495 CCTACAAGGCTCCTACCACCTGG - Intergenic
914565614 1:148863188-148863210 CCCACAAGGCTCCCATCCCAGGG - Intronic
914607211 1:149267064-149267086 CCCACAAGGCTCCCATCCCAGGG + Intergenic
916911671 1:169355582-169355604 CCAAGCAGGCTCCCACCTCAGGG + Intronic
917198416 1:172490723-172490745 CCAGCAAGGCTCCCCACTCCAGG - Intergenic
917679323 1:177349971-177349993 TCTGCAAGATTCCCACCTCCTGG - Intergenic
919343009 1:196337620-196337642 CCAGCCAGGCTCCCACTTTAGGG + Intronic
919842404 1:201618990-201619012 CCTCCCAGGCTCCCACCTGGGGG + Intergenic
919924479 1:202185352-202185374 GCTCCAAGGCTCCCTCCTCCAGG - Intergenic
920661933 1:207922744-207922766 CCTGCCAGGCTCCCACACCTCGG + Intergenic
920904644 1:210150521-210150543 GCAGCAAGGCTCCCTCCTCAGGG - Intronic
921039119 1:211413070-211413092 CTTGCAAAGCTGCCACCTCCAGG + Intergenic
922569482 1:226625561-226625583 CCTCCCATGCTCCCAGCTCAGGG + Intergenic
923035314 1:230281230-230281252 CCAGCCAGGCTTCCACCTCGGGG - Exonic
924031909 1:239894334-239894356 CCGGCAAGGCGGCCACCACAAGG - Intronic
1063072419 10:2679932-2679954 CCCGCCCAGCTCCCACCTCAAGG - Intergenic
1064773607 10:18751093-18751115 CCAGGCATGCTCCCACCTCAGGG + Intergenic
1066254247 10:33663182-33663204 GCTTCAAGGCTCCAACTTCAAGG - Intergenic
1066659994 10:37729077-37729099 CCTGTAAGGCTCCTACCACCTGG - Intergenic
1066758930 10:38736931-38736953 CCTACAAGGCTCCTACCACCTGG - Intergenic
1069545672 10:69326354-69326376 CCAGCACGGCTCCCTCCCCAGGG + Intronic
1069755478 10:70772068-70772090 CCAGCAAAGCTCCCACCTCTTGG - Intronic
1070309824 10:75265112-75265134 CCAGCCATCCTCCCACCTCAGGG - Intergenic
1070918721 10:80170944-80170966 CCTGCCAGTCCCCCACCACACGG + Intronic
1071087218 10:81876890-81876912 CCTGCAGAGCTGCCACCTCTAGG + Intronic
1071208800 10:83314285-83314307 CCTTCATGGTTCCCACTTCATGG + Intergenic
1073460629 10:103663813-103663835 CCTGCAGGGCCCACACCTCATGG - Intronic
1074455877 10:113594785-113594807 CCTGCAAGGCAGCCACCTCTGGG + Intronic
1075344185 10:121670310-121670332 CCTGCACAGCTCCCAAGTCAAGG - Intergenic
1076017996 10:127044498-127044520 CCTGCAATGCACCCTCCCCACGG - Intronic
1076871044 10:133195314-133195336 CCAGCATAGCCCCCACCTCACGG - Intronic
1077480666 11:2812937-2812959 GCTGCAAAGCTGCCCCCTCATGG + Intronic
1078424555 11:11238704-11238726 CCTTCAAGGGTCCCAGCCCAGGG + Intergenic
1078993203 11:16670065-16670087 CAGGCAAGGCCCCCAACTCATGG + Intronic
1081594639 11:44450710-44450732 CATCCAAGGCTCTGACCTCAAGG + Intergenic
1081824196 11:46031509-46031531 CCTGCCAGACCCTCACCTCATGG - Intronic
1082835162 11:57646132-57646154 CCTGTATGGCCCCCACCCCAAGG + Intronic
1083894342 11:65612709-65612731 CAGCCATGGCTCCCACCTCAAGG - Intronic
1086955967 11:92934758-92934780 ACTGCAGGACTCTCACCTCAGGG + Intergenic
1088740852 11:112765721-112765743 CCTGCAAGGCTCTCCTCTAATGG - Intergenic
1089679869 11:120113347-120113369 CCTGGAGGGCTGCCTCCTCAGGG - Intronic
1090479876 11:127058725-127058747 CCTGCTGTGCTCCCACCTCAGGG + Intergenic
1091603299 12:1930630-1930652 CCTGCCTCGCCCCCACCTCAGGG + Intergenic
1092654264 12:10668222-10668244 ACAGCAAGGCACCTACCTCAGGG - Intronic
1096773517 12:53950887-53950909 CCTACAAGCCTCCCTCCTCCAGG + Intergenic
1097010421 12:55949916-55949938 CATGCAATCCTCCCACCTCAGGG + Intronic
1097449804 12:59722590-59722612 CCAGCCATGCTCTCACCTCAGGG + Intronic
1097548593 12:61037290-61037312 CCTGAAAGATTCCCAACTCATGG - Intergenic
1098504373 12:71232253-71232275 CCTAGAATGCTCCCATCTCAAGG + Intronic
1098836371 12:75428862-75428884 CCTGCAAGCCTAACACCACATGG - Intronic
1099907561 12:88790291-88790313 CCTGCAAGCCTAACACCACATGG + Intergenic
1102050544 12:109858578-109858600 GCTGCAAGCTTCCCACCCCAAGG - Intronic
1102477245 12:113196589-113196611 CCTGCAAAGCTCCCCTCTCCAGG + Intronic
1102954918 12:117053037-117053059 CCTGCCTAGCTCCCTCCTCAGGG + Intronic
1103506363 12:121444215-121444237 CCTGCCCGGCTCCCTGCTCAAGG - Exonic
1103659693 12:122503845-122503867 CAAGCAATCCTCCCACCTCAGGG - Intergenic
1103717322 12:122952504-122952526 CCCTCTAGGCTGCCACCTCATGG - Intronic
1103963272 12:124622504-124622526 CCTGCTAGGGTCCTGCCTCAGGG + Intergenic
1104377734 12:128279606-128279628 CCAGATAGGCTCCCACCGCAGGG + Intronic
1104745425 12:131207500-131207522 CCTGGAAGGCTCCACCCCCACGG - Intergenic
1104788915 12:131469606-131469628 CCTGGAAGGCTCCACCCCCACGG + Intergenic
1105069494 12:133226151-133226173 CCAGCAAGGAGCCCACGTCAGGG - Intronic
1106853128 13:33817097-33817119 CCTGGAAGGCTTCTGCCTCAGGG - Intergenic
1107402845 13:40086167-40086189 CTTGCTGGGCTCCCACCCCAGGG - Intergenic
1115839868 14:37457881-37457903 CCTGCAAGAAACCCACCTCATGG + Intronic
1117015199 14:51510761-51510783 CCTCCAAGGCTAACACCTGAAGG + Intronic
1118076218 14:62302176-62302198 CCTGCAAGATTGCCACATCAAGG + Intergenic
1118969585 14:70622112-70622134 ACTCCAAGGCTCCACCCTCAGGG + Intergenic
1118978016 14:70694006-70694028 CCAAGCAGGCTCCCACCTCAGGG + Intergenic
1119397492 14:74337859-74337881 CAAGCCAGGCTCCCACTTCAGGG - Intronic
1120809692 14:88791820-88791842 CCTGAAGGGCTCTCACCTCCTGG - Intronic
1121554280 14:94824545-94824567 CCTCCAGGGCTCCTCCCTCAGGG - Intergenic
1122694847 14:103547518-103547540 CCTGCCAGGCTCCAACCTGGGGG + Intergenic
1122809438 14:104280787-104280809 CCTGCAGGGCACCCTCCCCATGG - Intergenic
1123422647 15:20144728-20144750 CCTACAAGGCTCCTACCACCTGG + Intergenic
1123442365 15:20301628-20301650 CCTACAAGGCTCCTACCACCTGG - Intergenic
1123496053 15:20828156-20828178 CCTGAATGGCTGCCACCTGATGG - Intergenic
1123531874 15:21151268-21151290 CCTACAAGGCTCCTACCACCTGG + Intergenic
1123552538 15:21397248-21397270 CCTGAATGGCTGCCACCTGATGG - Intergenic
1123588784 15:21834636-21834658 CCTGAATGGCTGCCACCTGATGG - Intergenic
1124584764 15:30994358-30994380 CCTCGAAGGCGCTCACCTCAAGG - Intergenic
1125874773 15:43134029-43134051 CCCGCAAGGGTCCCACCGCACGG - Intronic
1126758245 15:51945389-51945411 CCAGGCAGGTTCCCACCTCAGGG + Intronic
1128333741 15:66773083-66773105 CCTGCACAGGGCCCACCTCAGGG - Intronic
1128509568 15:68305069-68305091 CCTGCAAGGCCCTCCCCTCTCGG + Intronic
1129241112 15:74252784-74252806 CCTGCAGGGCCCCCACACCATGG + Intronic
1131120975 15:89823368-89823390 CCTGCCCTGCTGCCACCTCAGGG - Intergenic
1132034376 15:98469078-98469100 CCTTGAAGGCTCCAGCCTCATGG + Intronic
1202960887 15_KI270727v1_random:124468-124490 CCTGAATGGCTGCCACCTGATGG - Intergenic
1132571928 16:647948-647970 CCTGCCAGGTTCCCACCCCAGGG + Intronic
1133025510 16:2987455-2987477 CCTGCCAGGCCCCCAGCACAGGG + Intergenic
1133916406 16:10113172-10113194 CCAGCATGGCCCCCACCCCAGGG + Intronic
1134640786 16:15827768-15827790 CGTGCAAGGCCCCCAGGTCACGG - Intronic
1136718852 16:32303922-32303944 CCTACAAGGCTCCTACCACCTGG + Intergenic
1136723876 16:32342278-32342300 CCTACAAGGCTCCTACCACCTGG + Intergenic
1136837225 16:33510186-33510208 CCTACAAGGCTCCTACCACCTGG + Intergenic
1136842203 16:33548322-33548344 CCTACAAGGCTCCTACCACCTGG + Intergenic
1136862105 16:33710620-33710642 CCTACAAGGCTCCTACCACCTGG - Intergenic
1137367431 16:47872821-47872843 CATGCATGGCTCCCATCCCAGGG - Intergenic
1139261046 16:65594127-65594149 CCTGCAAGGATCCAATCTGATGG - Intergenic
1140551411 16:75870184-75870206 CCAGGCAGGCTCCCACCTCAGGG - Intergenic
1141093461 16:81146502-81146524 GATGGACGGCTCCCACCTCACGG + Intergenic
1141161686 16:81633358-81633380 CCTCCAGGGCTCCCACCTGCTGG + Intronic
1141305693 16:82861880-82861902 GATGCAAAGCTCCCAACTCAGGG + Intronic
1141700879 16:85641493-85641515 CCTACAAGGCTCCCAGGGCAGGG - Intronic
1142115838 16:88355695-88355717 CCTGCAAGACTCCCAGCCCCTGG - Intergenic
1142351655 16:89583482-89583504 CCTGCACGTCCACCACCTCACGG - Exonic
1142408678 16:89905120-89905142 CCTGCCACGCCCCCTCCTCAGGG + Intronic
1203002555 16_KI270728v1_random:175487-175509 CCTACAAGGCTCCTACCACCTGG - Intergenic
1203007579 16_KI270728v1_random:213849-213871 CCTACAAGGCTCCTACCACCTGG - Intergenic
1203123598 16_KI270728v1_random:1558803-1558825 CCTACAAGGCTCCTACCACCTGG - Intergenic
1203134161 16_KI270728v1_random:1711893-1711915 CCTACAAGGCTCCTACCACCTGG - Intergenic
1203147402 16_KI270728v1_random:1810465-1810487 CCTACAAGGCTCCTACCACCTGG + Intergenic
1203152368 16_KI270728v1_random:1848619-1848641 CCTACAAGGCTCCTACCACCTGG + Intergenic
1143341368 17:6213963-6213985 TCAGCCTGGCTCCCACCTCACGG - Intergenic
1144637262 17:16918247-16918269 CTGGCCAGGCTCCCACCTCAGGG - Intergenic
1145193256 17:20866532-20866554 CCTACCAGGCTCCTACCTCCAGG + Exonic
1145247718 17:21280481-21280503 CCTACAAGCCATCCACCTCAGGG + Intergenic
1146145491 17:30412601-30412623 CCTGCGAGGCTGCAGCCTCATGG - Intronic
1147322285 17:39653509-39653531 CCTGGTGGGCCCCCACCTCAGGG - Exonic
1147598435 17:41731685-41731707 CCTGCAAGGCTTCCAGCTGTGGG + Exonic
1147609030 17:41790723-41790745 CCTTCTATGCTCACACCTCAGGG + Intergenic
1148451878 17:47783887-47783909 CCTGTAAGGACCCTACCTCATGG - Intergenic
1149153720 17:53600855-53600877 CAGGCAATCCTCCCACCTCAGGG + Intergenic
1150287908 17:63964307-63964329 CCAGCAAAGCTCCCAGCCCAGGG + Intronic
1150798114 17:68255762-68255784 CATGCAAGGCTCCAACCACTTGG + Exonic
1151424885 17:74024548-74024570 GCTGCAATCCTCCAACCTCATGG + Intergenic
1153310214 18:3669940-3669962 GCTGTAGGGCTCCCACCCCACGG - Intronic
1153536414 18:6106905-6106927 ATGGCAAGGGTCCCACCTCAAGG + Intronic
1154415760 18:14174444-14174466 CCTACAAGGCTCCTACCACCTGG + Intergenic
1154453455 18:14500648-14500670 CCTGAATGGCTGCCACCTGATGG - Intergenic
1154485399 18:14868086-14868108 CCTCCAAGGCTCCTACCACTTGG - Intergenic
1156346566 18:36262321-36262343 CAAGCAATCCTCCCACCTCAAGG - Intronic
1156454113 18:37283219-37283241 CCTGGGTGGCTCCAACCTCAGGG - Intronic
1156471753 18:37381479-37381501 CCTGCAAGGCTCCCACCTCAAGG - Intronic
1160190825 18:76712917-76712939 ACTGCCAGGCTCCAAACTCATGG + Intergenic
1161800138 19:6412818-6412840 CGGGCCTGGCTCCCACCTCAGGG + Intergenic
1162217642 19:9149611-9149633 CCAGCCATGCTCCCACCTCAGGG - Intronic
1162432848 19:10639530-10639552 CCTGGCACACTCCCACCTCAGGG - Intronic
1163693606 19:18751026-18751048 CCTGCCAGGCCCCCACTCCAAGG - Intronic
1163746422 19:19051524-19051546 CCTGCAAGGTTCCCTCCCCTGGG - Intronic
1164428352 19:28165056-28165078 CTTGCAGGGGTCCCACCACAAGG + Intergenic
1164512918 19:28912004-28912026 CCTGGAAGGGACCCACCTCAGGG + Intergenic
1165323887 19:35102857-35102879 CCAGGCAGGCTCCCACCTCAGGG + Intergenic
1165423436 19:35733223-35733245 CCCCCACGGCTCCCACCTCCTGG + Exonic
1165743789 19:38218611-38218633 CCTCCAAGTCTTCCACCTCGAGG + Exonic
1166097356 19:40549218-40549240 CCTGCAGCTCTCCCACCTCGCGG - Exonic
1166499463 19:43330078-43330100 CCTGCAGGGTTACCACCACATGG + Intergenic
1166730555 19:45056882-45056904 CCTGCATGCCTCCCAACTCCAGG - Intronic
1167945696 19:52986783-52986805 CCTGCTAGTCTCCCATTTCATGG + Intergenic
1202692466 1_KI270712v1_random:101491-101513 CCTACAAGGCTCCTACCACCTGG + Intergenic
925035342 2:680582-680604 CCTGCAGGACACCAACCTCACGG + Intergenic
925118126 2:1397692-1397714 CCTCCAAGCCTCCCACCCCCGGG + Intronic
927869832 2:26616403-26616425 CCTCCCAGGCTCCCATCCCAAGG - Intronic
927909967 2:26890484-26890506 CCTGCAGGGCTTCAGCCTCAGGG - Intronic
930741454 2:54836542-54836564 CCTGCGACTCTCCCAGCTCAGGG + Intronic
930969899 2:57382506-57382528 CCTGCAAGGCGGCCACCTGCAGG - Intergenic
931142810 2:59482261-59482283 CCCCCAAGGCCACCACCTCATGG - Intergenic
932036736 2:68252924-68252946 CCCGCAAGGCTTCCACTCCAGGG - Intronic
932279967 2:70482079-70482101 TCTGCAAACCTCTCACCTCAGGG + Intronic
932303287 2:70683677-70683699 ACTGCACGGAGCCCACCTCATGG + Exonic
933771590 2:85748094-85748116 CCCAGCAGGCTCCCACCTCAGGG - Intergenic
934079904 2:88458847-88458869 CCTCCACTCCTCCCACCTCAGGG + Intergenic
934238134 2:90248723-90248745 CCTACAAGGCTCCTACCACCTGG - Intergenic
934275064 2:91568010-91568032 CCTACAAGGCTCCTACCACCTGG + Intergenic
934322261 2:91981271-91981293 CCTACAAGGCTCCTACCACCTGG - Intergenic
934460547 2:94212062-94212084 CCTACAAGGCTCCTACCACCTGG - Intergenic
934557619 2:95295868-95295890 CCTTCATGGCTGCCAGCTCAGGG - Intergenic
936111866 2:109671322-109671344 CCTACAAGGCTCCTACCACATGG - Intergenic
937189351 2:120079502-120079524 GCTGCAAGGCTACCACCAGATGG - Intronic
937225148 2:120364358-120364380 CCTCCCACTCTCCCACCTCAAGG + Intergenic
937408086 2:121649201-121649223 CTCGCCAGGCTCCCACCTCAGGG + Intronic
937423421 2:121777488-121777510 ACTGCAAGGCTGTCACCTCCTGG + Intergenic
938312606 2:130302703-130302725 CCTGCAAGGATCCTACCACCTGG - Intergenic
938583695 2:132669790-132669812 CCCCCAAGGCGCCCACCTCGGGG - Intronic
943743581 2:191437779-191437801 CCTCCCACTCTCCCACCTCAAGG + Intergenic
944067084 2:195630497-195630519 TCTGAAAGGCTCCCACCCTATGG - Intronic
944280915 2:197895798-197895820 CCTTCAAGGCTTCTAACTCAAGG - Intronic
945404010 2:209423812-209423834 TCTCCGAGGCTCCCACCTCGCGG + Intergenic
946177412 2:217929990-217930012 CTTGCATAGCTCCCAGCTCACGG + Intronic
946234711 2:218316852-218316874 CCTGACAGTCTCCTACCTCACGG - Intronic
946272787 2:218608201-218608223 TCTACAGGGCTCCCACCTCCTGG + Intronic
946525109 2:220509890-220509912 CATGGAAGGCACCCACCACAGGG + Intergenic
946714867 2:222542888-222542910 CAAGCAATCCTCCCACCTCAGGG + Intronic
947318673 2:228893299-228893321 CTTTCAAGTCTACCACCTCAGGG + Intronic
948520404 2:238533052-238533074 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948520668 2:238535088-238535110 GGTGCAATGCTCACACCTCAGGG + Intergenic
948520724 2:238535546-238535568 CATGCAGTGCTCACACCTCAGGG + Intergenic
948521075 2:238538307-238538329 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948521250 2:238539638-238539660 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948521508 2:238541636-238541658 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948522091 2:238546188-238546210 GATGCAGTGCTCCCACCTCAGGG + Intergenic
948522143 2:238546602-238546624 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948522323 2:238547844-238547866 AGTGCAGTGCTCCCACCTCAGGG + Intergenic
948522632 2:238550119-238550141 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
1168976477 20:1969779-1969801 CCAGCAGTGCTCCCACCTCTGGG + Intergenic
1171022225 20:21596121-21596143 CCTGCCAGTCTCCTGCCTCAAGG + Intergenic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1173628091 20:44488717-44488739 CCGGACAGGCTCCCACGTCAGGG - Intronic
1174115213 20:48222310-48222332 CAAGCAATCCTCCCACCTCAGGG + Intergenic
1174380032 20:50150387-50150409 CCTGGCAAGCTCCCACCTCAGGG + Intronic
1174465060 20:50710967-50710989 CAAGCAATGCTCCCACCTCGGGG + Intergenic
1174774875 20:53334421-53334443 CCAGGCATGCTCCCACCTCAGGG - Intronic
1175390892 20:58626662-58626684 CCCCCCAGGCTCCCAGCTCAAGG + Intergenic
1175923919 20:62462824-62462846 CCAGCATGGCTCCCACTGCATGG + Intergenic
1175928280 20:62481281-62481303 CCCCCAAGGCACCCACCTCCCGG - Intergenic
1175958007 20:62621258-62621280 CCTGCCAGGCTGCGACCCCAGGG - Intergenic
1176057708 20:63157510-63157532 TCTGCAAGGCCCCCACCTCTAGG - Intergenic
1176204765 20:63882297-63882319 CCTGCCAGGCGTGCACCTCAGGG + Intronic
1176297532 21:5082166-5082188 CCTGCAGGGCTCCCAGCCCCAGG - Intergenic
1176591673 21:8655101-8655123 CCTACAAGGCTCCTACCACCTGG - Intergenic
1176795936 21:13371390-13371412 CCTCCAAGGCTCCTACCACTTGG + Intergenic
1176820729 21:13652657-13652679 CCTGAATGGCTGCCACCTGATGG + Intergenic
1176857580 21:13984860-13984882 CCTACAAGGCTCCTACCACCTGG - Intergenic
1176867026 21:14059362-14059384 CCTACAAGGCTCCTACCACCTGG + Intergenic
1177299966 21:19230856-19230878 CCAGCAAGGCAACCACCCCAGGG + Intergenic
1179644963 21:42770203-42770225 CTGCCAAGGCCCCCACCTCAAGG + Intronic
1179859497 21:44179782-44179804 CCTGCAGGGCTCCCAGCCCCAGG + Intergenic
1180001796 21:44998449-44998471 CCTGCGAAGCTCCCAGCCCAAGG - Intergenic
1180009583 21:45040609-45040631 CCTTCAGGGCTGCCACCTCCTGG + Intergenic
1180549012 22:16527190-16527212 CCTACAAGGCTCCTACCACCTGG - Intergenic
1180917354 22:19498538-19498560 CCTTCAAGGCTCCCATCTTCAGG - Intronic
1181015955 22:20068890-20068912 TCTGCACAGCTCCCACCCCAGGG + Intergenic
1181335705 22:22126160-22126182 CCTACAAGGCTCCTACCACGTGG - Intergenic
1181355695 22:22294693-22294715 CCTACAAGGCTCCTACCACCTGG + Intergenic
1181553851 22:23656229-23656251 ACTGCCAGGCTCCCAGCTGAGGG - Intergenic
1181746460 22:24958158-24958180 CTTGCATGGCTCCCAACACAAGG + Intronic
1182685491 22:32119781-32119803 CCTACAGGGCTCCCACCACCTGG + Intergenic
1182697649 22:32207367-32207389 CCTACAAGGCTCCTACCACCTGG - Intergenic
1184469102 22:44685498-44685520 AGCGCAAGGCTCCCACCTTAAGG - Intronic
1185099896 22:48833857-48833879 CCTGCCAGGATCCCATCCCAGGG + Intronic
1185363525 22:50423518-50423540 TCTGCATGGCGCCCGCCTCATGG + Exonic
950521812 3:13501927-13501949 CCTGCAGGGCACTCACCTGATGG - Exonic
951160050 3:19407999-19408021 CCTTCATGGCTCCCACCCCTTGG + Intronic
952791530 3:37204440-37204462 CCAGGAATGCTTCCACCTCAGGG - Intergenic
953384569 3:42499279-42499301 CCTTCAAGGCTTCCAGCTCAGGG - Intronic
953388212 3:42519106-42519128 TCTGCCAGGCTCCCACCTCAAGG - Intronic
954794541 3:53154894-53154916 CCTGCATGGGGCCCACCTGAGGG + Intergenic
958047965 3:88307932-88307954 GCTGCAGGACTCCCGCCTCACGG - Intergenic
960956120 3:123032415-123032437 CACCCAAGGCTCTCACCTCAAGG + Intergenic
961636361 3:128335455-128335477 CCAGGCATGCTCCCACCTCATGG - Intronic
963967532 3:151389429-151389451 CCTGTAAGGATCACACCTGAAGG - Intronic
967417034 3:189230546-189230568 CCTCCATGGATCCCACCTCAGGG + Intronic
968131215 3:196193981-196194003 CCTGCAGGGCCCCCACCCAAGGG + Intergenic
968741157 4:2332405-2332427 CCTGCACAGCTCCCACCTCTGGG + Intronic
969417038 4:7067778-7067800 GCTGCCAGGCTGCCAGCTCAGGG - Intronic
969431560 4:7157924-7157946 CAAGCAATGCTCCCATCTCAGGG + Intergenic
969912742 4:10460557-10460579 CCTCAAAAGCGCCCACCTCAGGG - Intergenic
970833221 4:20367854-20367876 ACTGAATGGATCCCACCTCAGGG - Intronic
970979548 4:22080482-22080504 ACTGCAGGGCACCCAGCTCAGGG + Intergenic
971257451 4:25028449-25028471 CCTCCAAGGATGGCACCTCAGGG + Intronic
976658340 4:87512567-87512589 CCTGCAAGGTTCCAGCCACATGG - Intronic
978735356 4:112077992-112078014 CCTGCAAGGCTGCTACCTAATGG + Intergenic
980091425 4:128447192-128447214 CCTGTCATGCTCCCACCTAAGGG - Intergenic
981108736 4:140911201-140911223 CCTGCAAGGCTCCCACAGTCCGG + Exonic
981507157 4:145514835-145514857 GCTGCAAGTCTCCCACCGGAAGG + Exonic
984999236 4:185468574-185468596 CCAGCCACGCTCCCACCACAGGG + Intronic
985543783 5:499292-499314 CCTGCAGGGCTCACAGCACAGGG - Intronic
986346276 5:6838102-6838124 CCAGGAATGCTCCCACCACAGGG - Intergenic
988733406 5:33996089-33996111 CCTGAAAGGCTCCATTCTCAGGG + Intronic
989110612 5:37903544-37903566 CCAGCCATGTTCCCACCTCAGGG - Intergenic
991915017 5:71597191-71597213 CCTGGCACACTCCCACCTCAGGG - Intronic
995134916 5:108670810-108670832 CCTGCCAGGCTCCCTTCTCCAGG - Intergenic
995785590 5:115824238-115824260 CCTTCAAGGCCCCCTGCTCAAGG - Intergenic
997261836 5:132471264-132471286 CCTACAAGCCAGCCACCTCAGGG - Intronic
998564151 5:143201230-143201252 CCTGCCAGGCCCCCACATCTAGG - Intronic
999654114 5:153795858-153795880 TATGCAAGGCTGTCACCTCATGG + Intronic
999722045 5:154405524-154405546 CCTGCCTGGCTCCCTCCTCAGGG - Intronic
1000156310 5:158555514-158555536 CCTCCAAGGATTCCACCTCCTGG + Intergenic
1001874342 5:175186341-175186363 CCTTCGAGGCTCCCATGTCAGGG - Intergenic
1002381123 5:178830979-178831001 CCTACAAGGCTCCTACCACCTGG + Intergenic
1002408687 5:179056057-179056079 CCAGGCATGCTCCCACCTCAGGG + Intergenic
1004395398 6:15243515-15243537 CCTGCCAGGCTACCAGCTCCAGG - Intergenic
1004740052 6:18450825-18450847 CCTGCAAAGTTGCTACCTCAGGG + Intronic
1004920761 6:20373311-20373333 CCTGCAATGACCCCACTTCATGG - Intergenic
1008279094 6:49574057-49574079 CCTGCACTGCTTCCACCTCTCGG + Intergenic
1011527242 6:88278090-88278112 CCAGCCAGGCTCCCACGTCCAGG + Intergenic
1013919025 6:115378226-115378248 CCTGCATATCTCCCACCCCATGG - Intergenic
1014761614 6:125363414-125363436 GCTCCCAGGCTCCCGCCTCACGG + Intergenic
1015957508 6:138613922-138613944 CCTGCAAGGTTCCTATCTCTAGG + Intronic
1018838655 6:167503658-167503680 CCTGCTCGGCCCCCACCCCAGGG - Intergenic
1019313670 7:374909-374931 CCTGCAAGTTCCACACCTCAGGG - Intergenic
1020259326 7:6521815-6521837 CCTGCAAGACTCCTGCCTCTTGG - Intronic
1022199672 7:28104056-28104078 CCGGGCAGGCTCCCACCTCAGGG + Intronic
1022981767 7:35611112-35611134 TTTGGCAGGCTCCCACCTCAGGG - Intergenic
1023968065 7:44973639-44973661 CCTGTGGAGCTCCCACCTCATGG + Intronic
1024169240 7:46766980-46767002 CCTGCATAACCCCCACCTCAGGG - Intergenic
1024281800 7:47724728-47724750 CCTGCAAGTCCCCGACCCCAGGG + Intronic
1026015161 7:66666509-66666531 TGTGCCAGGCTCCCAGCTCAGGG + Intronic
1026736144 7:72949908-72949930 CCCGCCAGGCTCCCATGTCATGG - Exonic
1026851272 7:73725010-73725032 CCAGGCAGGCTCCCTCCTCATGG - Intergenic
1026891556 7:73985647-73985669 TGTGCCAGGCTCCCAGCTCAGGG + Intergenic
1027390322 7:77697049-77697071 CCCGCACGGCACCCACCTCGGGG - Exonic
1028096730 7:86769947-86769969 CCTGCAATCCACCCACTTCAGGG + Intronic
1028553308 7:92095602-92095624 TTTGCAAGGCTCTCAGCTCAAGG + Intronic
1028953849 7:96666836-96666858 CCTGCAGAGCACCCACCTCAGGG + Intronic
1032478730 7:132229744-132229766 TCTCCAAGGCTCCCTCCCCAAGG - Intronic
1032863606 7:135904514-135904536 CCAGGCATGCTCCCACCTCAGGG - Intergenic
1035972100 8:4260156-4260178 CTTGCAAGGATGCCACCTGATGG - Intronic
1037039695 8:14216108-14216130 CCTGCAAGGCTACTCTCTCAGGG - Intronic
1038698932 8:29831427-29831449 ACTGCAAGGGTCCTACCTCTGGG - Intergenic
1039237034 8:35513103-35513125 CCAGACAGGCTCCCACCTCTGGG + Intronic
1044305765 8:90638885-90638907 ACTGGAATGCTACCACCTCAAGG + Intronic
1049252629 8:141597340-141597362 CCGGCCTGGCTCCCACCCCACGG - Intergenic
1049372080 8:142272721-142272743 CCTGCAAGGGGCCCTCCCCACGG - Intronic
1049426919 8:142541829-142541851 CCTGCGAGGCCGCCACCTCCTGG - Intronic
1049525893 8:143126839-143126861 CCAGCACGGCTGCCAGCTCACGG - Intergenic
1049549489 8:143250465-143250487 CCGGCGAGGCTCGCACCGCAGGG - Exonic
1049651704 8:143772571-143772593 CCTGCCAGACTCACACCTCCCGG - Intergenic
1050387006 9:5101303-5101325 CCTGCCAGGCTGCTGCCTCACGG - Intronic
1051971882 9:22898248-22898270 TCTCCAATGCTCCCACCACAAGG - Intergenic
1053034299 9:34810735-34810757 CCTACAAGGCCTCCACCTCTGGG - Intergenic
1053050832 9:34958991-34959013 CCTAGAAGGCCCCCACCTCTGGG - Intronic
1053691046 9:40587759-40587781 CCTACAAGGCTCCTACCACCTGG - Intergenic
1053886317 9:42646958-42646980 CCTCCAAGGCTCCTACCACTTGG - Intergenic
1054225337 9:62454407-62454429 CCTCCAAGGCTCCTACCACTTGG - Intergenic
1054273758 9:63049732-63049754 CCTACAAGGCTCCTACCACCTGG + Intergenic
1054401082 9:64715236-64715258 CCTACAAGGCTCCTACCACCTGG - Intergenic
1054434687 9:65199550-65199572 CCTACAAGGCTCCTACCACCTGG - Intergenic
1054495702 9:65822131-65822153 CCTACAAGGCTCCTACCACCTGG + Intergenic
1055021539 9:71675496-71675518 CCTGCAGTGGCCCCACCTCATGG - Intergenic
1057152953 9:92809927-92809949 CCTCCAAGGCCCCCGCCCCAGGG - Intergenic
1057371856 9:94480483-94480505 CCTACAAGGCTCCTACCCCCTGG - Intergenic
1057666930 9:97053281-97053303 CCTCCAAGGCCTCCACCTCCAGG - Intergenic
1057787029 9:98095208-98095230 TCCGCATGGCTCCCACCTCAGGG - Intronic
1059633443 9:116150011-116150033 CCTGAAGGGCTCCCTCCTCTGGG - Intergenic
1059994881 9:119899051-119899073 CCTCCCAGTCTCCCACCTCTTGG + Intergenic
1060290567 9:122299014-122299036 CCAGGTAGACTCCCACCTCAGGG - Intronic
1061005911 9:127928315-127928337 CCTGCAAGGCTCAAGTCTCAGGG + Intronic
1061328580 9:129878706-129878728 CCTGCAAGGCCCTTTCCTCAGGG + Intronic
1061757364 9:132824397-132824419 CCAGCACGGCACCCACCGCAAGG - Intronic
1061817286 9:133204954-133204976 ACCGCAGGGCTCCCGCCTCAGGG - Intergenic
1062621381 9:137423828-137423850 CCTGCTCGGCTCCCACCTGCCGG - Intronic
1203526627 Un_GL000213v1:96908-96930 CCTGAATGGCTGCCACCTGATGG - Intergenic
1203621700 Un_KI270749v1:133865-133887 CCTACAAGGCTCCTACCACCTGG - Intergenic
1186394667 X:9195720-9195742 CCTCCAAGGCTCCCTCCACCTGG + Intergenic
1186796360 X:13050402-13050424 CCTCCAAGACTCTCAGCTCAGGG + Intergenic
1188224012 X:27574818-27574840 GCTGTGAGGCTCCGACCTCACGG + Intergenic
1188830740 X:34893944-34893966 CCTGCAAGTCTGCCACCTTGTGG - Intergenic
1190060130 X:47205496-47205518 CCTGCTAGCCTCCTAACTCAGGG + Intronic
1190324332 X:49197607-49197629 CCTGCCCAGCTCCCACCTCGAGG - Intronic
1190999115 X:55641102-55641124 CCTGCTGGTCTCCTACCTCACGG + Intergenic
1191798053 X:65044288-65044310 CCAAGCAGGCTCCCACCTCAGGG - Intergenic
1193277343 X:79604759-79604781 CCTGTTAGACTTCCACCTCAGGG + Intergenic
1195729268 X:107949273-107949295 CCTGCCAGGCTGCTGCCTCACGG + Intergenic
1201189751 Y:11436456-11436478 CCTACAAGGCTCCTACCACCTGG - Intergenic
1202583893 Y:26405513-26405535 CCTACAAGGCTCCTACCACCTGG + Intergenic