ID: 1156472271

View in Genome Browser
Species Human (GRCh38)
Location 18:37384661-37384683
Sequence CAGAGCAAAGTGAAGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 359}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156472265_1156472271 10 Left 1156472265 18:37384628-37384650 CCTTAGCCTATGGAGGGTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG 0: 1
1: 0
2: 1
3: 32
4: 359
1156472267_1156472271 4 Left 1156472267 18:37384634-37384656 CCTATGGAGGGTGGTGGTGTCAG 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG 0: 1
1: 0
2: 1
3: 32
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156472271 Original CRISPR CAGAGCAAAGTGAAGGTGGT AGG Intronic
900274320 1:1813916-1813938 CAGAGCAAATTGGAAGTGATGGG - Intronic
900623260 1:3596850-3596872 TAGAGCAGAGGGAAGGTGGGAGG + Intronic
900702637 1:4057808-4057830 CAGAGCACAGTCAAGATGGGAGG + Intergenic
900809038 1:4787296-4787318 CAGAGCAGAGTGATGGGGCTGGG + Exonic
901228199 1:7626811-7626833 CAGAGAGTAGTGAAGGTGGGAGG - Intronic
902107921 1:14053040-14053062 TAGAACACAGCGAAGGTGGTGGG + Intergenic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
906271935 1:44486217-44486239 CAGAACAAAGTGAAAGGGGGGGG + Intronic
906955397 1:50369866-50369888 CAGAGCGAAGAGCAGGTGGGAGG + Intergenic
908135283 1:61125918-61125940 CAGAGAAAAGTGAGGAAGGTAGG + Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910707192 1:90142297-90142319 CAGAGCAAAGAGCAGGAGCTGGG + Intergenic
911084996 1:93968924-93968946 CAGAGCAGAGTAAAGGGGCTGGG + Intergenic
912325726 1:108759709-108759731 CAGAGCAAACTGAAATTGTTAGG - Intronic
913191500 1:116417086-116417108 CACAGCATTGTGAGGGTGGTTGG + Intergenic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
916257494 1:162804599-162804621 CAGAGCAATGGGAAGCTGGAGGG + Intronic
916574610 1:166056391-166056413 AAGATCAGAGTGCAGGTGGTGGG + Intergenic
917745958 1:178007403-178007425 CAGAGCAAAATGAGGGAGGCAGG + Intergenic
917962429 1:180155312-180155334 CTGAGAAACATGAAGGTGGTGGG - Intronic
918611127 1:186493474-186493496 CAGTGCAAAGTGAGGTTGGCCGG - Intergenic
918661353 1:187092541-187092563 AAGAAAGAAGTGAAGGTGGTAGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919845372 1:201639124-201639146 CAGAGCAAAGCAAAGGTGCAGGG + Intronic
921179652 1:212621990-212622012 TAGAGGAAAGGGAAGGTGGGGGG + Intergenic
921285135 1:213602689-213602711 CAGATCAAAGTTAAGGTCTTTGG + Intergenic
921608016 1:217177846-217177868 GAGTGCAAATTGAATGTGGTGGG + Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
921971627 1:221155347-221155369 AAGAGCAAAGTGGAAGTGGGAGG - Intergenic
922040247 1:221889294-221889316 CAGAGGGAAGTGGAGGAGGTAGG + Intergenic
922464608 1:225838622-225838644 CAGAGCACAGTCAGGGTGGAGGG - Intronic
922791922 1:228315643-228315665 CAGGGCATAGTGGTGGTGGTGGG + Intronic
923665136 1:235992668-235992690 CAGAGGAAAGTCACGGTGCTGGG - Intronic
923990124 1:239427003-239427025 CAGAGGTGAGTGAAGGAGGTGGG + Intronic
1064280684 10:13948591-13948613 CTGAGCAGAGAGCAGGTGGTGGG + Intronic
1064428611 10:15252360-15252382 CAGAGTTCAGTGAAGGTGGATGG - Intronic
1065005171 10:21373075-21373097 CAGAATAAAGTGAAAGTGATGGG + Intergenic
1065047410 10:21756953-21756975 CAGCCCAAAGGGAAGGTGCTTGG + Intronic
1066723943 10:38370285-38370307 CAGAGCAATGGGAAGCTGGAGGG + Intergenic
1066986590 10:42474133-42474155 CAGAGGAATGTGAAAGTCGTTGG + Intergenic
1067156075 10:43782342-43782364 CAGGGCAAAGTGAAGGCTGGTGG - Intergenic
1069920093 10:71811248-71811270 CAGAGCAGACTGTCGGTGGTGGG + Intronic
1070409394 10:76125603-76125625 CAGAGTACAGTGAAGGTAGGGGG + Intronic
1070627696 10:78062919-78062941 CTGAGCAGACTGAAAGTGGTGGG - Intergenic
1071668079 10:87579678-87579700 CTGAAGAAAGTGAACGTGGTAGG + Intergenic
1073591802 10:104764997-104765019 CAGAGGTCAGGGAAGGTGGTGGG + Intronic
1073686060 10:105755056-105755078 CAGAGCGCAGTGGGGGTGGTAGG + Intergenic
1073765331 10:106676064-106676086 CAGAGCAAAGAAAAGGTCCTCGG - Intronic
1074682932 10:115927750-115927772 CAGTGCACAGTGTAGGTGTTGGG + Intronic
1074870329 10:117571043-117571065 CAGAGCACAGAGAAGCTTGTGGG - Intergenic
1075737074 10:124670530-124670552 CAGGGCACAGTGAAGCTGGGGGG - Intronic
1075919373 10:126197785-126197807 CAGAGAGAAGTGATGCTGGTAGG + Intronic
1075968047 10:126629866-126629888 CAAGGAAAAGTGAGGGTGGTGGG + Intronic
1076365588 10:129919506-129919528 CAGAGCACAGTGAAAGTTGTTGG - Intronic
1076553645 10:131306116-131306138 CGGGGACAAGTGAAGGTGGTAGG - Intronic
1076688538 10:132209020-132209042 CAGAGAAAAGTGAGTGTGTTGGG - Exonic
1077724596 11:4661513-4661535 CAGAGCACAGCCAAGGTGATGGG + Intergenic
1078085154 11:8229487-8229509 CAGAGCCAAATGCAGGTGCTGGG + Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1079548431 11:21664361-21664383 GATAGCAAAGTGGTGGTGGTGGG + Intergenic
1080090124 11:28337981-28338003 CAGATGAAAGTTAAGGGGGTGGG - Intergenic
1080774309 11:35371455-35371477 TGGAGCAAAGTGAAGCTGATGGG + Intronic
1080822159 11:35817841-35817863 CAGAGCAGAAGGAAGGTGGGGGG - Exonic
1081399812 11:42629751-42629773 CTGAGCCAAGTGAAGAGGGTTGG + Intergenic
1082160516 11:48883798-48883820 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082161850 11:48896608-48896630 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082167435 11:48965053-48965075 CTGAGCAAAGAGGAGGAGGTGGG + Intergenic
1082236127 11:49821606-49821628 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082239585 11:49856152-49856174 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082242569 11:49888199-49888221 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082609630 11:55281526-55281548 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1083519563 11:63295838-63295860 CAGATGAAAATGAGGGTGGTGGG + Intronic
1085206938 11:74740417-74740439 TGGACCAAAGTGAAGGTAGTAGG + Intergenic
1085386665 11:76161700-76161722 CAGAGCAGAGGGGAGGGGGTGGG - Intergenic
1085732765 11:79013447-79013469 GAGAACACAGTGAAGGGGGTTGG - Intronic
1088437598 11:109832426-109832448 CACAGTAGAGTGAAGGTGATTGG - Intergenic
1088610281 11:111570017-111570039 CCGGGCAAAGTGGAGGAGGTAGG - Intergenic
1090571309 11:128049556-128049578 AAGAGCAAAGAGATGGTGATTGG + Intergenic
1091051349 11:132375758-132375780 CAGAACATAATGAAGCTGGTTGG + Intergenic
1092071538 12:5635391-5635413 CAGAGCAAATAGTAGGTGCTCGG - Intronic
1092367684 12:7890678-7890700 AAGACCAAAGGGAAGGGGGTTGG - Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1093150755 12:15618315-15618337 CAGAGCAAAGGGAAGGGATTAGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1094450420 12:30577914-30577936 TAGAGCAGACTGAAGGTGATTGG + Intergenic
1096145552 12:49276392-49276414 AAGAGCAAAGTGCCAGTGGTTGG + Intergenic
1098106856 12:67076783-67076805 CAGAGGAAAATTAAGGTGGCTGG + Intergenic
1100490341 12:95072840-95072862 GAGAGAAAAGTGAAAGTGGGGGG + Intronic
1100743296 12:97618864-97618886 AGGAGCAAAGTCAAGGAGGTGGG - Intergenic
1101246531 12:102889015-102889037 GAAAGAAAAGTGCAGGTGGTGGG + Intronic
1102037926 12:109782814-109782836 GAGAGCAGAGTGATGCTGGTGGG - Intergenic
1102173346 12:110858810-110858832 CAGAGCAAAGGGGAGGAGTTGGG + Intronic
1102657550 12:114495135-114495157 CAGAAGAAAGTAAAGGAGGTAGG - Intergenic
1103518719 12:121523881-121523903 CAGAGGAGGGTGAAGGTCGTGGG - Intronic
1103989468 12:124788957-124788979 CACAGCAAATTGATGATGGTGGG + Intronic
1104347423 12:128013825-128013847 CCTAGCAAAGTGAGGGTGGGAGG + Intergenic
1106071942 13:26420847-26420869 CAGATCAAAGCTAAGGTGGCTGG - Intergenic
1106451221 13:29884325-29884347 CAGAGCAAAGTGAATTAGATTGG + Intergenic
1106964903 13:35051669-35051691 CAGAGCAAAGGCAATGTGATTGG - Intronic
1108086161 13:46796060-46796082 TAGAGCCATGTGAAGGTGTTTGG - Intronic
1108909357 13:55524297-55524319 CAGAGTAAAGAGAAAGTAGTGGG - Intergenic
1109245717 13:59952626-59952648 CAGAGAATAATGAAGGTGGTTGG - Intronic
1109778315 13:67073246-67073268 CAGAGCAAAGCTAAGGTGAATGG + Intronic
1111700769 13:91684894-91684916 CAGAGGAAAGTCAATGTGATTGG - Intronic
1111791249 13:92858312-92858334 AAGAGCAAAGGGATGGTGGCAGG - Intronic
1111792198 13:92871652-92871674 CAGAGCGTAGAGAAGATGGTTGG + Intronic
1112609932 13:100946164-100946186 CTGAGCAAGGTGGATGTGGTAGG - Intergenic
1113842682 13:113369357-113369379 CAGGGCAAAGGGAAGGCGGGAGG - Intergenic
1114088518 14:19261886-19261908 CAGAGCAAAGGCAATGTGATTGG + Intergenic
1114236042 14:20824613-20824635 TAGAGGAAGGTGCAGGTGGTGGG + Intergenic
1114829244 14:26119341-26119363 AACAGAAAATTGAAGGTGGTGGG - Intergenic
1114924412 14:27376932-27376954 CAGAGCAAAGTGAACAGTGTAGG - Intergenic
1116344811 14:43779076-43779098 CAAAGCAATGTGAAGGTAATAGG + Intergenic
1118137098 14:63042142-63042164 CAGAGCAGAGAGAAAGGGGTGGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119759002 14:77138591-77138613 CAGAGCAGAGGGAACGTGGGTGG - Intronic
1120614825 14:86690353-86690375 AAGATCAAAGTCAAGGTGCTGGG - Intergenic
1121236651 14:92396335-92396357 CACAGCAAATTGAAGGGAGTAGG - Intronic
1122148175 14:99706538-99706560 CTGTGCAGAGTGAAGGTGGGTGG - Intronic
1122378463 14:101285260-101285282 CTGAGGCAACTGAAGGTGGTTGG - Intergenic
1122595606 14:102888332-102888354 CAGGGCAGAGTCAAGGTGGTAGG - Intronic
1123804934 15:23860975-23860997 CCCAGCGAAGAGAAGGTGGTGGG - Intergenic
1124347939 15:28934815-28934837 CACAGCAAGGTGTAGGTGGCAGG - Intronic
1126335387 15:47581663-47581685 CAGAGCAAAGGACAGGGGGTTGG + Intronic
1127942555 15:63714278-63714300 TACAGCAAAGTGTAGATGGTAGG - Intronic
1127976458 15:64000803-64000825 GAGTGTAAAATGAAGGTGGTGGG + Intronic
1128506377 15:68275926-68275948 CAGAGGAGAGGGAGGGTGGTAGG + Intergenic
1128668860 15:69559269-69559291 CAGCGCAAAGAGAAGGCTGTGGG - Intergenic
1129268666 15:74408290-74408312 CAGAGCAAACTGAAGTGGGAGGG + Intergenic
1129540439 15:76343229-76343251 CAGACCGAAGTGGAGGGGGTCGG + Intergenic
1130871237 15:87973849-87973871 AAGAGCAAAATGAAGGTGGCAGG - Intronic
1131340891 15:91599541-91599563 GAGAGCAGACGGAAGGTGGTGGG + Intergenic
1131797550 15:96034922-96034944 CAGAGCAAAGGGAACGTGCAAGG - Intergenic
1132013509 15:98296395-98296417 CAGTGCAAAGTGAAAATGCTGGG + Intergenic
1132989663 16:2786276-2786298 CAGAGCACTGTGAAGGTGCAGGG + Intronic
1133062953 16:3187159-3187181 CACAGAAAAGTGAAGGAGGCTGG - Intergenic
1133385021 16:5362720-5362742 CAGAGCAAAATGGTGGTTGTCGG - Intergenic
1133818737 16:9217791-9217813 CAGGGCTGAGTGGAGGTGGTTGG - Intergenic
1134346108 16:13393318-13393340 CAGTGCAAAGTGAAAATGCTGGG - Intergenic
1134741339 16:16549798-16549820 CAAAGCAACAAGAAGGTGGTTGG - Intergenic
1134926219 16:18162643-18162665 CAAAGCAACGAGAAGGTGGTTGG + Intergenic
1135028157 16:19014599-19014621 CAGGGGAAAGAGAAGGTGCTGGG - Intronic
1136131123 16:28222217-28222239 CAGCTAAAAGTGAAGGTGGGAGG - Intergenic
1139003524 16:62542779-62542801 CAGAGAAAGGTGAAGGTGAAAGG + Intergenic
1139513860 16:67442147-67442169 CAGAGCACAGTGAGGGTTGGTGG - Intronic
1139776437 16:69319704-69319726 CAAAGACAAGTGAAGGTGGAAGG + Intronic
1140910870 16:79451150-79451172 CCCTGCAAACTGAAGGTGGTGGG - Intergenic
1142114098 16:88347521-88347543 AAGTCCAAAGTGAAGATGGTGGG - Intergenic
1143881134 17:10030984-10031006 CAGAGGACAGTGATGGTGTTGGG - Intronic
1144176774 17:12715140-12715162 CAGAGCAAAGTCAAAGAGGGTGG + Intronic
1146529100 17:33592690-33592712 CGGACCAAAGTGAAGGAGGAGGG + Intronic
1146840761 17:36152534-36152556 CACAGCAAAGAGAATGTAGTTGG - Intergenic
1147335233 17:39723610-39723632 CTGAGGAAGGTGAAGGTGCTTGG + Exonic
1147951612 17:44110910-44110932 CAGACCGAAGGGAAGGTGGTCGG + Intronic
1148085370 17:44990613-44990635 CAGAGCCAAGATAAGGTGCTGGG - Intergenic
1149040411 17:52181832-52181854 CAGAGGAAGGGAAAGGTGGTGGG - Intergenic
1149092312 17:52798459-52798481 CAGACCAAAATGAAGGTTATGGG + Intergenic
1149858762 17:60108434-60108456 CACAGCAAAGAGAATGTAGTTGG + Intergenic
1151000350 17:70368907-70368929 CAGGGCAGAGTGAAGGTGGGGGG + Intergenic
1151080237 17:71321366-71321388 CATAGCTATGTGAAGGTGGCAGG + Intergenic
1151259331 17:72904457-72904479 CAGACCAGAGTGAAGCTGATAGG - Intronic
1151476928 17:74349385-74349407 CAGAGCAACGTGAGGCTGGCCGG - Intronic
1151672275 17:75577715-75577737 CAGGGCAAGGCGACGGTGGTAGG + Intergenic
1151763342 17:76119810-76119832 GAAGGCAAAGTGAAGGAGGTCGG + Intronic
1156469176 18:37366858-37366880 CAGAGAGAAGTGAAGAGGGTGGG - Intronic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1156566918 18:38202148-38202170 AAGAGCAAAGGGAAAGTGGTGGG - Intergenic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1159424279 18:68264409-68264431 CAGAGCAATATGATGGTTGTTGG - Intergenic
1160701256 19:508498-508520 CTGAGCCCAGGGAAGGTGGTTGG + Intronic
1161731718 19:5964828-5964850 AGGAGCTAAGTGGAGGTGGTAGG + Intronic
1162099790 19:8332989-8333011 CAGAGCCAAGGGAGGGTGGGTGG - Intronic
1165230107 19:34381463-34381485 TAGACCAAAGTGAAGGAGTTTGG + Exonic
1165580206 19:36855787-36855809 CACAGCACAGTGGAGGTGATAGG - Intronic
1166767899 19:45263273-45263295 CAGAGGAGAGTGAGGGTGGGTGG - Intronic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1168024211 19:53631985-53632007 CAGAGAAAGGTGGAGGAGGTGGG + Intergenic
1168592897 19:57651782-57651804 GAGAGAAAAGGGAAAGTGGTAGG - Intergenic
925055425 2:853518-853540 AAGAGAAGGGTGAAGGTGGTGGG - Intergenic
925288690 2:2732015-2732037 CACAGCAATGTGAAGGTGACCGG + Intergenic
925288697 2:2732073-2732095 CACAGCAACGTGAAGGTGACCGG + Intergenic
925288704 2:2732131-2732153 CACAGCAATGTGAAGGTGACCGG + Intergenic
926053373 2:9758671-9758693 AAGAGCAAAGAGAAGGTTGTAGG + Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
927476421 2:23417702-23417724 CAGAGAAAAGTGAGGCTGGAGGG - Intronic
927761050 2:25754295-25754317 CAGAGAACAGTGAATGTGCTTGG + Intronic
929843461 2:45496727-45496749 CAGAGGAAAGTAGAGGTTGTGGG - Intronic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
935364121 2:102271328-102271350 GAGAGCAGAGTGCACGTGGTTGG - Intergenic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
936115856 2:109702456-109702478 CAGACCAGAGTTCAGGTGGTGGG - Intergenic
936459060 2:112698077-112698099 CAGAGGACAGAGAAGGTGGTAGG - Intergenic
937040957 2:118820294-118820316 CAGAGGAAAGTGAGTGTGGGAGG + Intergenic
938465502 2:131522279-131522301 GAGAGCAAAATGCAGTTGGTGGG + Intergenic
938487685 2:131729479-131729501 CAGAGCAAAGGCAATGTGATTGG - Intronic
939007802 2:136809390-136809412 TAGAGCTAAGTGAAGATGGTAGG + Intronic
939523830 2:143266458-143266480 CAGGGCAGACTAAAGGTGGTTGG + Intronic
939732379 2:145800403-145800425 CAGTGCAAAGGGAAGATGGGGGG + Intergenic
940979974 2:159990633-159990655 CAGAGAAAAGTGAAGCTCTTTGG + Intronic
941994789 2:171592121-171592143 CAGAGTAAAGTCAAGGCAGTGGG - Intergenic
943060387 2:183037636-183037658 CATAGGAAAGGGAGGGTGGTGGG - Intronic
944818918 2:203409137-203409159 CAGTGAAAAGAGAAGGTAGTTGG - Intronic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945990093 2:216388783-216388805 CCTAGCAAAGTGAAAGTGGGAGG - Intergenic
947060978 2:226164751-226164773 CAGATTCAAGTGAAGGTGGCAGG - Intergenic
948241778 2:236443812-236443834 CAGAGAAAAGGGAATGTGGAAGG - Intronic
948549945 2:238764623-238764645 CAGAGCCAAGTGAAGGAGGGAGG + Intergenic
948618406 2:239216676-239216698 CAGGGCAGAGTGAAGGCGGAGGG - Intronic
1168873117 20:1147782-1147804 CTGAGCAAAGTGGTGGTGATGGG - Intronic
1169342602 20:4807907-4807929 CAGTGCTTTGTGAAGGTGGTTGG - Intronic
1171505809 20:25632567-25632589 AAGAGCAAGGTGAAGGTCATTGG - Intergenic
1172855147 20:37996010-37996032 AACAGCAAAGTGAAAGTGCTGGG - Intronic
1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG + Intergenic
1174008328 20:47428266-47428288 CAGAGGGAAGGGAAGGTGGACGG - Intergenic
1174373364 20:50109355-50109377 AAGAGAAAAGAGAATGTGGTGGG + Intronic
1174423503 20:50416126-50416148 GAGAGGAAAGTGGAGGTGCTGGG + Intergenic
1174719646 20:52798233-52798255 GAGGACCAAGTGAAGGTGGTGGG - Intergenic
1175523501 20:59618148-59618170 CAGTGCAAAGGCCAGGTGGTGGG + Intronic
1176447324 21:6831434-6831456 CTGAGCACAGTGCAGGTGCTGGG + Intergenic
1176825492 21:13696460-13696482 CTGAGCACAGTGCAGGTGCTGGG + Intergenic
1177250163 21:18582322-18582344 CAGAGGGAAGTGATGGTGGCTGG - Intergenic
1177637363 21:23804867-23804889 AAGAGCAGAGTGAAAGTGGAAGG - Intergenic
1177862699 21:26473563-26473585 CTGAGCACAGTGAAGGGGGTGGG - Intronic
1178354293 21:31897755-31897777 AAGAGGACAGTGAAGGAGGTGGG + Intronic
1179218984 21:39389811-39389833 CAGAGCAAGGTGCAGGTGCAGGG - Intronic
1179299515 21:40094044-40094066 CAGAGAAAAATGTAGATGGTGGG - Intronic
1179396307 21:41043489-41043511 CAGAGCAGAAGGAAGGTGGTGGG + Intergenic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180492193 22:15860451-15860473 CAGAGCAAAGGCAATGTGATTGG - Intergenic
1180706818 22:17815329-17815351 CACAGCAACGTGAGGGAGGTGGG + Intronic
1181409852 22:22711214-22711236 CAGAGCAAAGGCAGGGAGGTGGG - Intergenic
1181528211 22:23502050-23502072 CAGAGGAAAGGGCAGGTGGTGGG - Intergenic
1183804956 22:40200876-40200898 CAGTGGAATGTGATGGTGGTGGG + Intronic
1184015526 22:41783078-41783100 CAGAGGACAGGGAAGGTGGGTGG - Intronic
1184101994 22:42345573-42345595 CAGAGCTAAGTCCAGGAGGTGGG + Intergenic
1184246219 22:43237083-43237105 AAGAGCAAAGGAAATGTGGTGGG + Intronic
1184306209 22:43604016-43604038 CAGAGCAGGATGAAGGTGGTGGG - Intronic
1185104283 22:48858409-48858431 CAGAGCAAGGTGCTGGTGGCAGG - Intergenic
949214678 3:1551633-1551655 CCCAGCAAAGTGATGATGGTGGG + Intergenic
949356600 3:3187055-3187077 CAGAGCAATGAGCAGTTGGTAGG + Intergenic
950333496 3:12175780-12175802 AAGAGCAAAGACATGGTGGTGGG + Intronic
952968576 3:38636673-38636695 CAGAGCCAGGTGCAGGTGGTGGG - Intronic
955806024 3:62735761-62735783 CAAAGAAAAGAAAAGGTGGTAGG - Intronic
956793778 3:72700313-72700335 CAGAGCTCAGTAAAGGTGGTTGG + Intergenic
957768280 3:84655453-84655475 CACAGAAAGGTGAAGGTGGAAGG + Intergenic
958440739 3:94153416-94153438 CAGAGCAAAGTAATGAGGGTTGG + Intergenic
958627634 3:96646569-96646591 CAGTGCGAAGTGAAGCTGGCTGG - Intergenic
960445256 3:117740502-117740524 AAGGGCAGAGTGAAGGTGCTTGG - Intergenic
960700303 3:120432812-120432834 CACAGGTAAGTGGAGGTGGTTGG + Intronic
962826992 3:139107579-139107601 CAGAGCAAGGTGGAGGAGGTGGG + Intronic
963574723 3:147045713-147045735 AAGAGGTAAGTGAAGGAGGTTGG - Intergenic
964417546 3:156463383-156463405 CATAGCAAAGTAAAGGTGAGTGG - Intronic
964913499 3:161811247-161811269 CAGATCAAAGGGAAGCTGTTAGG - Intergenic
965085794 3:164095892-164095914 AAAATCAAATTGAAGGTGGTTGG + Intergenic
966034641 3:175396802-175396824 AAGCACAGAGTGAAGGTGGTGGG - Intronic
966219497 3:177536220-177536242 GAGAGTCAAGTGAAGGTGGGAGG + Intergenic
966852906 3:184175479-184175501 CAGAGTAATGAGAGGGTGGTAGG - Intronic
968293880 3:197558586-197558608 CACAGAAAAGTGAAAGTGTTCGG - Intronic
968299740 3:197603499-197603521 CAGAAACAAGTGGAGGTGGTGGG - Intergenic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969501124 4:7553808-7553830 GAGAGGAAGGTGAAGGTGGGAGG + Intronic
970429376 4:15974789-15974811 CAGTGCAAAGAGAAGGTGCTAGG - Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971980744 4:33747049-33747071 AACAGCAAAGTGAATTTGGTAGG + Intergenic
972759151 4:42084808-42084830 CAGAGCAAAGTAAAGATTTTGGG - Intronic
973338785 4:48983758-48983780 GAGATCAAAGTAAATGTGGTGGG + Intergenic
974096909 4:57373865-57373887 CAGGGCAAGGTGTAGGGGGTAGG + Intergenic
975098317 4:70483264-70483286 CAGAGTAAAGTGAGGGAGATGGG - Intergenic
976151689 4:82099014-82099036 CAGGGAAGGGTGAAGGTGGTAGG - Intergenic
976456025 4:85247568-85247590 CAGAGCAAAATGAGGGAGGCAGG - Intergenic
976986250 4:91302690-91302712 CAGAGAAAAGGGAAAGTGGCTGG - Intronic
977123538 4:93134759-93134781 CAGAACAAAATGAAGGAAGTTGG + Intronic
977507040 4:97915667-97915689 CAGAGCAAAATGACGGAGGCAGG + Intronic
977786599 4:101042338-101042360 CAGGGCAGAGGGAAGGTGGGAGG - Intronic
978001411 4:103558969-103558991 CAGAGCAAAGTGTAGGAGGACGG + Intergenic
978314224 4:107418001-107418023 TAGAGGAAGGTGCAGGTGGTGGG - Intergenic
978331545 4:107618571-107618593 AAGAGGAAACAGAAGGTGGTGGG + Intronic
978686346 4:111449384-111449406 CAGAGCAAAGTAAAAGCAGTTGG - Intergenic
978974579 4:114854106-114854128 GGAAGCAAAGTGGAGGTGGTAGG - Intronic
979193177 4:117888709-117888731 TAGTGCAATGTGAAGCTGGTTGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980583177 4:134780689-134780711 CAGAGCAAATTGTAAGTTGTGGG - Intergenic
986162250 5:5240604-5240626 CACAGCAAGGTGTAGGTGGATGG - Intronic
986572592 5:9181069-9181091 CAAAGCTAAGTGAAGGTGACAGG + Intronic
986624131 5:9707453-9707475 CAGAGCAAAGTGCTGATGTTGGG + Intronic
986672218 5:10152439-10152461 CAGGGCAAAGGGTAGGTTGTGGG - Intergenic
987490768 5:18578047-18578069 GAGAGAAAAGAGAAGGTAGTAGG + Intergenic
987872680 5:23641059-23641081 AAGTGCAGAGTGAAGGTGGCCGG - Intergenic
988450125 5:31333769-31333791 AAGTGCAGAGTGAAGGTGGGGGG - Intergenic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
989499079 5:42144801-42144823 CTGAACACAGTGAAGCTGGTAGG + Intergenic
991153032 5:63394633-63394655 GAAAACAATGTGAAGGTGGTAGG + Intergenic
991601344 5:68354459-68354481 CAGAGGGATGTGAAGGTGGCGGG - Intergenic
992519512 5:77536019-77536041 CAAAGAAAATTGAAGGTGATTGG + Intronic
994738945 5:103594395-103594417 CAGAGCACAGTGAAAGAGTTTGG - Intergenic
995676514 5:114668510-114668532 CAGAAAGAAGTGAAGGTGGTGGG - Intergenic
999259896 5:150231760-150231782 CATGGCAAAGCAAAGGTGGTAGG - Intronic
999588316 5:153116086-153116108 GAGAGGAAAGTGAAGGTGAAAGG - Intergenic
999992675 5:157063705-157063727 AAGAGCAGGGTGAAGGTGGTTGG + Intergenic
1001954198 5:175837210-175837232 CAGAGCTAAGTGAAGGTCAGGGG - Intronic
1005631597 6:27713276-27713298 CAGAGAAAAGTGAAGACGGGTGG + Intergenic
1005897622 6:30191540-30191562 GAGAGCAGAGTGAAGGGGGATGG + Intronic
1006152669 6:31997720-31997742 AAGATCAATGTGAAGGTGGGAGG + Exonic
1006158977 6:32030457-32030479 AAGATCAATGTGAAGGTGGGAGG + Exonic
1007491580 6:42227104-42227126 CAGAGCAAAGTCATGGAGGTTGG + Exonic
1007492206 6:42232241-42232263 CAGAAGTAAGCGAAGGTGGTAGG + Intronic
1007934783 6:45723317-45723339 CACAGCAAAGTGGAGCTGCTGGG - Intergenic
1008045739 6:46849588-46849610 CAGAGCCAAGTGAAGGATGCCGG - Intergenic
1008408999 6:51151081-51151103 CAAAGAAATGTGAGGGTGGTAGG - Intergenic
1008420481 6:51293543-51293565 CAGAGTCAAGTGAAAGTGTTAGG - Intergenic
1009397453 6:63215834-63215856 CAGAGCAAAGTGCTGGGGGCTGG - Intergenic
1009516220 6:64621875-64621897 AAGAGCAAATTGAAAGTGATAGG - Intronic
1010085316 6:71910565-71910587 CAGAACACAGTGAAGGGAGTAGG - Intronic
1011519978 6:88194533-88194555 CAGGGCAAGCTGAAGGTGCTGGG + Intergenic
1012967972 6:105695940-105695962 CAGAGTGGAGTAAAGGTGGTTGG + Intergenic
1014545698 6:122733045-122733067 CAGGGAAAAAAGAAGGTGGTGGG - Intergenic
1014645547 6:123968236-123968258 GAGAGCAAAGAGAAAGAGGTGGG + Intronic
1016262287 6:142186638-142186660 CAGAGGAAAGGAGAGGTGGTAGG + Intronic
1016547927 6:145245211-145245233 CAGAGCACAGTAGAGCTGGTTGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1021613920 7:22483010-22483032 CAGAGCAAACCAAAGTTGGTGGG - Intronic
1021706001 7:23368512-23368534 CTGAGGAAAGTGAAAGTGGAGGG + Intronic
1023272490 7:38479608-38479630 CAGTGCAAAGGAAAGGAGGTGGG + Intronic
1023578115 7:41651887-41651909 GAGAGCAAAATGAAGGTGGTGGG - Intergenic
1024178472 7:46864085-46864107 CAGGGCACAGTGAAGGTGGAGGG - Intergenic
1025248653 7:57337085-57337107 CAGATGAAAGTGCAGGTGGGTGG - Intergenic
1025610594 7:63072897-63072919 CAGGGCAGAGTGGAGTTGGTGGG - Intergenic
1026367647 7:69665220-69665242 CAGAGCAAAGTGAAAGGCTTAGG - Intronic
1026374749 7:69739141-69739163 GGGAGGGAAGTGAAGGTGGTGGG - Intronic
1026738054 7:72961294-72961316 TACAGGAAAGTGAAGGTGGCCGG + Intronic
1026789091 7:73320091-73320113 TACAGGAAAGTGAAGGTGGCCGG + Intronic
1027105680 7:75403774-75403796 TACAGGAAAGTGAAGGTGGCCGG - Intronic
1027441997 7:78229413-78229435 CCTTGCAAAGTGAAGGTGTTGGG - Intronic
1027753968 7:82186475-82186497 CAGAGCAAAGTTAAGGTTGCAGG + Intronic
1028334029 7:89629083-89629105 TAGAGGAAGGTGCAGGTGGTGGG - Intergenic
1030395444 7:108980822-108980844 GAGAGAATGGTGAAGGTGGTGGG - Intergenic
1032923796 7:136578710-136578732 AAGAACAAAATGAAGTTGGTTGG - Intergenic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034552462 7:151830306-151830328 CACAGCACAGTGCAGGTGGCGGG - Intronic
1034753522 7:153592745-153592767 CAGAGAAGTGTGAAGGTGCTGGG + Intergenic
1034932028 7:155170105-155170127 AAAAGTAAAGTGAAAGTGGTGGG + Intergenic
1036286997 8:7451636-7451658 GACAGCAAAGTGAAGAAGGTGGG + Intronic
1036334484 8:7859885-7859907 GACAGCAAAGTGAAGAAGGTGGG - Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036931984 8:12965351-12965373 CAGAGCATAGAGATGGTGGCAGG + Intronic
1037146885 8:15582881-15582903 AAGAACAAAGAGAAGGTTGTAGG - Intronic
1037415012 8:18640518-18640540 GAGAGCCAAGTGAAGGTGAAGGG - Intronic
1037611541 8:20480390-20480412 CAGATCAAAGGGAAGGAGGATGG + Intergenic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038447253 8:27612707-27612729 CCGAGCAAAGGAAAGGAGGTCGG - Intronic
1041280468 8:56205733-56205755 CCTAGCAATGTGAAGGTGTTAGG - Intronic
1042982785 8:74549161-74549183 CAGATCAAGGTGAAAGGGGTGGG + Intergenic
1043339294 8:79218183-79218205 TAGAGCAAAGTGATGATGGGAGG + Intergenic
1043585236 8:81760902-81760924 GAGAGCAAAGTGGTGGTGGGGGG + Intergenic
1044017287 8:87059590-87059612 AAGTGCAGAGTGAAGGAGGTTGG + Intronic
1044767862 8:95596294-95596316 CACAGCAAAGGTAGGGTGGTGGG + Intergenic
1045640172 8:104241074-104241096 CAGAGCACAGTGAAGGAGTCAGG - Intronic
1047254838 8:123207149-123207171 CAGAGCCAGGTGAAGCTGGAGGG - Exonic
1049176810 8:141197757-141197779 AAGAGCAAAGTGGAGGTTGCGGG + Intergenic
1049301441 8:141872706-141872728 CAGAGGCAGGTGAGGGTGGTGGG + Intergenic
1051079205 9:13277140-13277162 CAGAGCAATGTCTAGGTGATAGG + Intronic
1051610325 9:18955745-18955767 CAGAGAAAAGTGAGAGTGGCAGG - Intronic
1051668565 9:19488235-19488257 CAGAACAAGGGGAAGCTGGTGGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052299474 9:26937176-26937198 AAGAGGAAAATGAAGGTGTTAGG - Intronic
1053278556 9:36801476-36801498 AAGAGCAAAGAGAAGATGGAAGG + Intergenic
1053651834 9:40177120-40177142 CAGAGCCAAGTGAAGGATGCCGG + Intergenic
1054959122 9:70947630-70947652 CAGAGCTCAGAGAAGGTGGGGGG + Intronic
1056335059 9:85560171-85560193 CTTAGCAAAGTGAAGGAAGTTGG - Intronic
1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG + Intergenic
1056984222 9:91346436-91346458 TAGAGCAAAGTTAGGGTGGAGGG - Intronic
1058265473 9:102893645-102893667 AAAAGCAAAATGAAGATGGTGGG - Intergenic
1059165704 9:112074494-112074516 CAGAGGACAGTGAAGGTTCTAGG - Intronic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1059726961 9:117018255-117018277 GGGAGCATAGTGAAGCTGGTGGG - Intronic
1060531976 9:124353048-124353070 CAGAGCTGTGTGAAGGTGGGTGG - Exonic
1061004783 9:127922258-127922280 CTGAGAAAAGTGAAAGTGTTGGG + Intronic
1061255876 9:129454032-129454054 CAGAGGAAAGGGCAGGTGGTTGG + Intergenic
1061746105 9:132741329-132741351 CAGTGCCCAGTGAAGATGGTGGG - Intronic
1203521866 Un_GL000213v1:53097-53119 CTGAGCACAGTGCAGGTGCTGGG - Intergenic
1185954321 X:4472740-4472762 CAGAGGAAACTGCAGGTGCTGGG - Intergenic
1189880577 X:45487249-45487271 CCCAGCAAAGTGATGGGGGTGGG + Intergenic
1192084719 X:68084823-68084845 CAGAGCTCAGAGAAGGTGCTTGG + Intronic
1192478129 X:71461265-71461287 CAGAGCAAATGGAAGTTGTTGGG + Intronic
1197571465 X:128156047-128156069 CAGAGCAAAGTAAAGGTGAGTGG + Intergenic
1198875153 X:141216742-141216764 CAGGACAAAGGGAAGGTGGTTGG + Intergenic
1199265077 X:145819107-145819129 GAGAGAAAGGTGGAGGTGGTTGG - Exonic
1200277489 X:154748391-154748413 GAGAGCAAAGGGAAGGTAGCGGG + Intronic