ID: 1156473963

View in Genome Browser
Species Human (GRCh38)
Location 18:37394262-37394284
Sequence CAGAGCAGGGAGAGGGACGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 746
Summary {0: 1, 1: 0, 2: 5, 3: 84, 4: 656}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156473944_1156473963 27 Left 1156473944 18:37394212-37394234 CCTCCCACTCTGGACAGGCGCGA 0: 1
1: 0
2: 1
3: 2
4: 63
Right 1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG 0: 1
1: 0
2: 5
3: 84
4: 656
1156473948_1156473963 23 Left 1156473948 18:37394216-37394238 CCACTCTGGACAGGCGCGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG 0: 1
1: 0
2: 5
3: 84
4: 656
1156473946_1156473963 24 Left 1156473946 18:37394215-37394237 CCCACTCTGGACAGGCGCGAGGG 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG 0: 1
1: 0
2: 5
3: 84
4: 656
1156473943_1156473963 30 Left 1156473943 18:37394209-37394231 CCACCTCCCACTCTGGACAGGCG 0: 1
1: 0
2: 0
3: 18
4: 182
Right 1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG 0: 1
1: 0
2: 5
3: 84
4: 656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156473963 Original CRISPR CAGAGCAGGGAGAGGGACGC GGG Intronic
900214858 1:1475958-1475980 CAGAGCAGTGACAGGAACGTGGG - Intronic
900222071 1:1514312-1514334 CAGAGCAGTGACAGGAACGTGGG - Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900420507 1:2554100-2554122 ACCAGCAGGGAGAGGGAGGCAGG - Intergenic
900484433 1:2914719-2914741 CAGAGCAGGATGAGGGAGGCTGG + Intergenic
900484441 1:2914750-2914772 CAGAGCAGGATGGGGGAAGCTGG + Intergenic
900519306 1:3098036-3098058 CAAAGGAGGGAGAGGGGCGGGGG - Intronic
900622763 1:3594944-3594966 CAGGGCAGGGAGAGGGACTCAGG + Intronic
900653870 1:3745398-3745420 CTGAGTCGGGAGAGGGAGGCTGG - Intergenic
900735079 1:4294653-4294675 CAGGGCAGGGCCAGGGACACTGG - Intergenic
900972859 1:6001075-6001097 CACTGCAGGGAGAGGGACAAGGG + Intronic
901643816 1:10706171-10706193 CCGTGCAGGGAGAGGGACGATGG + Intronic
901805559 1:11736396-11736418 CACAGCAGGGAGAGTGATCCAGG + Intronic
902571327 1:17348806-17348828 GAAAGCAGGGAGAGGGAGGCAGG - Intronic
902609392 1:17588289-17588311 CAGGGCTGGGGGAGGGAGGCGGG + Intronic
902614489 1:17616371-17616393 CAGAGGAGGGGGAGGCACACTGG - Intronic
902869854 1:19307409-19307431 CCCTGCAGGGAGAGGGACCCCGG + Exonic
903034693 1:20486156-20486178 CAGAGGGGGGAGAGGGAGGCAGG + Exonic
903283586 1:22263789-22263811 CAGAACAGGGGCAGGGACACGGG + Intergenic
903352622 1:22727168-22727190 CAGAGCAGGGAGAGGCAAGCTGG + Intronic
903372996 1:22848868-22848890 CAAGGCAGGGAGAGAGAGGCAGG + Intronic
903536275 1:24068384-24068406 CAGAACAGGGAAAAGGACTCTGG - Intronic
904001757 1:27342801-27342823 CAGGGCACAGAGAGGGACGTGGG + Intronic
904163153 1:28536064-28536086 CAGAGCCAGGACAGGAACGCAGG - Intronic
904190298 1:28737707-28737729 CTGAGCCGGGAGGGGGACGCGGG + Intronic
904236841 1:29122096-29122118 GAGAGGAGGGAGGGGGGCGCAGG + Intronic
904819226 1:33229819-33229841 GAGAGCAGAGGGAGGGACGCGGG - Intergenic
905015669 1:34776975-34776997 CAGATCAGGCAGAGGGATGGGGG - Intronic
905025467 1:34846521-34846543 CAGAGCAGGGACAGTGAGACAGG + Intronic
905202723 1:36324603-36324625 CCGGACAGGGAGAGGGTCGCTGG - Intronic
905470072 1:38185168-38185190 CAGAGCTGGGAGTGGAACACAGG + Intergenic
905498997 1:38420925-38420947 CAGAGCAGCGGGAGGGATGTGGG + Intergenic
905670367 1:39787238-39787260 GAGAGGAGGGAGAGGGTCCCTGG - Intronic
907542872 1:55232656-55232678 CAGATCCTGGAGAGGGACTCTGG + Intergenic
907816102 1:57919562-57919584 CAGAGCAAGGATAGGAACCCAGG - Intronic
908810871 1:67981189-67981211 CAGAGCAGAGAATGGGAGGCAGG + Intergenic
909456404 1:75854576-75854598 CAGAGCAGGGAGAGGACGGACGG - Intronic
909465016 1:75963862-75963884 CACACCAGGGAGTGGGAAGCTGG - Intergenic
911086111 1:93978703-93978725 CAGAGCAGAGGGAGGGGTGCTGG - Intergenic
911208618 1:95117551-95117573 CCGAGCCGGGAGAGGGCGGCGGG - Exonic
912948816 1:114106582-114106604 CAGAGAAGGGAGAGAGCAGCAGG - Intronic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915268480 1:154735211-154735233 CAAAGCTGGGACAGAGACGCAGG + Intronic
915530506 1:156500061-156500083 GAGAGGAGGGAGAGGGAGGGAGG + Intronic
915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG + Intergenic
915730049 1:158046893-158046915 CAGAGCATGGAGGGGGTTGCTGG + Intronic
915941380 1:160120677-160120699 CAGAGAAGGGTGAGGGGCTCAGG - Intronic
916786113 1:168088254-168088276 CAGAGCAGGCAGAGGGAATGGGG + Intronic
917968524 1:180193377-180193399 CAGAGGAGAGAGAGAGAGGCAGG + Intronic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918520428 1:185408783-185408805 CTGTGCAGGGAGAGAGACTCTGG - Intergenic
919894804 1:202002879-202002901 CAGAGCAGGGGTAGGAACCCAGG + Intronic
920182888 1:204143430-204143452 CAGAGCAGGGAGGGAGGCCCCGG - Intronic
920632815 1:207669319-207669341 CAGAGCATGGGGAGGGCTGCGGG - Intronic
922095603 1:222440503-222440525 AAGAGGAGGGAGAGGGAAGGAGG + Intergenic
922369697 1:224896837-224896859 CACATCAGGGAGAGAGACGTGGG + Intronic
922408115 1:225339895-225339917 CAGAGGAGGAAGAGGGAAGCTGG - Intronic
922663147 1:227447561-227447583 CAGAGCAGGGAGAAAGGCCCCGG + Intergenic
922796297 1:228341394-228341416 CAGCACAGGGAGGGGGACACGGG - Intronic
923010360 1:230083374-230083396 CGGAGCAGGGAGTGGGATGATGG + Intronic
923116011 1:230938525-230938547 CAGAGGAGGTAGAGGGAAACAGG - Intronic
923142698 1:231174593-231174615 CAGAGAAGGGAGAGGGAGAGGGG - Intronic
923198499 1:231690322-231690344 CTGAGCAGGGAAAGGGAGCCTGG - Intronic
924425259 1:243944458-243944480 CAGAGGAGGGAGTGGGGCACAGG + Intergenic
924502464 1:244650563-244650585 CAAAGAAGGGAGAGGGATCCAGG - Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063067412 10:2623750-2623772 CATGACAGGGAGAGGGAAGCAGG + Intergenic
1063451133 10:6151097-6151119 GACAGCAGGGAGACGGACACAGG + Intronic
1063502689 10:6569521-6569543 AAGAGCAGGGAGTGGCACACTGG + Intronic
1064113326 10:12557004-12557026 GAGAGCAGGGAGGGAGACGGAGG + Intronic
1064192785 10:13222181-13222203 CAGAGCAGGAAGAGAGGAGCCGG - Exonic
1064331848 10:14401592-14401614 CTGAGCATGGAGAGGGAGGAGGG - Intronic
1065070143 10:22015005-22015027 CAGTGCAGGGAGAGGAAGGCTGG - Intergenic
1065900294 10:30200207-30200229 GAGAGCAGTGGGAGGGACCCAGG + Intergenic
1065916036 10:30355706-30355728 CAGAGCTGGGACATGAACGCAGG + Intronic
1066367450 10:34791305-34791327 TGGAGCATCGAGAGGGACGCAGG - Intronic
1067781694 10:49212412-49212434 GGGAGTAGGGAGAGGGAGGCAGG - Intergenic
1069622674 10:69847493-69847515 CAGAGTAGGGAGAGAGATGAGGG - Intronic
1069709192 10:70478369-70478391 CAGAGGGGGGCGAGGGAAGCCGG + Intergenic
1069773928 10:70916009-70916031 CGGGTCAGGGAGAGGGAGGCTGG + Intergenic
1070406308 10:76100499-76100521 CAGATAAGGGAGAGGGTCCCTGG - Intronic
1070662419 10:78316787-78316809 CAGGGCAGGCAGAGGGAACCAGG + Intergenic
1070797933 10:79227944-79227966 GAGAGCTGGCAGAGGGAGGCTGG + Intronic
1070829076 10:79407752-79407774 CAGAGCTGGGAGTGGAGCGCAGG + Intronic
1072415245 10:95241776-95241798 CAGGGAAGGGAGAGGCACTCTGG - Intronic
1072614091 10:97038068-97038090 CAGAGCAGGGAGGGGAAGGCAGG - Intronic
1073207866 10:101778272-101778294 CAGAGCAGGGAGTAGGCCCCAGG + Intronic
1073381371 10:103080292-103080314 CAGAGCAGGCAGAGTGTCCCAGG - Exonic
1073441287 10:103554178-103554200 CAGAGGGGGAAGAGGGAGGCTGG - Intronic
1074472522 10:113740525-113740547 CAGAGCAGGGTGCTGGAAGCAGG + Intergenic
1075257202 10:120934725-120934747 CAAAGCAGGCAGAGGGAGGGGGG - Intergenic
1075445668 10:122511016-122511038 CAGAGCAGGGACAGGAACCCAGG - Intronic
1075727313 10:124617202-124617224 CGGAGCAGGCAGGGGGACGTCGG - Exonic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076371601 10:129959293-129959315 GAGGGCAGGGCGAGGGAGGCCGG + Intronic
1076445205 10:130509579-130509601 CAGAGCTGGGAGAGGGCAGAGGG + Intergenic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1076564095 10:131386494-131386516 AGGAGCAGGGAGAGGGACTGAGG + Intergenic
1076564134 10:131386662-131386684 AGGAGCAGGGAGAGGGATTCAGG + Intergenic
1076743825 10:132502640-132502662 CAGAGGAGGGAGAGCAAGGCTGG - Intergenic
1076912603 10:133399243-133399265 CAGAGCTGGGAGTGGGAGGCGGG + Intronic
1077078045 11:710058-710080 GAGGGCAGGGAGAGTGAAGCTGG + Intronic
1077212905 11:1381794-1381816 CAGAGCAGCGGGAGGAAAGCAGG - Intergenic
1077283551 11:1756172-1756194 CAGGTCAGGGAGGGGGACACAGG - Intronic
1077336302 11:2006349-2006371 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1078922350 11:15842385-15842407 CAAAGCAGGGAGGGGGAAGGAGG + Intergenic
1080552246 11:33382809-33382831 CAGGGCAGGGAGAGGGTGCCAGG - Intergenic
1081586086 11:44384841-44384863 CAGAGCTGGGAGTGGTACCCAGG - Intergenic
1081651643 11:44827823-44827845 CAGAGAAAGGAGAGGGACATGGG + Intronic
1082835820 11:57649508-57649530 CAGAGCTTGGAGAGGGATGGAGG + Exonic
1083253794 11:61484452-61484474 TAGAGCAGGGTGAGGCACTCAGG + Intronic
1083535922 11:63466557-63466579 GAGAGCAGGGAGTGAGGCGCAGG - Intronic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083676671 11:64329734-64329756 CAGGGCAGGGACAGGGAGCCAGG + Intergenic
1083683329 11:64361288-64361310 CAGAGCAGGAAGAGGCAGGAAGG - Intronic
1083862567 11:65430266-65430288 CAGAAAAGGGAGAGGGGCCCAGG - Intergenic
1083871260 11:65489841-65489863 CAGAGTAGGGAAAGGAAGGCCGG - Intergenic
1084446287 11:69205467-69205489 CTGCGCAGGGAGAAGGACCCCGG + Intergenic
1084475591 11:69386908-69386930 AGGAGCAGGGACAGGGATGCAGG - Intergenic
1084583843 11:70042342-70042364 CAGCACAGGGAGAGGAACTCAGG + Intergenic
1084617719 11:70247504-70247526 CAGAGTGGGGAGAGGGCCCCTGG - Intergenic
1085256475 11:75176358-75176380 CAGAGCCTGGAGAGGGACAGGGG - Intronic
1085276856 11:75306129-75306151 CAGAGCAGGGATGGGGAGTCAGG - Intronic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1085296228 11:75433251-75433273 GCGAGCAGGGAGGGGGATGCTGG + Intergenic
1085458798 11:76680895-76680917 CCCAGCAGGGAGAGGGAGGAGGG - Intergenic
1085523688 11:77152457-77152479 CAGAGCAGGGTGAGGCACTCAGG + Intronic
1085524258 11:77155125-77155147 CAGAGCAGGGTGAGGCACTCAGG - Intronic
1085651735 11:78274376-78274398 CAAACCAGGGACAGGGACACTGG + Intronic
1086076897 11:82864406-82864428 CAGAACAGGGAGTGGCACGTGGG - Intronic
1087696478 11:101382775-101382797 CAGAGAAGCGAAAGGGAAGCAGG - Intergenic
1087831140 11:102820880-102820902 CAGAGAAGGCAGAGGGATGGGGG - Intergenic
1088521950 11:110711253-110711275 CAAAGCTGGGAGAGGGATGCAGG - Intronic
1088549109 11:110992343-110992365 CAGAGCTGGGAGAAGAACCCAGG - Intergenic
1089155439 11:116398601-116398623 CAGAGCAGTGGCAGGCACGCAGG - Intergenic
1089399546 11:118156547-118156569 AAGAGGAGGGAGAGGGAGGCAGG - Intergenic
1089729589 11:120511913-120511935 CAGCGCAGGGAGCGGGCCGGGGG - Intronic
1090024725 11:123157803-123157825 CGGAGCAGAGACCGGGACGCTGG + Intronic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1091050003 11:132358834-132358856 AAGAGAAGAGAGAGGGACGGGGG - Intergenic
1091207718 11:133832928-133832950 CTGGGCTGGGAGGGGGACGCGGG + Intergenic
1091234125 11:134008381-134008403 CAGAGCAGGGAGAGGAGAGGTGG - Intergenic
1091277858 11:134364485-134364507 CAGCGCAGGGAGCTGGACTCAGG + Intronic
1202819286 11_KI270721v1_random:61531-61553 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1091513506 12:1153984-1154006 CAGAGCAGGGGGAGGCAGGCAGG - Intronic
1091616482 12:2054003-2054025 CCGAGCCGGGCGAGGGACCCCGG - Intronic
1091681991 12:2533777-2533799 CAGAACCGGGACAGGGACGCAGG - Intronic
1091992866 12:4970830-4970852 CAGAGCAGGGACAGAGAATCAGG + Intergenic
1092195660 12:6548342-6548364 CAGAGCAAGGAGAGGAGCGGGGG + Intronic
1092204878 12:6608566-6608588 CAGAGCAGGGAGGGCCAGGCAGG + Intergenic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092726737 12:11493963-11493985 CAGAGCAGGGAGGGAGTGGCAGG - Intronic
1094372258 12:29751318-29751340 AAGAGCAGAGAGAGAGAGGCAGG + Intronic
1096521576 12:52187488-52187510 CAGAGCAGAGAGAGAGGGGCTGG - Intronic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096557243 12:52410920-52410942 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1096598503 12:52713591-52713613 CTGAGCTGGGAGGGGGACCCTGG - Intergenic
1096870815 12:54590940-54590962 GAGAGGAGGGAGAGGGAAGAGGG + Intergenic
1097051174 12:56224256-56224278 CAGGGCAGGCGGCGGGACGCAGG + Intronic
1097694730 12:62765127-62765149 CAGAGCTGAGAGAGGGAACCAGG + Intronic
1097981672 12:65742334-65742356 CCGGGCAGGGGCAGGGACGCTGG - Intergenic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1100461104 12:94800141-94800163 TAGAGCAGGGAAGGGGACACAGG - Intergenic
1101396786 12:104355819-104355841 CAGAACAGGGAGAGAGGGGCAGG + Intergenic
1101405762 12:104427313-104427335 CAGAGCAGAGAGACGGAGTCTGG + Intergenic
1101594226 12:106149471-106149493 CAGGGCAGGGAGAAGGAAGGCGG + Intergenic
1101856531 12:108448161-108448183 AAGAGCAAGGAGTGGGAGGCAGG - Intergenic
1102394521 12:112575037-112575059 AAGAGGAGGGAGAGGGGCGATGG + Intronic
1102819365 12:115894848-115894870 CTGAGCAAAGAGAGGGAAGCAGG + Intergenic
1102904450 12:116663332-116663354 CAGAGCAGGGAGAGGTGGGGAGG - Intergenic
1103003994 12:117407444-117407466 CAGAGGAGGGAGAGGCAGGTGGG - Intronic
1103047612 12:117750641-117750663 GAGAGAAGGGAGAGGGACAAAGG - Intronic
1103561457 12:121795142-121795164 CAGAGCTGGGAAGGGGAGGCCGG + Intronic
1103986583 12:124771630-124771652 CAGAGCAGGGAGTAGCACGCAGG + Intergenic
1104845748 12:131845959-131845981 CCGACCAGGGAGAGGCAGGCCGG - Intronic
1104939425 12:132387906-132387928 CAGAGAGGGGAGAGAGATGCGGG + Intergenic
1104982328 12:132579047-132579069 CAGAGGAGGGAAGGGGAGGCGGG - Intronic
1105005627 12:132718939-132718961 CAGAGCAGGTTGAGGGACAAGGG - Intronic
1105205230 13:18217730-18217752 CAGAGCAGGGAGATGGGCCCTGG - Intergenic
1105859374 13:24395407-24395429 CAGAGCAGGGACAGGGAATGAGG - Intergenic
1105880942 13:24606457-24606479 GACAGCAGGGATAGGGACCCCGG + Intergenic
1111975495 13:94962693-94962715 CAGATGAGGGAGGGGGACCCTGG + Intergenic
1113527549 13:110992373-110992395 CAGAGCAGGGATGGGGGAGCGGG - Intergenic
1114484115 14:23053026-23053048 CAGAGCTGTGACAGGGATGCTGG + Intronic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1114941993 14:27623979-27624001 TAGAGCAGGGAGGGGGACTCTGG + Intergenic
1114946504 14:27688350-27688372 AGGAGCAGGGACAGGGACGGTGG + Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115936832 14:38561548-38561570 TAGAGCAGGGAGAGAGTTGCTGG + Intergenic
1116060034 14:39911868-39911890 GAGAGAAGAGAGAGGGACACAGG - Intergenic
1118153129 14:63211155-63211177 CAGAGCAGGGAGTGGGAAACAGG + Intronic
1118347884 14:64952808-64952830 CAGAGGAGGGAGAGTGAATCTGG + Intronic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118697134 14:68396077-68396099 CAGAGCAGGGACACGGGCACCGG + Intronic
1118766019 14:68909770-68909792 CACTGCAGGGAGAGAGACGGGGG + Intronic
1118903858 14:70008959-70008981 CTGAGCAGGGAGAGGGGCCTTGG - Intronic
1119172900 14:72547993-72548015 GTGAGCAGGGGGAGGGAGGCAGG - Intronic
1119369610 14:74128193-74128215 TGGTGCAGGGAGAGGGACCCAGG + Intronic
1119585739 14:75833132-75833154 AAGCACAGGGAGAGGAACGCAGG - Intronic
1120546707 14:85820575-85820597 GAGAGCAGGGAGAAGGCCACTGG + Intergenic
1121473043 14:94171474-94171496 CAGAGCCAGGACAGGGACTCAGG + Intronic
1121637184 14:95461822-95461844 CAGAGCAGGGACTGGGAGGCTGG + Intronic
1121780048 14:96616427-96616449 CAGAGCAGGGAGAGGCAAGGAGG + Intergenic
1122117513 14:99535251-99535273 AAAAGCAGGGAGAGGGAGACTGG + Intronic
1122271978 14:100572411-100572433 CAGAGCTGGGACAGGAACCCAGG - Intronic
1122279180 14:100611061-100611083 GAGGGCTGGGAGAGGGAGGCTGG - Intergenic
1122295054 14:100700812-100700834 CATAGCAAGTAGAGGGAGGCTGG + Intergenic
1122627068 14:103090218-103090240 CAAAGCAGAGAGAGGGTCCCTGG - Intergenic
1122786597 14:104166983-104167005 CTGAGCAGGCAGGGGGGCGCCGG - Exonic
1122847194 14:104506426-104506448 CAGAGCAGGGACAGGGAACGAGG - Intronic
1122855780 14:104559486-104559508 CAGACCAGGAAGAGGGACAAAGG - Intronic
1122873073 14:104650430-104650452 AGGGGCAGGGAGAGGGAAGCGGG - Intergenic
1122987017 14:105217188-105217210 CAGAGCAGGCACAGGGCGGCAGG + Intronic
1123472565 15:20566026-20566048 CAGAGCAGGAAGTGGTAGGCAGG - Intergenic
1123645438 15:22434327-22434349 CAGAGCAGGAAGTGGTAGGCAGG + Intergenic
1123732870 15:23161017-23161039 CAGAGCAGGAAGTGGTAGGCAGG - Intergenic
1123751003 15:23358394-23358416 CAGAGCAGGAAGTGGTAGGCAGG - Intronic
1123758274 15:23413899-23413921 CAGAGCTGGGAGAAGGTCTCAGG + Intergenic
1124100837 15:26691145-26691167 CAGAGCAGGGAGAGCAAGACTGG - Intronic
1124283376 15:28382312-28382334 CAGAGCAGGAAGTGGTAGGCAGG - Intronic
1124299322 15:28529301-28529323 CAGAGCAGGAAGTGGTAGGCAGG + Intronic
1124365258 15:29066550-29066572 GAGAGCAGGGAGTGGGGAGCTGG + Intronic
1124963151 15:34413028-34413050 GAGAGCAGGGAGTGGGGAGCTGG + Intronic
1124979774 15:34559254-34559276 GAGAGCAGGGAGTGGGGAGCTGG + Intronic
1125513787 15:40306938-40306960 CACAGCAGAGAGAGGGCTGCAGG + Intronic
1125592142 15:40861331-40861353 CAGCACAGGGAGAGGGACAGAGG + Intergenic
1126156611 15:45571169-45571191 CAGAGCAGGGAAGGTGACGGTGG + Intergenic
1126192691 15:45895183-45895205 CAGAGCAGGGAGATAGAACCAGG - Intergenic
1127070572 15:55284756-55284778 CAGAGCTGGAAGTGGGACTCTGG - Intronic
1127530516 15:59839164-59839186 CAGAGCAGTGTGAAGGAAGCTGG - Intergenic
1127724663 15:61737308-61737330 CAGCCCAGAGAGAGGGAGGCTGG - Intergenic
1127932617 15:63606970-63606992 CAGCTCAGCAAGAGGGACGCAGG + Intergenic
1128084451 15:64876194-64876216 CAGAGCAGTAAGAGGGAAGGAGG - Intronic
1128186083 15:65644545-65644567 GACAGCAGGGAGAGGGGGGCAGG - Intronic
1128577751 15:68787997-68788019 GAGAACAGGGAGACAGACGCAGG + Intronic
1129386706 15:75200472-75200494 CAGGGCAGGGACAGGGTCGCCGG + Intronic
1129517685 15:76166514-76166536 CAGAGCAGTGCCAGGGAAGCAGG - Intronic
1129712161 15:77825944-77825966 AAGAGCAGGGAGAGGGAGAGAGG + Intergenic
1129764153 15:78150285-78150307 CAGAGCAGGGAGAGGAACCTAGG + Intronic
1129771017 15:78203702-78203724 AAGAGCAGAGAGCGGGAGGCTGG + Intronic
1129852125 15:78799310-78799332 CAGAGCTGGGAGAGTGGGGCTGG + Intronic
1130250878 15:82299777-82299799 CAGAGCTGGGAGAGTGGGGCTGG - Intergenic
1130970199 15:88726377-88726399 CAGAGGAGGGTGAGGGCAGCGGG + Intergenic
1131078706 15:89515681-89515703 CAGCTCAGGGAGAGGTACTCAGG + Intergenic
1131294925 15:91139452-91139474 CAGAGCTGGGAAATGGAGGCAGG + Intronic
1131473229 15:92714299-92714321 GAGAGCGGGGAGAGGGGAGCGGG + Intronic
1131952484 15:97695587-97695609 CAGAGCAGGGAGAGCAAAACTGG + Intergenic
1132982050 16:2743250-2743272 CAGAGCAGGGAAAGTGCTGCTGG + Intergenic
1133170681 16:3980910-3980932 CAGAGCAGAGAGGGTGATGCAGG + Intronic
1134458064 16:14408995-14409017 CAGAGCTGGGAGAAGGTCTCAGG - Intergenic
1135542900 16:23345978-23346000 GAGAGAAGGGAGGGGGAAGCAGG + Intronic
1135770759 16:25216798-25216820 CAGGGCAGGGTGAGGGAGTCAGG - Intronic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136084357 16:27874019-27874041 CATAGCTGGGAGAGGGGAGCAGG + Intronic
1136284071 16:29231054-29231076 CGGAGCAGGGTGAGGGCCGATGG - Intergenic
1136540759 16:30926577-30926599 CAGAGTGGGGAGGGGGACGCAGG - Intronic
1136657558 16:31719559-31719581 CAGAGCAAGGCTAGGGACACGGG - Intronic
1136933382 16:34437414-34437436 CGGAGCAGGGACAGGGTCTCAGG + Intergenic
1136971190 16:34974400-34974422 CGGAGCAGGGACAGGGTCTCAGG - Intergenic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1138248026 16:55481144-55481166 CAGAGCAGGGAATGGGCTGCTGG + Intronic
1138415554 16:56869628-56869650 CAGAGAAGGGAGATGAACGTAGG + Intronic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138454935 16:57115764-57115786 CAGTGCAGGGAGGGGGCTGCTGG - Intronic
1138490093 16:57371742-57371764 CAAAGCAGGGAGCGGGAGACCGG + Intergenic
1139041499 16:63004460-63004482 CAGAGCAGGGAGAGGAAGGGGGG - Intergenic
1140400322 16:74666069-74666091 AAGAGGAGGGAGAGGGAGACGGG + Intronic
1140416689 16:74778675-74778697 AAGAGAAGGGAGAGGGAAGAGGG - Intergenic
1141283868 16:82653410-82653432 GAGAACAGAGAGAGGGACCCAGG + Intronic
1141700357 16:85639440-85639462 CAGCGCAGGGGGTGGGACACAGG - Intronic
1141998625 16:87650368-87650390 CAGAGGAGAGAGAGGGATGGGGG - Intronic
1142089103 16:88200562-88200584 CGGAGCAGGGTGAGGGCCGATGG - Intergenic
1142125994 16:88410994-88411016 AAGAGAAGGGAGACGGACGCAGG - Intergenic
1142181662 16:88674184-88674206 GAGAACAGCGAGAGGCACGCAGG + Intergenic
1142202902 16:88769661-88769683 CAGAGCAGGGAGAGGACCCCGGG + Intronic
1142253200 16:89002212-89002234 CAGAGCAGCCGGAGGGACGCAGG + Intergenic
1142253238 16:89002320-89002342 CAGAGGAGCCGGAGGGACGCAGG + Intergenic
1142253413 16:89002814-89002836 CAGAGGAGCCGGAGGGACGCAGG + Intergenic
1142253484 16:89003013-89003035 CAGAGGAGCCGGAGGGACGCAGG + Intergenic
1142253511 16:89003087-89003109 CAGAGGAGCCGGAGGGACGCAGG + Intergenic
1142324909 16:89408485-89408507 CAGAGCAGGGTGAGGGAATCTGG - Intronic
1142414225 16:89932693-89932715 CAGGGCTGGGATAGGGAGGCTGG - Intronic
1142958222 17:3535383-3535405 GAGAGGAGGGAGAGGGAGGAGGG - Intronic
1143090279 17:4445919-4445941 CAGAGTAGGGAGAGGGGATCGGG - Intronic
1143137696 17:4720874-4720896 GAGGGCAGGGAGTGGGAGGCTGG + Intronic
1143306316 17:5949872-5949894 ATGAGAAGGGAGAGGCACGCAGG - Intronic
1143319616 17:6059627-6059649 GGGAGCAGGGAGAGGAAGGCGGG + Intronic
1143377631 17:6476808-6476830 CAGGGCAGGGACAGGGAACCAGG + Intronic
1143563133 17:7706845-7706867 CAGAGAAGTGTGAGGGAGGCTGG - Intronic
1144107405 17:11998039-11998061 GAGAGAAGAGAGAGAGACGCAGG - Intergenic
1144500890 17:15786315-15786337 CAGAGCCGGGGGAGGGACGGGGG + Intergenic
1144501328 17:15787997-15788019 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1144702044 17:17346476-17346498 CAGGGCACGGAGAGGGAAGTCGG + Intronic
1145163052 17:20588977-20588999 CAGAGCCGGGGGAGGGACGGGGG + Intergenic
1145163503 17:20590671-20590693 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1145260734 17:21352910-21352932 CCAAACAGGGAGAGGGACACTGG - Intergenic
1145265576 17:21378182-21378204 CAGCGCAGCGCGAGGGAGGCTGG - Intronic
1145286062 17:21506687-21506709 GCGCGCAGGGAGAGGGACCCAGG - Intergenic
1145391544 17:22459604-22459626 ATGTGCAGGGAGAGGGACCCAGG + Intergenic
1145722893 17:27089694-27089716 CAGAGCAGTAAGAGGGTGGCCGG + Intergenic
1146138249 17:30342060-30342082 CAGAGCAGGGAGATCCAAGCTGG - Intergenic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1146464485 17:33075451-33075473 CAGAGCAGGGAGAGGAATCTGGG - Intronic
1146798509 17:35800036-35800058 CAGTGCAGAGAGAGGGAGGGAGG - Intronic
1146921835 17:36718364-36718386 CAGAGCAGGAAGAGCGAGGTTGG - Intergenic
1147044359 17:37742652-37742674 CAGGGCAGGGAGAGGGACTGGGG - Intronic
1147600219 17:41740523-41740545 CAGAGCCTGGACATGGACGCAGG - Intergenic
1147606006 17:41774031-41774053 CAGCTAAGGGAGAGGGAAGCGGG + Intronic
1147848062 17:43419250-43419272 GGCAGCAGAGAGAGGGACGCCGG + Intergenic
1148265906 17:46225475-46225497 CAGAAGGGGGAGAGGGATGCTGG + Intergenic
1148371118 17:47100393-47100415 CAGAAAGGGGAGAGGGAAGCTGG + Intergenic
1148874441 17:50678290-50678312 CTGAGCAGGGAGGGGCACTCGGG - Intronic
1149666791 17:58370631-58370653 CAGAGCAGGGGAAGGGACTCAGG + Intronic
1150621031 17:66807811-66807833 CTGAGAAGGGAGAGGGAGGCGGG + Exonic
1150636228 17:66915190-66915212 TGGGGCAGGGAGAGGGAGGCAGG + Intergenic
1150657242 17:67047408-67047430 CAGAGCTGGGAAAGGGAAACAGG - Intronic
1150731078 17:67694458-67694480 CTGAGCACTGAGAGGGAAGCAGG - Intronic
1151268821 17:72977634-72977656 AAGAGCAGAGAGAGGGACTAGGG + Intronic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151679045 17:75614372-75614394 CAGGCCAGGGAGAGGGGTGCTGG - Intergenic
1151970553 17:77455391-77455413 CAGAGCAGGGCGGGGGCAGCAGG - Intronic
1152228278 17:79102616-79102638 AGGAGCAGGGAGAGGGGCCCTGG - Intronic
1152722839 17:81931326-81931348 CAGAGCAAGACGAGGGGCGCGGG - Intergenic
1152822400 17:82444026-82444048 CAGAGCAGCGACAGTGAGGCCGG - Exonic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1153185479 18:2481477-2481499 CAGGGCCGGGAGTGGGAAGCTGG + Intergenic
1153456253 18:5285590-5285612 CAGAGCTGGGACAGGAAAGCAGG - Intergenic
1153711269 18:7802089-7802111 CAGAGAAGGGAGAGGGGAGAAGG - Intronic
1153987791 18:10368595-10368617 GAGAGCAGAGAGAGGGAGGAAGG + Intergenic
1154132941 18:11751816-11751838 CGGGGAAGGGAGAGGGAGGCTGG - Intronic
1154985536 18:21547202-21547224 CAGATCAGTGCGAGGGACGATGG - Intronic
1155100600 18:22606771-22606793 CTGGGCAGGGAGAGAGACACAGG + Intergenic
1155171143 18:23267586-23267608 CAGTGCAGGGAGTGGGCAGCCGG - Intronic
1156183994 18:34640263-34640285 CAGAGGAGGGACAGGCAGGCAGG - Intronic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1156482603 18:37445582-37445604 GGGAGCAGGGAGAGAGAGGCAGG + Intronic
1157128482 18:44980601-44980623 CAGAGGAGGGAGAGGCAGGGAGG + Intronic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1157308774 18:46536397-46536419 AAGTGCAGAGAGAGGGACACAGG + Intronic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1157799010 18:50603273-50603295 CACACCAGGGAGATGGAAGCTGG - Intronic
1158434598 18:57427525-57427547 TAGGGCAGGGAGAGGGGCGTTGG + Intergenic
1159866172 18:73707895-73707917 CAGAGCAGGAAGAGAGAGGGAGG + Intergenic
1160011519 18:75110061-75110083 GGGAGGAGGGAGAGGGAGGCTGG + Intergenic
1160318333 18:77868243-77868265 AAGAGCAGGGAGAGGGACAATGG + Intergenic
1160391954 18:78540611-78540633 CAGAGCAGAGAGAGGGGCCAGGG + Intergenic
1160570535 18:79814581-79814603 CAGAGCTGGGAGGGGGTGGCAGG + Intergenic
1160685050 19:430755-430777 CAGAGCAGTGAGAGGTTCCCCGG + Intronic
1160723726 19:608564-608586 CAGAGCCTGGAGATGGACGTGGG + Intronic
1160961097 19:1721203-1721225 CAGAGCCAGGAGAGGGGCACGGG + Intergenic
1160968794 19:1758337-1758359 CAGAGATGGGAGAGGAACTCTGG + Intronic
1160970696 19:1766554-1766576 CAGAGAGGGGAGAGGGAGGGAGG + Intronic
1160975516 19:1790503-1790525 CAGAGGAGGGAGGGGGAAGAGGG - Intronic
1161570975 19:5030794-5030816 CAGAGCAGGGCCAGGGACCCGGG + Intronic
1162534766 19:11256325-11256347 CAGAGGAGGGAGAGGGGAGGAGG + Intronic
1163458708 19:17423879-17423901 CAGAGTTGGGAGAGGGAAGTAGG - Intronic
1163692054 19:18743509-18743531 CAGACCAGGGACAGGGAAGAGGG - Intronic
1163815226 19:19460938-19460960 CAGAGCACACAGAGGGACGGGGG - Intronic
1165129040 19:33621158-33621180 CAGAGTAGGGACAGGAACACGGG - Intergenic
1165333812 19:35155458-35155480 CAGGGCAGGGAAAGGGCTGCAGG + Exonic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166690957 19:44821017-44821039 CTGGGCAGGGAGAGGGAAGAGGG - Exonic
1166871927 19:45876552-45876574 GAGAGCTGGGAGAGGGATGGAGG - Intergenic
1167103858 19:47419377-47419399 CAGAGCCGGGGAAGGGACGGGGG - Intronic
1167250513 19:48396387-48396409 CTCAGTAGGGAGTGGGACGCGGG + Intronic
1167265332 19:48480294-48480316 CCCAGCAGGGACCGGGACGCGGG + Intronic
1167429025 19:49443646-49443668 AAGAGGAGGGAGTGGGAAGCGGG + Intergenic
1167529098 19:50003835-50003857 CAGTGCAGGGAGAGCGGGGCTGG - Intronic
1167748609 19:51367233-51367255 CGGAGCAGGGAGAGGAAGGTGGG + Intronic
1168290173 19:55353786-55353808 AAAGGCAGGGAGCGGGACGCCGG + Intronic
1168294001 19:55370016-55370038 CCGAGCAGGGGCAGGGACGCAGG - Intronic
1168414659 19:56160509-56160531 TGGAGGAGGGAGAGGGAGGCTGG - Exonic
925068865 2:950876-950898 CGGAGCCGGCAGAGGGGCGCGGG + Exonic
925225609 2:2181954-2181976 CAGAGCTGGGATGGGGACCCAGG + Intronic
925336752 2:3104386-3104408 CAGAGCAGGGAGAGGATTCCCGG + Intergenic
926122669 2:10253435-10253457 CAGAGCAAGGAGCGAGAGGCAGG - Intergenic
926555590 2:14354240-14354262 CAGGGCAGGGAAGGGGAGGCAGG + Intergenic
926837782 2:17043613-17043635 CAGAGCAGGGATGAGGACCCAGG + Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
927506916 2:23620756-23620778 CAGAGGTGGGAGAGGGAGGCAGG + Intronic
927557890 2:24049029-24049051 CAGAGCTGGGGGAGGGAGGGAGG - Intronic
927720036 2:25376661-25376683 CAGAGGTGGGTGAGGGATGCTGG + Intergenic
927848461 2:26484359-26484381 GAGAGCAGGGTGAGGGAGACGGG + Intronic
928194178 2:29202501-29202523 GAGAGCAGAGAGAGGGAGGTGGG - Intronic
929411102 2:41698087-41698109 CAGAGAAGGGAGAGAGACAGAGG - Intergenic
929583237 2:43097734-43097756 GAGAGCAGGGAGTGGGAAGTTGG + Intergenic
929593682 2:43162549-43162571 CAGAGCTGGGAGTAGGACCCAGG - Intergenic
930277963 2:49335757-49335779 AGGAACAGGGAGGGGGACGCTGG + Intergenic
930701144 2:54457894-54457916 CAGTGCAGGCAGAGGGGAGCCGG + Intronic
931682912 2:64767989-64768011 CAGGGCGGGGAGCGGGAAGCCGG - Intergenic
931682921 2:64768013-64768035 CCTAGGAGGGAGAGGGGCGCGGG - Intergenic
932220535 2:69995681-69995703 GGGAGCAGGAAGAGGGACACAGG + Intergenic
932437467 2:71711087-71711109 CAGGGCAGGGAGAGGGCAGAAGG + Intergenic
932865484 2:75336960-75336982 CTGAGGAGGGAGATGGAGGCTGG - Intergenic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
933876056 2:86623174-86623196 CACAGAAAGGAGAGGGGCGCGGG + Exonic
933969904 2:87461933-87461955 CAGAGCAGGCAGATGGTCACAGG + Intergenic
935744232 2:106176813-106176835 CAGAGCAGGGCGAGGACCACAGG - Intronic
935757052 2:106284442-106284464 CAGAGCAGACACAGGGAAGCTGG - Intergenic
935815425 2:106842699-106842721 CTGAACAGTGAGAAGGACGCCGG + Intronic
936075645 2:109399980-109400002 CAGGGCAGCCAGAGGGACTCTGG - Intronic
936112509 2:109676546-109676568 CAGAGCAGACACAGGGAAGCTGG + Intergenic
936247164 2:110838425-110838447 CAGAGCAGGGCGAGGGGCTTTGG + Intronic
936323877 2:111488563-111488585 CAGAGCAGGCAGATGGTCACAGG - Intergenic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
936514684 2:113174226-113174248 CAGAGCAGGAAGGGGGAAGGAGG - Intronic
938115913 2:128602836-128602858 CGGAACAGGGAGAGGGACGTTGG + Intergenic
938410117 2:131056598-131056620 CAGGGGAGGGAGAGGGTCTCTGG + Intronic
938811927 2:134861830-134861852 GAGAGGACTGAGAGGGACGCAGG + Intronic
939606673 2:144262823-144262845 GGGAGCAGGGAGAGGGGAGCGGG + Intronic
940364871 2:152837134-152837156 CAGATCAGGGAAAGGGCTGCAGG - Intergenic
940982083 2:160014902-160014924 AAGGACAGGGAGAGGGAGGCTGG + Intronic
942058175 2:172204656-172204678 CAGAGCAGGGTGAGGGAGACTGG - Intergenic
943635409 2:190301469-190301491 CAGAGGAGGGAGAGGGAGTTGGG + Intronic
943712445 2:191111975-191111997 CAGAGCACGGAGAGGTAGGAGGG + Intronic
947602889 2:231465200-231465222 CAGGGCAGGGAGAGGGGCCTGGG + Intronic
948072797 2:235140998-235141020 GAGAGCTGGGAAGGGGACGCGGG - Intergenic
948769673 2:240244815-240244837 GAGAGCAGGGAGAGGAAGCCAGG - Intergenic
948789430 2:240369746-240369768 CTGGGCAGGGCGAGGGACACTGG + Intergenic
1169912016 20:10654755-10654777 CTGGGCAGGGAGAGGGAGGTGGG + Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170601183 20:17842974-17842996 GAAAGCAGGCAGAGGGATGCTGG - Intergenic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170783637 20:19449069-19449091 GTGGGCAGGGAGAGGGAGGCAGG + Intronic
1171034646 20:21705557-21705579 CAGGGCGGGGAGGGGGGCGCTGG + Intergenic
1171278574 20:23878643-23878665 CTGTGCAGGGAGAGGGCTGCAGG + Intronic
1172015397 20:31870120-31870142 CACAGCGGGGACAGAGACGCAGG + Intronic
1172149446 20:32779921-32779943 CTGAGCAGGGAGAGGGGGCCAGG + Intronic
1172161473 20:32871783-32871805 CAGAACAGGAAGAAGGACACTGG - Intronic
1172223465 20:33289091-33289113 CAGAGCAAGGCCAGGGACGGTGG + Intronic
1172579307 20:36034250-36034272 CTGAGAAGGGAGAGAGACTCTGG + Intergenic
1172644998 20:36463431-36463453 CAGAGCTGGGACAGGGATCCAGG + Intronic
1172788515 20:37486360-37486382 CAGGGCAGTGAGAGGGGCCCTGG + Intergenic
1172844825 20:37923628-37923650 CTGAGCAGGGAGGGGGGCTCAGG + Intronic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1173167748 20:40697875-40697897 CAGAGCAGGGAGGGAGAGACTGG + Intergenic
1173643590 20:44620004-44620026 AAGGGCAGGGAGAGGGGCCCAGG - Intronic
1173659871 20:44725569-44725591 CAGAGCCGGGAGAGGAAAGGTGG + Intronic
1173729397 20:45318000-45318022 CAGGGCAGGGACAGGGACTCAGG - Intergenic
1173810294 20:45951263-45951285 CAGAGGTTGGAGAGGGAAGCAGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173849398 20:46208343-46208365 CAGAGCAGGGATGGGGCAGCTGG - Intronic
1173873837 20:46357576-46357598 CAGAGCAGGAAGAGGGGCTGGGG - Intronic
1174164728 20:48576676-48576698 CACAGCAGGGAGAGGGGCATGGG - Intergenic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174215285 20:48911776-48911798 GAGGTCAGGGAGAGGGAGGCAGG - Intergenic
1174292556 20:49519457-49519479 GAGAGCCGGGAGTGGGAAGCTGG - Intronic
1174418047 20:50380456-50380478 CAGTGCAGGGATGGGGACGTGGG + Intergenic
1174863622 20:54114846-54114868 CAGACCAGGGAGAGGCCAGCAGG + Intergenic
1175143957 20:56881825-56881847 CAGAGCTGGGACGGGGACCCAGG + Intergenic
1175361658 20:58415943-58415965 CAGAGTAGGGAGAGGAAGGTTGG + Intronic
1175546025 20:59778338-59778360 GCGAGCCGGGAGAGGGAGGCAGG - Intronic
1175773089 20:61635864-61635886 CAGAGCAGGGGGCAGGACACAGG + Intronic
1175802688 20:61810173-61810195 CAGAGATGGGTGAGGGAGGCCGG + Intronic
1175912706 20:62412445-62412467 CAGAGGAGGGCGAGGGTGGCCGG - Intronic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1176135431 20:63520288-63520310 CAGAGCTGTGAGGGGGACTCGGG + Intergenic
1176285856 21:5019134-5019156 CAGAGCTGGGAGAGGCAGGTAGG + Intergenic
1178370098 21:32020378-32020400 CAGCCCAGGGAGAGGGAAACTGG - Intronic
1178488284 21:33032462-33032484 CTGACTAGGGAGAGGGACGTGGG + Intergenic
1179343201 21:40531847-40531869 CAGAGCATTGAGTGGGATGCTGG - Intronic
1179788571 21:43743099-43743121 CAGAGCGGGGGGAGGGAGGTGGG - Intronic
1179871325 21:44244341-44244363 CAGAGCTGGGAGAGGCAGGTAGG - Intergenic
1180829006 22:18888251-18888273 CAGAGCGGGGAGATGGGCCCTGG + Intergenic
1180882483 22:19215864-19215886 CAGAGCAGTAAGAGGAGCGCAGG + Intronic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181525687 22:23484404-23484426 CAGAGCGGGGAGATGGCCCCTGG + Intergenic
1181811395 22:25405551-25405573 CAGGGCAGGGCGAGGAGCGCGGG - Intergenic
1182036549 22:27202979-27203001 CCGAGGAGGGGGAGGGCCGCGGG - Intergenic
1182141443 22:27962846-27962868 CAGAGCAGGGTGTGGGCCCCAGG + Intergenic
1182620158 22:31614431-31614453 CACAGCAGGGACCGGGACCCAGG - Intronic
1183025905 22:35065914-35065936 CAGAGCAGGGGAAGGGAAGGTGG - Intergenic
1183060705 22:35334831-35334853 CAGTGCAGGGAGGGGGGCGGGGG - Intronic
1183433488 22:37780126-37780148 GAGAGCAGGGGGACGGACGGAGG - Intergenic
1183485702 22:38086634-38086656 CAGGGCAGAGAGAGGGGCTCAGG + Intronic
1183499801 22:38171993-38172015 CAGAGCAAGGAGAGAGAACCTGG - Intronic
1183515253 22:38261807-38261829 CAGAGCAGGTACAGGGATCCTGG - Intronic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1183573478 22:38671767-38671789 CAGAGCTGGGTGAGGAACCCAGG - Intronic
1184153772 22:42653616-42653638 CAGAGCAGGTTGAGGGAAGTTGG + Intergenic
1184268834 22:43365937-43365959 CAGACCATGGAGAGAGAGGCTGG + Intergenic
1184444298 22:44538469-44538491 CAGAGCAGGGATTTGAACGCTGG + Intergenic
1184766546 22:46575518-46575540 CAGAGTAGGGAGCGGTAGGCAGG + Intergenic
1184806647 22:46798879-46798901 CAGGGCAGGGAGAGGGTTTCCGG + Intronic
1184907061 22:47495440-47495462 CAGAACAGGAAGTGGGACACAGG - Intergenic
1185098545 22:48825252-48825274 CAGAGAAGGGAGTGAGAGGCAGG + Intronic
1185182311 22:49370369-49370391 CAGAGCAGAGACAGGGCTGCAGG + Intergenic
1185205050 22:49533141-49533163 CACAGCAGGGCGAGGGACCCTGG - Intronic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
1203279097 22_KI270734v1_random:114239-114261 CAGAGCGGGGAGATGGGCCCTGG + Intergenic
950509255 3:13415919-13415941 TGGGGCAGGGAGAGGGACCCAGG + Intronic
950584038 3:13880252-13880274 CGGAGCAGGGAGGGGGCCCCCGG - Intergenic
950637524 3:14325217-14325239 CAGAGCAGGGAGAGGGCTGGAGG - Intergenic
950703355 3:14765673-14765695 CAGAGCAGGTGCAGGGAAGCTGG + Intronic
951072084 3:18341301-18341323 AGGAGAAGGGAGAGGGACACAGG - Intronic
952684384 3:36132047-36132069 CAGAGCTGGGAGAGGAGCCCTGG - Intergenic
952969775 3:38643546-38643568 CAGAGCAGAGAGAGGTAATCTGG - Intronic
953221094 3:40972278-40972300 TAGAGTAGGGAGAAGGATGCAGG - Intergenic
953890512 3:46748891-46748913 CAGTGCAGGGACAGGGTGGCAGG + Intronic
954036227 3:47852657-47852679 CAAAGCAGGGAGATGGGCCCAGG + Exonic
954374215 3:50185613-50185635 CAGGGCAGGGAGGGGGTCCCTGG + Intronic
954628035 3:52033378-52033400 GAGAGCAGGGAGAGGGGTGCAGG - Intergenic
954871119 3:53768163-53768185 CAGAATAGGGAGAGGCCCGCAGG + Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955709624 3:61764652-61764674 CATTGCAGGTAGAGGGAAGCGGG + Intronic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
960700403 3:120433885-120433907 CAGAGCAGCAAGAGGTAAGCTGG + Intronic
960860375 3:122146726-122146748 CAGAGCAGCAAGAGAGAGGCAGG - Intergenic
961430083 3:126875212-126875234 CAGAGCAGGAAGAGGGAAGAAGG + Intronic
961440072 3:126947539-126947561 CAGAGCAGTGAGAGGGGCCCGGG - Intronic
961466618 3:127085620-127085642 CTGTGCAGGGAGAGGGAGTCTGG + Intergenic
961563697 3:127748364-127748386 CAGAGGTGGGAGAGGGAGGAGGG + Intronic
961622721 3:128237598-128237620 CAGAGCTGGGAGAGGGGAGCAGG - Intronic
961812578 3:129530400-129530422 CCGAGAAGGGAGAGGGAGGAAGG + Intronic
963259141 3:143176289-143176311 CTGAGCAGGGAGGGGGCCTCAGG + Intergenic
964499779 3:157335942-157335964 AACAGCAGGCAGAGGGAGGCTGG - Intronic
966509777 3:180748897-180748919 CTGGGCAGGGAGAGGGAAGGAGG + Intronic
966711753 3:182979982-182980004 CGGAGGAGGGAGAGGCGCGCCGG + Intronic
966818061 3:183905370-183905392 CAGAGCAAGGAGAGTGATGGAGG + Intergenic
967676481 3:192305058-192305080 CAGAGAAGGGAGAGGAAGGAGGG + Intronic
968041986 3:195596353-195596375 CAGAACAGAGAGAGGGCCACAGG + Intergenic
968541892 4:1172182-1172204 CGGAGCAGGGAGGGGGTCGCGGG - Intronic
968557095 4:1251016-1251038 CTGAGAACGGAGAGGGATGCAGG + Intergenic
968780692 4:2578936-2578958 CAGAGGAGGTAGAGGAAGGCAGG + Intronic
968973995 4:3811639-3811661 CAGTGCAGGGAGGGGGGTGCTGG + Intergenic
969060788 4:4432633-4432655 CAGAGCAGTGAGAGGGCCCAGGG + Intronic
969135815 4:5027880-5027902 CAGAGCTGGGAGATGGATGGAGG + Intergenic
969146689 4:5130327-5130349 GAGAGCAAGGAGAGTGACGGTGG + Intronic
969152882 4:5185528-5185550 GAGGGCAGGGAAAGGGACGTGGG + Intronic
969398321 4:6937714-6937736 CAGGGAAGGGAGAGAGAGGCAGG + Intronic
969527186 4:7709829-7709851 CAGAGCAGGGAGGGGTCCCCAGG + Intronic
969559092 4:7934607-7934629 CAGAGGAGAGAGAGGAAAGCAGG + Intronic
969861103 4:10035899-10035921 CAGAGCAGTGGATGGGACGCTGG - Intronic
969997369 4:11326674-11326696 AAGAGAAGGGAGAGGGCTGCAGG + Intergenic
970223584 4:13834964-13834986 CAGAGCAGGGAGCTGGTCGAAGG - Intergenic
970326329 4:14928759-14928781 CAGAGCAGGGCCAGGGGCCCAGG + Intergenic
970528428 4:16956596-16956618 CAGACCTGGGAGTGGGACTCAGG - Intergenic
970590821 4:17559380-17559402 CAGAGCAGGGATTTGGACCCTGG - Intergenic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
971728902 4:30350538-30350560 CAGAGCAGGGAGAGGGACAGAGG - Intergenic
972371165 4:38424682-38424704 AAGGGCAGGGGGAGGAACGCGGG + Intergenic
972663629 4:41142714-41142736 CAGAGAAGAGAGAAGGACGTTGG - Intronic
972836429 4:42876127-42876149 CAGAGAAGGAAGAGGGTAGCAGG + Intergenic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
978120617 4:105074703-105074725 CAAAGCAGAGAGAGGGAGGGAGG - Intergenic
979010308 4:115358460-115358482 CAGAGCAAAGAGAGGGCCACAGG - Intergenic
979303105 4:119110085-119110107 CACAGCAAGGAGAGGGAGTCTGG - Intergenic
980493482 4:133560651-133560673 AGGAGCAGGGAGAGGGAGCCAGG + Intergenic
980893470 4:138838786-138838808 CAGGGTAAGGAGAGGGGCGCGGG - Intergenic
981000401 4:139823640-139823662 CAGAGCGGGGTGAGGGAAGGCGG - Intronic
981816739 4:148839660-148839682 CAGAGGAGGGAGAGGGTTGGGGG + Intergenic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
985520786 5:373236-373258 CAGGGCAGGGCCAGGGCCGCGGG - Intronic
985657890 5:1141490-1141512 GAGAGCACAGAGAGGGAGGCAGG - Intergenic
985784425 5:1886584-1886606 GAGAGGAGGGAGAGGGCCGCGGG - Intronic
986004202 5:3654410-3654432 CAGAGTGGGGAGAGGGACTTTGG + Intergenic
986052529 5:4103490-4103512 CAGAGAAGCAAGAGGGACCCAGG + Intergenic
987035822 5:14017342-14017364 CAAAGCAGAGAGTGGGATGCTGG - Intergenic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
991055887 5:62319676-62319698 CAGAGCAGTGAAAGAGAAGCTGG - Intronic
992093327 5:73338844-73338866 CAGAGCGGGGAGAGGGAGGAGGG + Intergenic
992876970 5:81065927-81065949 AAGCGCAGGGAGGGGGACGTTGG + Intronic
992967577 5:82018844-82018866 CAGAGTAGGAAAAGGGAAGCAGG - Intronic
995256796 5:110056176-110056198 CAGAGAAGGGAGAGAGCAGCTGG + Intergenic
995528265 5:113068047-113068069 AAGAGGAGGAAGAGGGACTCTGG + Intronic
996847777 5:127919832-127919854 CAGAGCAGATAGAGGGACAGAGG - Intergenic
997383043 5:133450982-133451004 CAGAGGAGGGAGAGGCATGATGG + Intronic
997692375 5:135835375-135835397 CACAGCAGGGAGCGGAGCGCCGG + Intronic
997878091 5:137566886-137566908 CAGAGCAGGGACGGGCAGGCAGG - Intronic
998059088 5:139105029-139105051 CAGGGCAGGGATAGGGCGGCAGG + Intronic
999875720 5:155803577-155803599 CAGAGAAGAGAGAGGGAAGCAGG + Intergenic
1000242473 5:159421369-159421391 CAGAGAAGGGAGAGAGGAGCAGG - Intergenic
1001276187 5:170353519-170353541 CAGAGCAGGGAGGGAGGAGCTGG - Intronic
1001383828 5:171321647-171321669 TGGTGCAGGGAGAGGGAGGCCGG - Intergenic
1001795973 5:174502647-174502669 CAGAGCAGGGAGGTGGACAGAGG + Intergenic
1002214951 5:177624544-177624566 CAGGGGAGGGAGAGGGATGTTGG + Intergenic
1002295751 5:178230237-178230259 CAGAGCAGGGAGAGAGAAGCTGG + Intronic
1002564253 5:180100990-180101012 CAGGGCAGGGTGAGGGACCATGG + Exonic
1002568690 5:180128222-180128244 CACCCCAGGGAGAGGGAGGCTGG - Intronic
1002886082 6:1295505-1295527 AGGAGCAGGGAGAGGAAGGCAGG - Intergenic
1003239800 6:4334314-4334336 CAAGGCTGGGAGAGGGGCGCCGG - Intergenic
1003244171 6:4370183-4370205 CAGAGCAGGCAGAGGGGAGATGG + Intergenic
1003296653 6:4835783-4835805 CGAGGCTGGGAGAGGGACGCCGG - Intronic
1004044375 6:12011601-12011623 CAGGGACGGGAGGGGGACGCGGG - Intronic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083485 6:21980766-21980788 CAGAGCAGGAAGGAGGAGGCTGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1006020415 6:31114595-31114617 CAGAGCAGGGAGTGTGAAGATGG + Intergenic
1006187608 6:32189930-32189952 CGGAGCAGGGAGGGGGCCTCAGG - Exonic
1006197455 6:32254759-32254781 GAGGGCAGGGAGAGGGAGGGGGG + Intergenic
1006378806 6:33685996-33686018 TACAGCACGGAGAGGGAGGCTGG - Intronic
1006632789 6:35441471-35441493 CAGGGCAGGGACAGGGACAGAGG - Intergenic
1007656633 6:43454956-43454978 CCGACGAGGGAGAGGGGCGCCGG + Intronic
1010529015 6:76942899-76942921 CAGAGCAGGGAAAGACACTCTGG + Intergenic
1010703857 6:79083978-79084000 GAAAGCAGGAAGAGGGAAGCAGG - Intergenic
1013161010 6:107544862-107544884 CAGAGCAGGCAGAGGCCAGCAGG - Intronic
1013227971 6:108134194-108134216 CGGGGCAGGGAGAGGGGCGCGGG - Intronic
1013599855 6:111693713-111693735 CAGAGCAGGGAGAGGGAGAGTGG - Intronic
1013608592 6:111773555-111773577 CAGAGGAGGGAGAGGGAGAGGGG + Intronic
1015833063 6:137390150-137390172 CAGAGCAAGAAAAGGCACGCTGG - Intergenic
1016965824 6:149717951-149717973 CAGAGCGGGGAGACGAACGGGGG + Exonic
1016990248 6:149923479-149923501 CAACGCAGGGAGAGGGAAGGCGG - Intergenic
1017018316 6:150118953-150118975 CAGTGCGGGGAGTGGGAGGCTGG + Intergenic
1017852202 6:158314490-158314512 CAGTGCAGGGAGAGGACAGCAGG - Intronic
1018346878 6:162908857-162908879 CAGCACAGGGAGATGGAAGCTGG + Intronic
1018414563 6:163590169-163590191 CAGAGCAGAGGGAGGGCAGCTGG - Intergenic
1018841144 6:167518009-167518031 GTCAGCTGGGAGAGGGACGCAGG + Intergenic
1018901338 6:168053332-168053354 CAGAGCTGGCAGTGGGAGGCTGG - Intergenic
1018964375 6:168473162-168473184 CAGAGCAGGGAGTGGGATCAGGG + Intronic
1019270328 7:143565-143587 CAGACCAGGTACTGGGACGCAGG - Intergenic
1019287339 7:230273-230295 CAGAGCTGGGAGAGGCAAGAAGG + Intronic
1019404821 7:877705-877727 GAGAACAGGGAGGGGGAGGCCGG - Intronic
1019488240 7:1299253-1299275 CAGGCCACGGAGGGGGACGCAGG - Intergenic
1021085884 7:16421004-16421026 CAGGGCGGGGAGCGGGAGGCCGG + Intronic
1022220820 7:28311883-28311905 CAGCGCAGGGAGACCGACACTGG - Intronic
1024047147 7:45592615-45592637 CAGCGCAGGGCCAGGGACACAGG - Intronic
1024323874 7:48093746-48093768 CATAGGAGGGAGAGGGACTGAGG - Intronic
1024945781 7:54806267-54806289 CAGAGCTGGGAGGGGGAGCCAGG + Intergenic
1025188785 7:56881305-56881327 CAGAGCAGGGAGTGGGACAGAGG + Intergenic
1025683150 7:63695615-63695637 CAGAGCAGGGAGTGGGACAGAGG - Intergenic
1026766043 7:73160525-73160547 CAGACCCGGGACAGGGTCGCTGG - Intergenic
1026845519 7:73696991-73697013 CAGAGCAGGGCTGGGGACACAGG - Intronic
1026890721 7:73980342-73980364 CAGAACAGGGAGATGAAAGCTGG + Intergenic
1027042518 7:74970221-74970243 CAGACCCGGGACAGGGTCGCTGG - Intronic
1027051836 7:75025596-75025618 CAGAGGAGGGAGGAGGACGGCGG - Intergenic
1027081125 7:75232136-75232158 CAGACCCGGGACAGGGTCGCTGG + Intergenic
1027165353 7:75830201-75830223 GAAAGCAGGGAGAGAGACGAGGG - Intergenic
1027165793 7:75833543-75833565 GAAAGCAGGGAGAGAGACGAGGG + Intergenic
1027569554 7:79847234-79847256 CAGAGCTGGAAGAGGGATGGAGG - Intergenic
1028518815 7:91706724-91706746 CAGGGCTGGGAGTGGGACTCAGG + Intronic
1028773589 7:94655743-94655765 CAGAGCAGGGAGGGGCCCGCGGG + Intronic
1028815717 7:95141521-95141543 CAGAGAAGGGAGAGGAGAGCTGG - Intronic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029419993 7:100467427-100467449 CCCAGCAGGGAGAGGGACGGAGG + Intronic
1029543093 7:101196099-101196121 CACTGCAGGGAGAGGGAGACAGG + Exonic
1031025328 7:116672802-116672824 CTTAGGAGGGAGAGGGGCGCTGG + Intronic
1031625062 7:123983279-123983301 CAGAGCAGGAAGAGGAACCCAGG - Intergenic
1032097409 7:128946475-128946497 CACAGCAGGGAGAGAAAAGCAGG - Intronic
1032488529 7:132306380-132306402 CAGAGCCAGGAGAGAGACTCAGG - Intronic
1033146976 7:138879594-138879616 GAGTCCAGCGAGAGGGACGCAGG - Exonic
1034040262 7:147870397-147870419 CTGAGCAGGGAGAGATACTCAGG - Intronic
1034286459 7:149886497-149886519 CAGAGTATTGAGAGGGACACTGG + Intergenic
1034441651 7:151088677-151088699 CAGAGCAGGGAGAGGTTTCCGGG + Intronic
1034442543 7:151093776-151093798 CAGAGCAGGGACGGGAACCCAGG - Intronic
1035004446 7:155644762-155644784 CAGAGAAGGGAGGGGGCTGCAGG - Exonic
1035076512 7:156181101-156181123 CAGAGCAAGGAGCTGGCCGCGGG - Intergenic
1035221601 7:157409714-157409736 CAGAGCAGAGGGAGGGAAGCTGG - Intronic
1035259347 7:157651892-157651914 CAGAGGAGGGAGAGGCAGGAAGG - Intronic
1035389946 7:158497219-158497241 CAGGGAAGGGGGAGGGGCGCAGG - Intronic
1035581704 8:744466-744488 CGGAGAAGAGGGAGGGACGCAGG - Intergenic
1035582072 8:746800-746822 CAGAGCAGACAGAGGGAACCTGG - Intergenic
1035770679 8:2144482-2144504 CAGAGCAGGCAGAGGACAGCAGG - Intronic
1036044016 8:5119813-5119835 CAGACCAAGGAGAGGTACCCAGG - Intergenic
1036588203 8:10144605-10144627 AAAAGCAGGGAGAGGGAAGGGGG - Intronic
1037168289 8:15857932-15857954 GTGAGCAGGGAGAGGAACACAGG - Intergenic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037681549 8:21101861-21101883 CAGGGGAGGGAGTGGGAGGCAGG - Intergenic
1037992597 8:23331322-23331344 CAGAGGAGGGAGAAGGGCTCTGG - Intronic
1038035251 8:23681945-23681967 GAGAGGCGGGAGAGGGAGGCAGG + Intronic
1038517758 8:28201874-28201896 CTGAGCAGAGAGAGGGAGGTGGG - Intergenic
1038611775 8:29065577-29065599 CTGAGAAGGGAGAGGGAGGCCGG - Intergenic
1039443427 8:37611471-37611493 CAGAGCAGGAAGAGGGGGACAGG + Intergenic
1039542502 8:38382975-38382997 CAGAGCAGGAAGAGGCGCGCGGG - Intergenic
1039890450 8:41682228-41682250 CAGAGCAGGGAGTGTGAAGGGGG - Intronic
1040654247 8:49486416-49486438 CAGAAAAGGGAGAGGCAAGCTGG - Intergenic
1040663584 8:49604216-49604238 GAGAGTAGGGAGGGGGAAGCAGG - Intergenic
1040676587 8:49757665-49757687 CAGCCCAGGGAGAGGGACTCTGG - Intergenic
1040875784 8:52150572-52150594 GCGGGCAGGGAGAGGGAGGCAGG + Intronic
1040905630 8:52467318-52467340 CAGAGCAGGGAGGGAGCTGCAGG - Intergenic
1040974878 8:53178838-53178860 TAGAGCAGGGAGAGAGACTTGGG + Intergenic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1042018804 8:64347392-64347414 TAGTGCAGGGAGAGAGAGGCAGG - Intergenic
1043316652 8:78931151-78931173 CAGAGCAGGGAGTGGGATACAGG - Intergenic
1047799950 8:128298495-128298517 CAGGGCAGGGAGAGTGACTCAGG - Intergenic
1048579041 8:135715921-135715943 CTGAGCAGGGATAGGGCCTCTGG - Intergenic
1048718276 8:137293064-137293086 TAGAGCAGGGAAAAGGACACTGG + Intergenic
1048833291 8:138496718-138496740 AAGAGGAGAGAGAGGGACCCAGG - Exonic
1049195498 8:141313561-141313583 CGGAGCAGGCGGAAGGACGCTGG - Intergenic
1049198015 8:141326006-141326028 CAGAGCAGGAACAAAGACGCTGG + Intergenic
1049239862 8:141531838-141531860 CAGAGCAGGGGCAGGAAGGCAGG + Intergenic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049363729 8:142226512-142226534 CAGAGCTGGGAGGGGGACCCTGG + Intronic
1049392089 8:142376903-142376925 CAGAGCAGGGAGAGCCACACAGG + Intronic
1049408587 8:142462539-142462561 CAGAGCAGGGAGCTGGGCCCAGG - Intronic
1049537494 8:143189098-143189120 CACAGCAGGGAGAGGTAGGAGGG - Intergenic
1049632539 8:143666422-143666444 CAGAGGAGGGAGGGGCACGCAGG - Intergenic
1049632558 8:143666520-143666542 CAGAGGAGGGAGGGGCACGCAGG - Intergenic
1049632569 8:143666569-143666591 CGGAGGAGGGAGGGGCACGCAGG - Intergenic
1049632580 8:143666618-143666640 CAGAGGAGGGAGGGGCACGCAGG - Intergenic
1049632612 8:143666764-143666786 CAGAGGAGGGAGGGGCACGCAGG - Intergenic
1049720261 8:144112341-144112363 CAGTGCAGGGTGAGGGACCCAGG + Exonic
1049748845 8:144274195-144274217 CAGGGCAGGGAGGGCGCCGCTGG - Intronic
1050309219 9:4335769-4335791 CAGAGTAGGGCAAGGGACCCAGG - Intronic
1052040723 9:23735875-23735897 CAGAGCAAGGAGAGGAAAACAGG + Intronic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053286532 9:36852851-36852873 CAGAGCAGGGCCTGGGACCCTGG + Intronic
1053361896 9:37493979-37494001 CAGAGGAGGGAGAAGGCCTCAGG + Intronic
1056222573 9:84464920-84464942 CACAGCAGGGAGAAGGACTTAGG - Intergenic
1056672200 9:88639810-88639832 CAGAGCTGGGAGAGCAAGGCAGG - Intergenic
1056729733 9:89155317-89155339 AAGAGCAAGGAGAGAGAAGCCGG - Intronic
1056779585 9:89539175-89539197 CAGAGCAAGGAGAGGCAGCCAGG - Intergenic
1057286404 9:93758326-93758348 CAGGGAAGGGAGAGGGACTAAGG - Intergenic
1057727598 9:97579101-97579123 CACGGCAGGCAGAGGGACACTGG - Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058907273 9:109492094-109492116 CAGAGCAGGGGAGGGGACTCGGG + Intronic
1059391361 9:114001522-114001544 CAGAACAGGGACAGGGACCCAGG + Intronic
1059393838 9:114017983-114018005 CAGAGCAGTGAGGGGCAAGCAGG - Intronic
1060585523 9:124782951-124782973 CAGAGCTGGGAAGGGGACCCAGG + Intronic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1060756818 9:126219750-126219772 GAGAGCAGGGAGGGGGTTGCGGG - Intergenic
1060798344 9:126527512-126527534 CAGAGCAGGGACAAAGTCGCTGG - Intergenic
1060799200 9:126532970-126532992 GAGAGAAGGGAGAGGGCCACTGG - Intergenic
1060839410 9:126782020-126782042 CTGAGCAGGGAGAGAGAGGAGGG + Intergenic
1060980314 9:127788122-127788144 CAGAGCTGGGAGGAGGACCCAGG + Intronic
1061148949 9:128818205-128818227 CAGAGCAGGCACAGGGCCCCAGG - Intergenic
1061873781 9:133534193-133534215 CTAAGCAGGTGGAGGGACGCAGG - Intronic
1062089161 9:134665678-134665700 CAGAGCAGGGACAGGGACGTGGG + Intronic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062269163 9:135700810-135700832 CAGGGCCGGGAGAGGGGCCCAGG - Intergenic
1062392325 9:136338785-136338807 CAGAGCAGGGGATGGGACCCAGG - Intronic
1062491600 9:136807693-136807715 CAAAGCAGGGAGCGGGGCGGCGG - Exonic
1062548916 9:137077212-137077234 CAGGGGACGGAGAGGGACGGGGG + Intergenic
1203768187 EBV:37242-37264 CAGAGCAGGGGGAGGGGCAGGGG + Intergenic
1185499359 X:585182-585204 CAGAGGGTGGAGAGGGACTCAGG + Intergenic
1186079267 X:5912822-5912844 TGGAGCAGGGAGAGGGAAGGAGG + Intronic
1187288104 X:17925595-17925617 CTGAGCCGAGAGAGGGAGGCTGG - Intergenic
1187688416 X:21839678-21839700 CGGTGCAGGGAGGAGGACGCCGG + Exonic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1189261360 X:39681051-39681073 CAGAGCATGGAGGGGGAAGAAGG - Intergenic
1189821383 X:44872995-44873017 CCGAGATGGGAGCGGGACGCAGG - Intergenic
1190570745 X:51779076-51779098 CAGAGCATGGACAGGGATGATGG - Intergenic
1192172927 X:68867936-68867958 GACAGCAGGGAGTGGGAGGCCGG - Intergenic
1192495840 X:71616286-71616308 CAGAGCCGGCAGAGGGAGGGAGG + Exonic
1192844406 X:74890823-74890845 CAGACCAGGGAGTGGCACACGGG + Intronic
1194977663 X:100410116-100410138 CAGCGCCGGGCTAGGGACGCGGG + Exonic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195483838 X:105379620-105379642 CAGAGCAGGGATAGAAACCCAGG - Intronic
1195903697 X:109824112-109824134 CAGAGCAAGGAGAGGGTCCAGGG - Intergenic
1197199472 X:123735210-123735232 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1198378578 X:136063211-136063233 AAGAGCTGGGATAGGGAGGCAGG - Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199967282 X:152830884-152830906 CAGCGCGGGGAGGGGCACGCTGG + Intergenic
1200059804 X:153479222-153479244 GAGAGCTGGGAGAGGCACGGTGG - Intronic
1201515218 Y:14812995-14813017 TGGAGCAGGGAGAGGGAAGGTGG - Intronic