ID: 1156473541

View in Genome Browser
Species Human (GRCh38)
Location 18:37392019-37392041
Sequence GGTTCTGGTGACCCAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156473541_1156473545 -4 Left 1156473541 18:37392019-37392041 CCTGCAACTGGGTCACCAGAACC No data
Right 1156473545 18:37392038-37392060 AACCGAATTCAGGGAGACCCTGG No data
1156473541_1156473548 -2 Left 1156473541 18:37392019-37392041 CCTGCAACTGGGTCACCAGAACC No data
Right 1156473548 18:37392040-37392062 CCGAATTCAGGGAGACCCTGGGG No data
1156473541_1156473549 -1 Left 1156473541 18:37392019-37392041 CCTGCAACTGGGTCACCAGAACC No data
Right 1156473549 18:37392041-37392063 CGAATTCAGGGAGACCCTGGGGG No data
1156473541_1156473546 -3 Left 1156473541 18:37392019-37392041 CCTGCAACTGGGTCACCAGAACC No data
Right 1156473546 18:37392039-37392061 ACCGAATTCAGGGAGACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156473541 Original CRISPR GGTTCTGGTGACCCAGTTGC AGG (reversed) Intronic